Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M500156200 on January 18, 2005

J. Biol. Chem., Vol. 280, Issue 14, 14252-14263, April 8, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/14/14252    most recent
M500156200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leo, E.
Right arrow Articles by Fisher, L. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leo, E.
Right arrow Articles by Fisher, L. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Novel Symmetric and Asymmetric DNA Scission Determinants for Streptococcus pneumoniae Topoisomerase IV and Gyrase Are Clustered at the DNA Breakage Site*

Elisabetta Leo{ddagger}, Katherine A. Gould{ddagger}, Xiao-Su Pan{ddagger}, Giovanni Capranico§, Mark R. Sanderson||, Manlio Palumbo**, and L. Mark Fisher{ddagger}{ddagger}{ddagger}

From the {ddagger}Molecular Genetics Group, Department of Basic Medical Sciences-Biochemistry and Immunology, St. George'sHospital Medical School, University of London, London SW17 0RE, United Kingdom, §G. Moruzzi Department of Biochemistry, University of Bologna, 40126 Bologna, Italy, ||Randall Centre for Cell and Molecular Biophysics, King's College, Guys' Campus, London Bridge, London SE1 1UL, United Kingdom, and the **Department of Pharmaceutical Sciences, University of Padua, 35131 Padua, Italy

Received for publication, January 5, 2005 , and in revised form, January 18, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Topoisomerase (topo) IV and gyrase are bacterial type IIA DNA topoisomerases essential for DNA replication and chromosome segregation that act via a transient double-stranded DNA break involving a covalent enzyme-DNA "cleavage complex." Despite their mechanistic importance, the DNA breakage determinants are not understood for any bacterial type II enzyme. We investigated DNA cleavage by Streptococcus pneumoniae topo IV and gyrase stabilized by gemifloxacin and other antipneumococcal fluoroquinolones. Topo IV and gyrase induce distinct but overlapping repertoires of double-strand DNA breakage sites that were essentially identical for seven different quinolones and were augmented (in intensity) by positive or negative supercoiling. Sequence analysis of 180 topo IV and 126 gyrase sites promoted by gemifloxacin on pneumococcal DNA revealed the respective consensus sequences: G(G/C)(A/T)A*GNNCT(T/A)N(C/A) and GN4G(G/C)(A/C)G*GNNCTTN(C/A) (preferred bases are underlined; disfavored bases are in small capitals; N indicates no preference; and asterisk indicates DNA scission between -1 and +1 positions). Both enzymes show strong preferences for bases clustered symmetrically around the DNA scission site, i.e. +1G/+4C, -4G/+8C, and particularly the novel -2A/+6T, but with no preference at +2/+3 within the staggered 4-bp overhang. Asymmetric elements include -3G and several unfavored bases. These cleavage preferences, the first for Gram-positive type IIA topoisomerases, differ markedly from those reported for Escherichia coli topo IV (consensus (A/G)*T/A) and gyrase, which are based on fewer sites. However, both pneumococcal enzymes cleaved an E. coli gyrase site suggesting overlap in gyrase determinants. We propose a model for the cleavage complex of topo IV/gyrase that accommodates the unique -2A/+6T and other preferences.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Type IIA DNA topoisomerases mediate the ATP-dependent transport of one DNA helix through another DNA segment via a transient enzyme-bridged double-strand break (1–4). This maneuver allows the control of DNA topology essential for a variety of DNA transactions, including DNA replication, transcription, and recombination. Bacteria usually express two essential type IIA enzymes, DNA topoisomerase (topo)1 IV and DNA gyrase (5, 6), which were first identified in Escherichia coli (7, 8). Gyrase is unique in catalyzing the negative supercoiling of closed circular DNA. It is believed to act ahead of replication forks promoting fork progression by removing the positive supercoils that arise during DNA unwinding (9). By contrast, topo IV relaxes positive and negative supercoils and has evolved as an efficient DNA decatenase with a specialized role in separating daughter chromosomes at cell division (9). In addition to their biological functions, topo IV and gyrase are also targets for the quinolone class of antibacterial drugs (5, 10).

Topo IV and gyrase are tetrameric complexes comprising two subunits each of ParC and ParE, and GyrA and GyrB, respectively (5). The ParC and GyrA subunits are homologous in their N-terminal domain that carries the DNA breakage-reunion function but diverge in their C-terminal regions that also contribute to DNA binding (11). The ParE and GyrB proteins contain the ATPase site involved in energy transduction and are closely homologous, both in primary sequence and structure. Early work established that gyrase and topo IV act by introducing a transient double-stranded break into DNA and passing a second helical segment through the break that is then resealed (12, 13). Following the mechanism first elaborated for yeast topo II (20), gyrase and topo IV are believed to catalyze DNA strand passage by functioning as an ATP-operated clamp. According to the model, the open enzyme clamp first binds a DNA segment, termed the "gate" or G segment, at a site formed by the breakage-reunion domains. Binding of ATP causes closure of the clamp capturing a second DNA helix, termed the T or "translocated" segment. In events coupled to ATP hydrolysis, the T segment is then passed through a transient double-strand DNA break in the G segment and is released by the opening of a protein gate, prior to the enzyme resetting to the open clamp form. The T and G segments may be part of the same DNA molecule leading to DNA supercoiling-relaxation or knotting-unknotting. Alternatively, the G and T segments may belong to different molecules allowing decatenation of interlocked DNA. For gyrase, it appears that wrapping of a 120–150-bp DNA region encompassing the DNA breakage site on the G segment favors intramolecular DNA strand passage producing DNA supercoiling (13–16), whereas the absence of DNA wrapping on topo IV allows efficient intermolecular DNA passage and chromosome decatenation.

Transient double-strand DNA breakage by topo IV and gyrase proceeds via an enzyme-DNA intermediate termed the "cleavage complex" involving a 4-bp staggered break and covalent attachment of ParC (GyrA) subunits to each 5' DNA end through a phosphotyrosine linkage (with Tyr-122 in E. coli GyrA) (2, 5). Protein-DNA linkage preserves the energy of the DNA phosphodiester bond and allows resealing of the DNA backbone by attack of the 3'-OH ends of the broken DNA. The breakage-reunion equilibrium is very much toward the sealed DNA (closed G gate), perhaps a safeguard against the inadvertent release of lethal double-stranded breaks in vivo. The cleavage complex is, however, stabilized by quinolones and is then detectable as a frank double-stranded DNA break on addition of a denaturant such as SDS. Unlike restriction enzymes, DNA cleavage occurs at specific although degenerate sequences and generates 5' ends linked to ParC (GyrA) protein (14–17). The cleavage determinants are poorly understood. Even for E. coli gyrase, relatively few sites have been analyzed and compared. The most extensive analysis to date involved only 19 sites induced in E. coli on plasmid pBR322 and generated a 20-bp consensus (18). However, it is not clear if all these sites are highly preferred. Much less is known about the cleavage specificity of topo IV. In the one study thus far, norfloxacin-promoted DNA breakage sites by the E. coli enzyme were mapped but only in one strand of a linear DNA generating a weak two-base consensus (17). It is clear that the sequence determinants for DNA breakage have yet to be convincingly established for either topo IV or gyrase.

Site-specific DNA breakage is important for the physiological functions of topo IV and gyrase and for their roles as quinolone targets. The proposed action of gyrase ahead of replication forks and topo IV behind has been invoked to explain why gyrase is the primary target of quinolones in E. coli (9, 19). According to the model, a replication fork is more likely to collide with a gyrase-quinolone-DNA complex converting it into a lethal lesion, possibly an irreversible double-stranded DNA break. By contrast, topo IV-quinolone-DNA complexes are envisaged to form behind the replication fork, allowing time for DNA repair by uvrD-dependent processes. The model is supported by genetic studies showing that quinolone action through gyrase is rapidly lethal to E. coli, whereas killing through topo IV (in quinolone-resistant gyrA mutants) occurs much more slowly (19). However, recent work is at odds with some aspects of the model (for a review see Ref. 20). First, the much greater activity of E. coli topo IV in relaxing positive over negative supercoils suggests the enzyme could act selectively to remove replication-induced positive supercoils while preserving the overall negative supercoiling of the bacterial chromosome (21). Indeed, microarray studies of E. coli DNA replication have shown that either topo IV or gyrase can support replication fork movement in vivo (22). Second, for Gram-positive bacteria such as Streptococcus pneumoniae (the pneumococcus), many quinolones induce cleavage complex formation much more efficiently with topo IV than gyrase in vitro (23). However, depending on the structure of the drug, either enzyme can be the primary intracellular quinolone target in S. pneumoniae (24–26). These unexpected features suggest that either topo IV or gyrase can act ahead of replication forks or that the detailed replication model developed for E. coli may not hold in the pneumococcus. Quinolone targeting of topo IV and the possibility of overlapping type II topoisomerase functions highlight the need to understand the site specificity of both topo IV and gyrase.

Previous studies of DNA cleavage by type IIA enzymes from Gram-positive organisms focused on gyrase purified from Micrococcus luteus but were severely limited by the inefficient capture of cleavage complexes afforded by oxolinic acid and the other quinolones then available (15). In this paper we have exploited recently developed and highly potent anti-pneumococcal quinolones (Fig. 1) (27) to investigate the topological and sequence determinants of quinolone-mediated DNA breakage by topo IV and gyrase from S. pneumoniae. This study presents the first analysis of DNA scission by type IIA topoisomerases from a Gram-positive bacterium.



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 1.
Structures of fluoroquinolones used in this study. Numbering of the fluoroquinolone ring system is shown.

 

   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Reagents—Sources were as follows: [{gamma}-33P]ATP (3000 Ci/mmol), ICN Biomedicals NV/SA; kDNA, TopoGEN; fmol® DNA cycle sequencing kit, Promega; proteinase K, Sigma; restriction enzymes, MBI Fermentas and New England Biolabs; T4 DNA ligase and T4 polynucleotide kinase, Invitrogen; calf thymus topoisomerase I, Invitrogen; TaqDNA polymerase, Bioline; Vent DNA polymerase, New England Biolabs; QIAquick PCR purification kit, Qiagen; glutathione-Sepharose resin and PreScission protease, Amersham Bioscience; oligonucleotides used as PCR primers and for DNA sequencing (Table I), Oswel Ltd. Reverse gyrase from Thermatoga maritima was a generous gift from Claire-Bouthier de la Tour and Michel Duguet. Unless specified otherwise, all other reagents were from Sigma. Fluoroquinolones were obtained as follows: gemifloxacin and gatifloxacin, GlaxoSmithKline; levofloxacin, McNeil-Ortho; ciprofloxacin and moxifloxacin, Bayer; sparfloxacin, Dainippon; clinafloxacin, Pfizer.


View this table:
[in this window]
[in a new window]
  		TABLE I
Oligonucleotides used in this study

 
Bacterial Strains and Plasmids—S. pneumoniae strain 7785 used as a source of genomic DNA for PCRs has been described (28). E. coli strains XL-Blue used for DNA cloning and BL21({lambda} DE3)pLysS used for protein expression were obtained from Stratagene and Novagen. Plasmid pXP1 carrying a 4.3-kb HindIII fragment of the S. pneumoniae parE-parC locus cloned in pBluescript SK+/- was used in mapping topoisomerase cleavage sites and the effects of supercoiling on cleavage (28). Plasmids pXP9, pXP10, pXP13, and pXP14 used for the expression of S. pneumoniae topoisomerase IV and gyrase subunits have been described previously (23). Coding regions of S. pneumoniae parC were amplified by PCR and cloned into plasmid pGEX-6P1 (Amersham Biosciences) for expression of GST ParC fusion proteins. Negatively supercoiled plasmid pBR322 used in enzyme assays was from Invitrogen. Linear pBR322 was generated by digestion with EcoRI.

S. pneumoniae Topo IV and Gyrase—Highly active recombinant S. pneumoniae topo IV and gyrase enzymes were reconstituted from C-terminally His-tagged ParC and GyrA subunits and N-terminally His-tagged ParE and GyrB proteins (23). Proteins were expressed in E. coli and purified to >95% homogeneity as described previously (23) except that E. coli cells were induced with 0.4 mM isopropyl-{beta}-D-thiogalactopyranoside, and protein expression was carried out for 12 h at 16°C, a modification that produced higher yields of soluble protein. The purified tagged proteins were demonstrably free of host E. coli topoisomerase activity (23).

To eliminate the possibility that the His tags may affect DNA cleavage specificity, non-His-tagged S. pneumoniae ParC and ParE proteins were also expressed and purified using a GST fusion approach as follows. In the case of ParC, the parC gene (28) was amplified with proofreading Vent DNA polymerase using S. pneumoniae 7785 genomic DNA as template with C4GST (5'-GCTATGGATCCATGTCTAACATTCAAAACA) as forward primer and P7166 (5'-AGAACTTATTGAGCTCTTCACTTA) as reverse primer. C4GST carries the start codon (shown in boldface) and a BamHI restriction site (underlined); P7166 contains the stop codon (boldface) followed by an XhoI site (underlined). PCR was carried out as follows: 1 min denaturation at 94°C, 1 min annealing at 50°C, 3 min extension at 72°C; 30 cycles. The resulting 2.5-kb product was digested with BamHI and XhoI, purified from low gelling agarose, and ligated into BamHI-XhoI-cut GST expression plasmid pGEX-6P1 (that had been similarly gel-purified) prior to transformation of E. coli XL-Blue. Plasmids from drug-resistant colonies were grown, and the parC gene of one recombinant plasmid, pEL1, was sequenced in full. Plasmid pEL1 was then transformed into the expression host BL21({lambda}DE3)pLysS. A single colony of transformed cells from an overnight plate was used to inoculate 250 ml of Luria Bertani broth containing 100 µg/ml ampicillin and grown at 37°C. When the A600 had reached 0.5, the culture was induced with 0.4 mM isopropyl-{beta}-D-thiogalactopyranoside, and incubation continued overnight at 16°C. Bacteria were harvested by centrifugation at 5,000 x g and then resuspended in phosphate-buffered saline buffer, pH 7.3, containing 0.5% Triton. After sonication, the cell lysate was centrifuged at 35,000 x g for1hat4°C.The supernatant was collected and incubated with 200 µl of glutathione-Sepharose resin for 30 min. After several washes with phosphate-buffered saline, resin-bound GST-ParC fusion protein was cleaved by treatment with PreScission Protease at 4°C for 16 h with gentle agitation in Protein Cleavage Buffer, 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM DTT. Both the cleaved GST protein and the PreScission Protease remain attached to the resin, allowing the released nontagged ParC protein to be eluted from the beads.

A similar approach was used to produce nontagged S. pneumoniae ParE. The parE gene (28) was amplified by PCR from strain 7785 genomic DNA using Vent polymerase and forward primer EGST (5'-GGAGGGGATCCATGTCAAAAAAGGAAATCA; BamHI site underlined and initiation codon in boldface) and reverse primer N7044 (TATTTGGATCCTTAAAACACTGTCGC; BamHI site underlined and stop codon in boldface). PCR was performed for 1 min at 95°C, 1 min at 52°C, 3 min at 72°C; 30 cycles. The 1.9-kb parE PCR product was digested with BamHI, purified by agarose gel electrophoresis, ligated to dephosphorylated BamHI-cut vector pGEX-6P1, and used to transform E. coli XL-Blue. One plasmid, pEL2, containing a correctly oriented parE BamHI fragment, was transformed into BL21({lambda}DE3)pLysS. The expression and purification of GST-ParE and the recovery of ParE were performed as described for ParC. The resulting ParC and ParE proteins were recovered at >90% homogeneity.

The specific activities of the non-His-tagged ParC and ParE proteins were comparable with those of the His-tagged proteins when examined in DNA supercoiling, DNA relaxation, or DNA decatenation assays (23). Moreover, in site-specific DNA cleavage assays, the His-tagged and untagged topo IV complexes showed absolutely identical behavior both in regard to DNA cleavage specificity and DNA cleavage efficiency. Thus, for topo IV (and likely for gyrase, a closely homologous protein complex), the presence or absence of C-terminal or N-terminal tags on ParC and/or ParE does not affect enzyme-DNA complex formation or DNA cleavage processes.

Supercoiled and Linear pXP1 DNA—Various topological forms of plasmid pXP1 (28) were used as DNA cleavage substrates for topo IV and gyrase. Negatively supercoiled pXP1 DNA was recovered in quantity from cultures of pXP1-transformed E. coli XL-Blue cultures using the standard Qiagen plasmid purification kit. Linear pXP1 DNA was generated by digestion with either ScaI or XhoI, followed by precipitation with ethanol.

Plasmid pXP1 (4 µg) was incubated with T. maritima reverse gyrase (40 units) at 85°C for 30 min in reaction buffer containing 50 mM Tris-HCl, pH 8.0, 0.5 mM DTT, 30 µg/ml bovine plasma albumin, 10 mM MgCl2, 120 mM NaCl, and 1 mM ATP (total volume 250 µl). The reaction was stopped by extraction with phenol/chloroform and then chloroform. DNA was precipitated with ethanol and analyzed by two-dimensional agarose gel electrophoresis. A 1.2% gel was run in TPE buffer (90 mM Tris phosphate, 2 mM EDTA), then soaked in TPE buffer containing 3 µg/ml chloroquine, and electrophoresed in the orthogonal direction in the same chloroquine buffer. The gel was washed extensively with TPE buffer containing 1 µg/ml ethidium bromide prior to photography under UV illumination using an Alpha Innotech digital camera, and quantification was by ImageQuant software.

Enzyme-mediated Cleavage of Plasmid DNA—Cleavage of plasmid DNA substrates by S. pneumoniae topo IV was carried out as follows. EcoRI-cut pBR322 (0.4 µg) or pXP1 DNA (linear XhoI-cut, positively supercoiled or negatively supercoiled) (0.3 µg) was incubated with S. pneumoniae ParC (0.45 µg) and ParE (1.7 µg) at 37°C for 1 h in the presence or absence of gemifloxacin or other fluoroquinolones in topo IV reaction buffer: 40 mM Tris-HCl, pH 7.5, 6 mM MgCl2, 10 mM DTT, 200 mM potassium glutamate, and 50 µg/ml BSA (total volume 20 µl). Cleavage complexes were disrupted by addition of SDS to 1% followed by proteinase K at 100 µg/ml and incubation for 30 min at 42°C to digest ParC proteins covalently bound to DNA. DNA from reactions involving linear pBR322 or linear pXP1 was analyzed directly by agarose gel electrophoresis. DNA products derived from reactions involving negatively or positively supercoiled pXP1 substrate were precipitated with ethanol and restricted with XhoI, prior to ethanol precipitation and gel electrophoresis. All samples were loaded on a 1% agarose gel and run at low voltage (approximately 3 V/cm) in TBE buffer. DNA was visualized by staining with ethidium bromide, photographed, and quantitated using an Alpha Innotech digital camera as described above.

Cleavage of pBR322 and the various pXP1 substrates by S. pneumoniae gyrase was carried out as for topo IV by incubation with GyrA (0.45 µg), GyrB (1.7 µg), and gemifloxacin at 25°C for 1 h in gyrase reaction buffer: 35 mM Tris-HCl, pH 7.5, 24 mM KCl, 5 mM DTT, 6.5% glycerol, 1.8 mM spermidine, and 50 µg/ml BSA (total volume 20 µl). Samples were processed and analyzed as described for cleavage with topo IV.

Mapping Gemifloxacin-promoted Double-strand DNA Breaks Mediated by Topo IV and Gyrase in the parE-parC Genes of S. pneumoniae— pXP1 carries a 4.3-kb HindIII fragment of the S. pneumoniae chromosome partially encoding the parE-parC locus (28) and was used for low resolution mapping of cleavage sites. pXP1 linearized at the unique XhoI or ScaI sites was used as a substrate in gemifloxacin-promoted cleavage reactions with topo IV or gyrase. By comparing the sizes of cleavage fragments derived from XhoI-cut and ScaI-cut DNA, cleavage sites could be mapped in the pneumococcal DNA insert to within 50 bp. Specific PCR products (made using primers in Table I) were then employed as substrates to refine the location of sites further and to locate sites in parE and parC sequences not present in pXP1.

Primer Radiolabeling Reaction—Oligonucleotide primers (20 pmol) were 5' end-labeled by incubation with 20 pmol of [{gamma}-33P]ATP and T4 polynucleotide kinase for 45 min at 37°C. The kinase was inactivated at 65°C for 15 min. Labeled primers were used to generate uniquely end-labeled PCR products and cycle sequencing ladders.

Sequence Analysis of Topo IV and Gyrase Cleavage Sites—High resolution mapping of cleavage sites was carried out using parE and parC PCR products (216–360-bp in size) in which the 5' end of the top or bottom strand was radiolabeled by incorporation of one 5' 33P-labeled primer. PCR conditions for amplification from S. pneumoniae 7785 genomic DNA were as follows: denaturation at 95°C for 30 s, annealing at 55°C for 35 s, and extension at 74°C for 1 min, 30 cycles. DNA fragments were purified using the QIAquick PCR purification kit and quantified.

Labeled DNA (~1nM) was incubated at 37°C for 1 h with either topo IV or gyrase in 35 mM Tris-HCl, pH 7.5, 6 mM MgCl2, 24 mM KCl, 5 mM DTT, 6.5% glycerol, and 50 µg/ml BSA. To ensure similar levels of DNA cleavage, gemifloxacin was included at 2.5 µM for topo IV and 20 µM for gyrase. Reactions were stopped by addition of SDS to 1% and incubated with proteinase K as described above for nonradiolabeled substrates. DNA samples were precipitated, resuspended in 3 µl of stop solution (95% formamide, 10 mM NaOH, 0.25% bromphenol blue, 0.25% xylene cyanol), and electrophoresed in a denaturing urea-polyacrylamide sequencing gel (6–8% depending on the length of the PCR product). Gels were dried, exposed to a PhosphorImager screen, and visualized using software provided by Amersham Biosciences and ImageQuant. The exact position of the cleavage bands was determined by comparison with a dideoxy sequence ladder generated by primer extension (using the fmol® DNA cycle sequencing kit according to the manufacturer's instructions), and the same labeled primer was chosen for the preparation of the DNA substrate. Statistical analyses of DNA cleavage site sequences were performed as described previously (29).

Cleavage at the 990 Site of pBR322—PCR was used to prepare 33P-end-labeled substrates carrying the strong cleavage sequence for E. coli gyrase present in pBR322 (13, 30). Two PCR products, 158 and 389 bp in size, were prepared using 5'GyrA-3'GyrB and Upbr811-Apbr1200 as primers. After purification and quantification, the fragments were cleaved in the presence of S. pneumoniae topo IV or gyrase, and the products were examined on 6- or 10%-polycrylamide-urea sequencing gels alongside the appropriate sequencing ladder.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Anti-pneumococcal Quinolones Promote Site-specific DNA Cleavage by Topo IV and Gyrase—To investigate DNA breakage by pneumococcal topo IV and gyrase, we used four fluoroquinolones either clinically approved or in clinical use for pneumonia and other infections caused by S. pneumoniae, namely gemifloxacin, gatifloxacin, moxifloxacin, and levofloxacin (Fig. 1). Plasmid pBR322, linearized at the EcoRI site, was incubated with S. pneumoniae topo IV or gyrase in the absence or presence of quinolones. After addition of SDS to release enzyme-bridged DNA breaks, samples were digested with proteinase K to remove ParC (GyrA) protein covalently linked to DNA ends and analyzed by agarose gel electrophoresis (Fig. 2). Cleavage of EcoRI-cut DNA at a particular site by topo IV (or gyrase) is expected to generate two specific DNA fragments. In the absence of quinolones, neither topo IV (Fig. 2A) nor gyrase (Fig. 2B) induced detectable DNA cleavage. However, inclusion of any of the four quinolones promoted enzyme-mediated dosedependent DNA breakage at multiple sites. No breakage was seen when either enzyme was omitted (not shown). For topo IV, gemifloxacin was at least 10-fold more efficient than the other quinolones in stimulating DNA breakage (Fig. 2A) (27). Most interestingly, the four quinolones induced cleavage by topo IV at the same DNA sites, generating essentially identical cleavage patterns. Drug-promoted cleavage by gyrase (Fig. 2B) was less efficient for gemifloxacin and levofloxacin than that seen for topo IV; gatifloxacin and moxifloxacin exhibited similar activities against the two enzymes. As for topo IV, gemifloxacin was the most active drug against gyrase, being at least 4-fold more potent than the other quinolones (Fig. 2B). Except for minor differences in some band intensities, the four quinolones promoted gyrase-induced DNA cleavage at the same spectrum of sites. These findings were seen using other plasmid substrates and other quinolones, e.g. ciprofloxacin, clinafloxacin, and sparfloxacin (not shown). It appears that differences in quinolone structure do not affect the specificity of DNA breakage by either topo IV or gyrase.



View larger version (102K):
[in this window]
[in a new window]
  		FIG. 2.
Quinolones promote DNA cleavage by S. pneumoniae topo IV (A) and gyrase (B). EcoRI-linearized pBR322 DNA (0.4 µg) was incubated with ParC (0.45 µg) and ParE (1.7 µg) (A) or GyrA (0.45 µg) and GyrB (1.7 µg) (B) in the absence or presence of four different quinolones at the indicated concentrations. Following treatment with SDS and proteinase K, the DNA samples were examined by electrophoresis in 1% agarose. Drug concentrations were chosen so as to produce comparable levels of DNA breakage. Lanes M, DNA size markers. GEMI, gemifloxacin; GATI, gatfloxacin; MOXI, moxifloxacin; LEVO, levofloxacin.

 
Effects of DNA Conformation on Enzyme-mediated Breakage of Pneumococcal DNA—The bacterial chromosome comprises 50–100 DNA domains each maintained in a negatively supercoiled state by the action of DNA gyrase (5). However, positive supercoiling is induced ahead of DNA tracking enzymes such as RNA polymerase and DNA polymerase (5, 6). Topo IV is known to bind preferentially to positively supercoiled DNA (21), but it is presently unclear whether topo IV or gyrase is the enzyme responsible for removal of positive supercoils inside the cell. To examine how DNA supercoiling affects enzymatic cleavage of S. pneumoniae DNA (which is highly (58%) A + T-rich), we used plasmid pXP1, a 7.3-kb pBluescript derivative that carries a 4.3-kb HindIII fragment of the S. pneumoniae genome consisting of the parE gene and part of the parC gene (Fig. 3A) (28). In addition to the negatively supercoiled pXP1 plasmid recovered from E. coli, positively supercoiled pXP1 was generated by incubation with T. maritima reverse gyrase in the presence of ATP (31). Two-dimensional agarose gel electrophoresis was used to examine DNA substrates (Fig. 3B) in which chloroquine was absent in the first (north to south) dimension but was included in the second (west to east) dimension. The addition of the intercalater chloroquine causes DNA helix unwinding, which is compensated by positive supercoiling of the plasmid DNA. Consequently, negatively supercoiled pXP1 DNA runs less supercoiled in the second dimension (Fig. 3B). By contrast, positively supercoiled DNA is more positively supercoiled in the presence of chloroquine and consequently runs more quickly in the second dimension producing topoisomers that lie above a diagonal linking nicked DNA and highly supercoiled DNA (Fig. 3B). This broad two-dimensional pattern of positively supercoiled topoisomer products has been reported previously for reverse gyrase (31). In combination with pXP1 linearized at a single XhoI site, these negatively and positively supercoiled substrates allowed investigation of the effects of DNA conformation on DNA cleavage.



View larger version (59K):
[in this window]
[in a new window]
  		FIG. 3.
DNA cleavage of plasmid pXP1 by S. pneumoniae topo IV and DNA gyrase. A, structure of pXP1 comprising a 4.3-kb HindIII fragment from the S. pneumoniae parE-parC region cloned into pBluescript SK+/-. Unique sites for XhoI and ScaI are present in the vector. Filled and open arrowheads indicate strong cleavage sites for pneumococcal topo IV and gyrase lying within regions E and K, respectively. IS1 denotes an insertion sequence upstream of the parE-parC genes. B, characterization of negatively supercoiled (-SC) and positively supercoiled (+SC) pXP1 using two-dimensional gel electrophoresis. Samples were run in a 1% agarose gel in the absence of chloroquine (-CQ) in the first dimension and in the presence of 3 µg/ml chloroquine (+CQ) in the second dimension. Asterisks indicate wells in which samples were loaded on the gel. C and D, positively supercoiled (+SC), negatively supercoiled (-SC), and XhoI-cut (linear) pXP1 were incubated with topo IV (C) and gyrase (D) in the absence or presence of gemifloxacin (GEMI) at the indicated concentrations (in µM). All samples were treated with SDS and proteinase K, and DNA products from reactions involving supercoiled substrates were precipitated with ethanol and linearized by incubation with XhoI. DNA was examined by electrophoresis in 1% agarose. Filled and open arrowheads denote fragments arising from the strong cleavage sites E and K for topo IV and gyrase, respectively. Linear DNA size markers were run on the left of each gel.

 
DNA substrates were incubated with S. pneumoniae topo IV or gyrase in standard cleavage assays in the absence or presence of increasing concentrations of gemifloxacin, the most potent of the quinolones examined (Fig. 1). After SDS and proteinase K treatment, cleaved DNA products were purified by precipitation with ethanol. DNA reaction products derived from negatively or positively supercoiled pXP1 substrate were further digested with XhoI. The DNA was then analyzed by agarose gel electrophoresis. For topo IV, little or no cleavage of linear pXP1 was observed in the absence of gemifloxacin (Fig. 3C). However, in the presence of drug, cleavage at multiple sites generated DNA subfragments whose production increased in a dose-dependent fashion. Cleavage at one particular site in the pneumococcal DNA insert, termed the E site, was especially favored leading to prominent ~2.4- and ~4.9-kb DNA fragments (Fig. 3C, filled arrowheads). Topo IV cleavage of both positively and negatively supercoiled substrates also occurred in a site-specific manner, was dependent on the inclusion of gemifloxacin, and gave a pattern of fragments similar to that observed with linear DNA (Fig. 3C). However, DNA supercoiling, especially negative supercoiling DNA, enhanced cleavage efficiency yielding substantial DNA breakage even at 1 µM drug. Cleavage was particularly accentuated at the prominent E site.

In the case of gyrase, linear and positively and negatively supercoiled DNA substrates were cleaved at the same spectrum of sites in a gemifloxacin-dependent reaction, with linear DNA being the least effective substrate (Fig. 3D). There were key differences compared with cleavage by topo IV. First, the cleavage patterns and the preferred cleavage site were different for the two enzymes. Thus, the most prominent gyrase cleavage site occurred not at the E site but at a different site, site K, producing ~1.6-kb and ~5.7-kb fragments (Fig. 3D, open arrowheads). Second, positively supercoiled DNA was the best substrate for gyrase. These results suggest there are differences in site preferences for the two enzymes and that DNA conformation modulates the efficiency but not the specificity of DNA breakage.

This interpretation of experiments in Fig. 3, C and D, assumes that the DNA templates retain their initial superhelicity throughout the incubation prior to induction of DNA cleavage. Although ATP was omitted, it is known that under some conditions, gyrase (but not topo IV) has a weak ATP-independent DNA relaxation activity on negatively supercoiled DNA. It was therefore important to examine the conformation of pXP1 DNA prior to cleavage induction. Cleavage complexes formed by topo IV and gyrase with supercoiled pXP1 (using the protocol of Fig. 3, C and D) were completely reversed by addition of EDTA to 20 mM and incubation for 15 min at 37°C, prior to treatment with SDS and proteinase K as before. For both topo IV and gyrase, complex reversal allowed the recovery of fully supercoiled DNA substrates; no plasmid relaxation or nicking was observed (not shown). Thus, the cleavage patterns in Fig. 3, C and D, do reflect the sampling of cleavage sites on supercoiled DNA templates vis à vis linear DNA.

Distribution of Topo IV- and Gyrase-induced Double-strand Breaks on pXP1 and Other Pneumococcal DNA Sequences— The positions of topo IV and gyrase cleavage sites in pXP1 were obtained by performing two sets of cleavage experiments using plasmid DNA linearized either with XhoI (Fig. 3, C and D) or with ScaI (results not shown). The unique ScaI and XhoI sites lie within the pBlueScript sequence at positions 2526 and 668, with the XhoI site lying just a few base pairs upstream of the insert (Fig. 3A). By comparing the sizes of the cleavage fragments generated from the two different linear substrates, topoisomerase cleavage sites could be mapped unambiguously to a resolution of ±50 bp. We could show that many strong topo IV and gyrase cleavage sites mapped in the pneumococcal DNA insert. including the prominent sites E and K that lie in the parE gene (Fig. 3, C and D).

To map and resolve double-strand break sites more accurately, and to identify sufficient sites to facilitate statistical analysis at the sequence level (see below), the entire IS1-parE-parC gene locus comprising 6812-bp was amplified as five overlapping PCR products using genomic S. pneumoniae DNA as template. Cleavage and mapping experiments were repeated using the same conditions as for Fig. 3 as a prelude to high resolution analysis by DNA sequencing methodology.

Topo IV and Gyrase Share an Overlapping Cleavage Site Repertoire—To determine the structure of double-stranded DNA cleavage sites generated by gyrase and topo IV on pXP1 pneumococcal DNA, we mapped the 3'-OH ends of cleaved DNA fragments on each strand (termed "top" and "bottom strands"). DNA substrates, 5'-labeled with 33P in one or the other strand, were obtained by PCR and cleaved with topo IV or gyrase in the presence of gemifloxacin, and the resulting DNA fragments were separated in denaturing polyacrylamide gels. Cleavage sites were located by comparing the migration of cleaved DNA fragments with dideoxy sequencing products obtained using primers that had the same 5' DNA ends as the substrates. Representative cleavage experiments for PCR products containing the E and K sites are shown in Fig. 4.



View larger version (132K):
[in this window]
[in a new window]
  		FIG. 4.
Identification of topo IV and gyrase cleavage sites at the nucleotide level. The 256-bp E fragment (A) and 215-bp K fragment (B) from the parE gene in each case 33P-labeled at one or the other 5' end were generated by PCR using appropriately labeled primers. These DNA substrates labeled in the TOP or BOTTOM strands were subjected to DNA cleavage by S. pneumoniae topoisomerase IV (topo IV) and gyrase (gyr) in the absence or presence of gemifloxacin (Gemi) at 2.5 and 20 µM, respectively. DNA products were separated by electrophoresis in denaturing urea, 8% polyacrylamide gels alongside DNA sequencing products (GATC) generated by the chain termination method using the same 5'-labeled oligonucleotide primers employed in PCR. Filled and open arrowheads denote strong sites of DNA cleavage at the E and K sites of Fig. 3. The figure shows cleavage using histidine-tagged proteins. Experiments using topo IV reconstituted from non-histidine-tagged ParC and ParE proteins gave identical DNA cleavage patterns (data not shown).

 
Topo IV cleavage of the E fragment required the presence of gemifloxacin and occurred predominantly at a single site on each strand (Fig. 4A), allowing unambiguous identification of the E site on plasmid pXP1 (Fig. 3C). Much weaker cleavage was observed at several other sites. Gyrase also mediated breakage at several sites in the fragment including the E site. However, unlike the situation for topo IV, the E site was not the most preferred location for gyrase cleavage. For the K fragment, gemifloxacin-dependent breakage by gyrase occurred at six major sites that were closely spaced on each strand, several of which corresponded to moderately strong sites of cleavage by topo IV (Fig. 4B). It appears that the strong K site seen in double-strand breakage by gyrase of pXP1 (Fig. 3D) in fact arises from cleavage at several closely spaced sites producing fragments that were not resolved by agarose gel electrophoresis. A compilation of DNA cleavage data for the E and K fragments brings out several important features (Fig. 5). First, specific breakage of one strand by topo IV (or gyrase) is usually paired with a site cleaved with similar efficiency and staggered by 4 bases on the complementary strand, as expected for the production of double-strand DNA breaks mapped by agarose gel electrophoresis (results not shown). However, in some cases, cleavage on one strand is not accompanied by a staggered cut on the complementary strand. Second, many although by no means all sites are cleaved by both topo IV and gyrase, suggesting the enzymes must share at least some DNA breakage determinants (Fig. 4).



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 5.
Location and relative strengths of double-stranded DNA breakage sites for topo IV and gyrase in the E and K parE fragments. Filled and open arrowheads denote sites of DNA scission by topo IV and gyrase, respectively. Strong sites are denoted by large arrowheads. Numbers refer to the nucleotide positions in the S. pneumoniae parE gene (28) counting from the first nucleotide of the initiation codon ATG.

 
Topo IV and Gyrase Cleavage Sites Exhibit Multiple Symmetric and Asymmetric Base Preferences Including a Novel -2A/+6T Determinant—Nucleotide sequences were determined for a large number of gemifloxacin-promoted sites of double-stranded DNA cleavage by topo IV and gyrase in the S. pneumoniae parE-parC genes. For each demonstrably double-strand DNA break, the sequence of only one strand was selected arbitrarily, and the bases were assigned according to the convention that places the nucleotide attached to ParC (GyrA) as the +1 position and that 5' of the break as -1. After aligning sequences in this way, the base preferences at particular positions were analyzed. For each group of sites, the probability (P) of the observed base frequency deviation from expectation was evaluated for each position in a 35-bp region encompassing the site. A base composition of 58% AT and 42% GC exhibited by the parE-parC DNA was assumed (in line with the known 60% AT-rich S. pneumoniae genome). Analyses of 180 topo IV site sequences and 126 gyrase site sequences are presented in Fig. 6, A and B, respectively. It is immediately clear that sites show a nonrandom distribution of nucleotide sequences with some positions exhibiting highly statistically significant base preferences (taken as -log P > 3, where -log P = 3 corresponds to a 0.1% possibility that the preference arose by chance) or disfavored bases (-log P < -3). For topo IV, the strongest base preferences were at positions -2A and +6T (-log P of 9 and 10.5), +1G and +4C (-log P of 7.5 and 4.8), and -4G and +8C (-log P of 5 and 4, respectively). Most interestingly, in each case, the preferences are related by 2-fold symmetry: +6T, +4C, +8C correspond to -2A, +1G, and -4G on the complementary strand (Fig. 6A). Moreover, the disfavored -2T and +6A and -1A and +5T bases (-log P of -4 to -5) are also symmetrically related. The predilection for -2A/ +6T, +1G/+4C, and -4G/+8C and against -2T/+6A and -1A/+5T suggests a strong element of symmetry in site recognition by topo IV. It is noteworthy that some of these preferences involve the -1/+1 positions that flank the scissile DNA bond, and the equivalent +4/+5 positions involving base pairs adjacent to the cleavage site on the complementary strand (Fig. 6A). By contrast, it is striking that no preferences were detected at positions +2 and +3 that lie in the sequence between the two scissile bonds and form part of the 4-bp staggered break. In addition to these multiple symmetric features, topo IV sites also exhibited an asymmetric preference for -3G, and a preference against -3C and +8A (Fig. 6A). Many of these consensus sequence preferences are clearly evident in the DNA sequences of strong sites of topo IV cleavage mapped in the E, K, and S regions (Fig. 3A) of the S. pneumoniae parE-parC genes (Table IIA). Most interestingly, the pneumococcal topo IV consensus is starkly different from the published consensus for E. coli topo IV (17), which specifies only a weak preference for a purine at -1 and an A or T at +1 (Table II, A).



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 6.
Analysis of cleavage sites for topo IV (A) and gyrase (B) on pneumococcal DNA. The figures show the probability (P) of the observed deviations in base frequency from expectation at sites of DNA scission promoted by gemifloxacin, either as an excess (positive value of -log P) or deficiency (negative -log P) compared with the expected frequency of each base. P values were calculated for 180 topo IV sites and 126 gyrase sites assuming a base composition for pneumococcal DNA of A + T = 0.58 and G + C = 0.42. DNA scission occurs between the -1 and +1 nucleotides, in which the +1 nucleotide becomes attached to the enzyme ParC/GyrA subunit by a 5'-phosphotyrosine link; and -1 bears the 3'-OH end.

 


View this table:
[in this window]
[in a new window]
  		TABLE II
Alignment of strong S. pneumoniae topo IV (A) and gyrase (B) cleavage sites against the preferred consensus sequences and comparison with sites defined for E. coli topo IV and gyrase DNA sequences encompassing the breakage point are shown for one strand of each double-strand breakage site promoted by gemifloxacin in E, K, and S fragments of the parE-parC locus. The central four nucleotides (+1 to +4) correspond to those in the 4-bp overhang generated by DNA scission. Bases in boldface match the preferred consensus for S. pneumoniae topo IV or gyrase derived from Fig. 6; bases in italics show bases that are disfavored according to statistical analyses (Fig. 6). The consensus site reported E. coli topo IV and the 20-bp consensus (R, purine; Y, pyrimidine; dash, no preference) proposed for E. coli gyrase are taken from Refs. 17 and 18, respectively. For strong E. coli gyrase sites (references in parentheses), bases highlighted in boldface conform to the S. pneumoniae gyrase consensus.

 
Analysis of cleavage sites for S. pneumoniae gyrase is shown in Fig. 6B. Similar to pneumococcal topo IV, gemifloxacin-promoted gyrase cleavage sites shared the symmetric preferences for -2A/+6T (-log P of 9 and 6.2), +1G/+4C (-log P of 7 and 3.5), and -4G/+8C (-log P of 3 and 5.5) and an asymmetric preference for -3G. As for topo IV sites, there was no base preference at +2 and +3, and -3C, +5T, and +8A were strongly disfavored. However, there were some clear differences with topo IV. For example, gyrase sites did not display such a strong preference against -2T, -1A, and +6A observed for topo IV. Instead, -2C was strongly disfavored. Finally, gyrase had a preference for sites with -1G and -9G that was not observed for topo IV. The consensus and sequence data for strong S. pneumoniae gyrase sites in fragments E, K, and S are shown in Table II, B. Many sites conform to the -2A/+6T rule. It is significant that the consensus for E. coli gyrase displays some similarity to that of S. pneumoniae gyrase, notably preferences for +1G/+4C, purines at -4, and -2, and pyrimidines at +6 and +8 (Table II, B). However, pneumococcal gyrase does not share the reported E. coli gyrase preferences (18) for +1T, +5G/T, +10G, purines at +8 and +2, and pyrimidines at +3 and +12 (Table II, B). It might be mentioned that our choice of -log P of >3 or <-3 as significant is conservative, and thus the pneumococcal consensus sequences are strong.

The Major pBR322 Site for E. coli Gyrase Is Efficiently Cleaved by S. pneumoniae Gyrase and Topo IV—To examine whether pneumococcal type II enzymes could act at E. coli gyrase cleavage sites, we investigated cleavage at the strong site of oxolinic acid-promoted gyrase cleavage that maps at nucleotide position 990 in pBR322 (14, 30). The 990 site was chosen as it is currently the best characterized gyrase breakage site and undergoes cleavage in the presence of a variety of different quinolones. A 158-bp product (positions 905–1063) containing the 990 site was amplified by PCR using pBR322 DNA as template with one or the other PCR primer labeled with 33P at its 5' end. The two PCR products were then incubated with S. pneumoniae gyrase or topo IV in the absence or presence of gemifloxacin and cleaved by treatment with SDS, and following proteinase K digestion, DNA products were analyzed by denaturing PAGE alongside appropriate sequencing ladders (Fig. 7). In the presence of gemifloxacin (+ lanes, Fig. 7), gyrase induced cleavage predominantly at a single site on each strand, i.e. 3' of T990 in the sequence 5'-GGAT990, GGCCTTGGGG (Fig. 7, right-hand panel), and after A994 in the sequence 5'-GGGGAA994, GGCCAT (left-hand panel). Thus, gyrase cleavage occurs with a 4-bp stagger at the 990 site. S. pneumoniae topo IV also cleaved at the 990 site (among others), although less efficiently than gyrase (Fig. 7). Preferential cleavage at the 990 site was also observed when it was present in a 389-bp pBR322 fragment generated with primers Upbr811 and Apbr1200 (Table I) (data not shown) showing that 990 site cleavage is not determined by proximity to DNA ends. Therefore, the 990 site, originally identified using E. coli gyrase and oxolinic acid, is a substrate for gemifloxacin-stimulated cleavage by S. pneumoniae topo IV and gyrase. Interestingly, high levels of oxolinic acid induced cleavage by S. pneumoniae topo IV (but not by gyrase) with DNA scission occurring at the 990 site.2 Scrutiny of the pBR322 990 site sequence reveals it to be a very strong match to the pneumococcal gyrase consensus (identical in 7 of 9 positions) and to the topo IV consensus (identical in all 7 preferred positions but carrying an unfavored T at +5) (Table II). It appears that the quinolone-stabilized cleavage complexes of E. coli gyrase and the pneumococcal type II topoisomerases may share some DNA cleavage determinants in common.



View larger version (81K):
[in this window]
[in a new window]
  		FIG. 7.
S. pneumoniae topo IV and gyrase efficiently cleave a strong DNA breakage site for E. coli gyrase. A 158-bp fragment of pBR322 (nucleotides 905–1063) labeled with 33P at one or the other 5' end was obtained by PCR using primers in which one was labeled with 33P. A cleavage assay was carried out using topo IV and gyrase in the presence of gemifloxacin at 2.5 and 20 µM, respectively. After processing, DNA fragments were sized by electrophoresis in a denaturing 8% polyacrylamide gel against DNA sequencing products (GACT) obtained for the same DNA sequence by priming with the labeled PCR primers used in PCR. Arrowheads, DNA fragments arising from breakage at nucleotide position 990.

 


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
S. pneumoniae type IIA topoisomerases are very important clinically as the targets for new anti-pneumococcal quinolones (27). The key feature of quinolone agents is their ability to stabilize a topoisomerase-DNA cleavage complex that cellular processes convert into a lethal lesion, thought to be a double-stranded DNA break (5). In the presence of quinolones, topo IV and gyrase induce DNA scission at specific sites involving degenerate sequences, but the DNA cleavage determinants have remained elusive. In contrast to the type IIA topoisomerases from E. coli, the pneumococcal topo IV (not gyrase) is generally the more sensitive drug target in vitro (23). Most surprisingly, however, depending on the quinolone, either topo IV or gyrase can be the intracellular target in S. pneumoniae (24–26). These findings are not in accord with the roles of gyrase and topo IV envisaged in the current E. coli replication model (9). The distinctive features of the S. pneumoniae system lead us to examine the DNA conformation and sequence determinants for quinolone-mediated cleavage complex formation by S. pneumoniae topo IV and gyrase. By a rigorous analysis of very many sites, we have established strong consensus sequences for cleavage by both enzymes including the unique -2A/+6T preference that has not been reported previously.

Initial experiments revealed that the clinically important antipneumococcal quinolones gemifloxacin, gatifloxacin, moxifloxacin, and levofloxacin (as well as other quinolones such as sparfloxacin, clinafloxacin, and ciprofloxacin) induced a very similar enzyme-specific pattern of DNA cleavage by S. pneumoniae topo IV and gyrase (Fig. 2), with gemifloxacin exhibiting the greatest potency. Evidently, differences at the 5, 7, and 8 positions of the quinolone ring (Fig. 1) alter potency but do not affect the specificity of DNA breakage. The pattern of enzyme cleavage was also the same for linear and supercoiled DNA, although negative supercoiling and, to a lesser extent, positive supercoiling accentuated the efficiency of cleavage by both enzymes, particularly at strong cleavage sites in regions E and K in parE (Fig. 3, C and D). Enhanced cleavage could arise if topo IV and gyrase bind more avidly to supercoiled DNA, e.g. by preferential association at crossover points involving two plectonemically interwound DNA duplexes. Alternatively, or additionally, supercoiling could promote cleavage complex formation by facilitating enzyme-quinolone-DNA interactions. These results suggest that although DNA conformation affects cleavage efficiency, it is not a major determinant of cleavage specificity.

Topo IV and gyrase induced quinolone-promoted DNA breakage at specific sites that exhibit degeneracy. Sequence analysis of 180 topo IV sites and 126 gyrase sites promoted by gemifloxacin on pneumococcal DNA under the same reaction conditions (Figs. 4, 5, 6) generated two consensus cleavage sequences (Fig. 6, A and B, and Table II) as follows: topo IV, G(G/C) (A/T)A*GNNCT(T/A)N(C/A); gyrase, -GN4G(G/C)(A/C)G*GNNCTTN(C/A)- (where the asterisk denotes the cleavage site; boldface indicates preferred base; small capitals denote unfavored base; N, no base preference). The topo IV sequence shares 7 base preferences in common with gyrase, probably accounting for the observation that certain sites can be cleaved by both enzymes (Figs. 4 and 5). However, the sequences are distinct in terms of strong topo IV preferences against -2T and -1A (rather than -2C in the case of gyrase) and additional gyrase preferences at -9 and +1. These differences may account for enzyme-specific cleavage at particular sites. Moreover, in foot-printing experiments, topo IV protects only a 34-bp region containing the breakage site (32), whereas similar experiments for gyrase revealed that a 120–150-bp DNA region is protected by the enzyme (14–16). Therefore, in addition to the strong preferences seen at the cleavage site, it is conceivable for gyrase that other weaker DNA-protein interactions could also contribute to DNA cleavage specificity. Moreover, competition among sites in a given stretch of DNA may be more intense for gyrase than topo IV as the extent of DNA protection is greater for bound gyrase.

One striking feature that emerges from the analysis of topo IV and gyrase sites is the very strong preference for -4G, -2A, and +1G and for the symmetrically placed +8C, +6T, and +4C bases, respectively (Fig. 6 and Table II). These elements of symmetry could arise in either of two ways. First, the dyadic symmetry of the topo IV ParC2ParE2 and gyrase GyrA2GyrB2 complexes may favor cleavage of symmetric DNA sequences possessing G, A, and G nucleotides placed at positions -4, -2, and +1 on each complementary DNA strand (Fig. 6). Alternatively, apparently symmetric requirements could result from asymmetric sites (i.e. bearing -4G, -2A, and +1G on just one strand) as a consequence of our choosing to analyze the sequence of just one DNA strand from each double-stranded DNA breakage site. Clearly, random selection of the opposite strand for analysis would register as a preference for +8C, +6T, and +4C (Fig. 6). Symmetric site requirements are more consistent with the need for two identical ParC (GyrA) subunits to interact with DNA (and quinolone) at the breakage site. However, it is also conceivable that a strong signal in one DNA strand could allosterically induce DNA breakage at an unrelated sequence on the complementary strand. Indeed, this behavior has been reported for DNA scission by eukaryotic topo II (33).

In fact, both symmetric and asymmetric determinants were present among strong pneumococcal topo IV and gyrase sites (Table II). For example, of 11 sites for topo IV, site 1 (i.e. site E), sites 2–5, and 10 had both -2A and +6T (Table II, A). Sites 1, 9, and 11 had both -4G and +8C. Other sites, such as 6–8, had only asymmetric preferences. Similar results were seen for the strong sites of gyrase action (Table II, B). For example, 6 of 14 sites had both -2A and +6T, whereas a further 6 sites had just one of these preferred nucleotides. Similarly, 3 sites had +1G and +4C and 4 other sites had one or the other determinant. Several gyrase breakage sites had the asymmetric -9G, -3G, and/or +8C preference. These findings suggest that site specificity involves both symmetric and asymmetric elements.

The S. pneumoniae topo IV cleavage consensus bore little resemblance to that previously reported for the E. coli topo IV, which was derived from analysis of 61 sites stabilized by norfloxacin (Table II) (17). However, there is similarity between the pneumococcal gyrase consensus and the 20-bp consensus for E. coli gyrase derived for 19 pBR322 sites induced in vivo by oxolinic acid (18). Unfortunately, unlike our analysis of very many sites of pneumococcal topo IV and gyrase cleavage, the highly degenerate E. coli gyrase consensus is based on relatively few sites identified by an indirect cloning procedure that obscures whether they represent favored or rare sites of enzyme action. The fact that both S. pneumoniae- and E. coli-gyrase efficiently cleave the pBR322-990 site (Fig. 7) provides functional evidence supporting an overlap in cleavage determinants. Moreover, scrutiny of this pBR322 site and other "strong" E. coli gyrase sites mapped in vitro in plasmids pVH51 (14), ColE1 (16), and pSC101 (34) and in bacteriophage mu (35, 36) indicates they carry one or more of the pneumococcal gyrase determinants -4G/+8C, +1G/+4C, and -2A/+6T (Table II, B). Clearly, proper comparison of gyrase cleavage determinants across bacterial species will require a reliable consensus for E. coli gyrase and topo IV.

The DNA cleavage preferences observed for S. pneumoniae topo IV and gyrase can be considered in the context of current knowledge of the cleavage complex (37). Quinolones stabilize the topoisomerase-DNA cleavage complex as little or no DNA breakage is seen in the absence of drug (Figs. 2, 3, 4). Complex stabilization likely involves drug interactions both with DNA and enzyme. First, the presence of DNA is needed for tight drug binding to the enzyme; in fact quinolones are known to bind single-stranded DNA (with a preference for guanine residues) in an Mg2+-dependent process (38). Second, from x-ray studies of a 59-kDa E. coli GyrA fragment (39), it appears that residues implicated in quinolone resistance lie at the protein-DNA interface of the breakage-reunion domain, with the enzyme forming a binding pocket to accommodate the drug. Although an enzyme-DNA complex has not been solved at high resolution, modeling of DNA on the GyrA structure suggests that the DNA helix could be bound in a distorted (possibly single-stranded) conformation (39). Indeed, in earlier work, Shen and co-workers (40) proposed that four quinolone molecules are bound within a single-stranded DNA bubble encompassing the DNA cleavage site in the gyrase-DNA complex and opened up by enzyme action. This model has proven conceptually useful, but several lines of evidence suggest it is unlikely to be completely correct. For example, the model does not accommodate the fact that quinolone-DNA binding requires Mg2+ ions (41), which have been shown to interact with the drug C-3 carboxylate and C-4 carbonyl groups, most likely in a 1:1 complex (42). Furthermore, recent work suggests that two (not four) quinolones bind to the gyrase-DNA complex and that drug binding does not require the formation of covalent GyrA-DNA links (43). However, in common with several other proposals, the model does not explicitly address the origins of DNA cleavage specificity, particularly the roles of the drug and of the enzyme.

We do not know which of the observed base preferences at S. pneumoniae topo IV and gyrase cleavage sites reflect enzyme-DNA or quinolone-DNA interactions. It has been proposed that quinolones bind DNA inducing a DNA distortion that acts as a preferred substrate for subsequent enzyme recruitment and DNA scission (17). Evidence in support of this idea has come from studies showing that norfloxacin alters the DNA conformation at a particular DNA cleavage sequence for E. coli topo IV, and that this distortion was made more pronounced by addition of the enzyme (17). It is not known whether quinolone recruitment of enzyme to DNA is a general feature of all cleavage sites. However, we note that structurally distinct quinolones promote cleavage at the same DNA sites (Figs. 2 and 7). Therefore, any putative drug-mediated specificity must reside in a conserved feature of these quinolones, such as the 3-carboxy-4-keto moiety involved in Mg2+-dependent DNA interactions. Furthermore, the limited size of a quinolone molecule suggests that its direct interactions with DNA would be restricted to a few nucleotides at most, e.g. at the sites of DNA scission involving -1 and +1 positions. Based on these considerations, it seems likely that the majority of the multiple base preferences involve enzyme-DNA contacts, especially those distal to the cleavage site at -4/+8, at -3, and at -9 for gyrase. Indeed, by using end-labeled fragments and slightly different reaction conditions, we could detect very weak site-specific DNA breakage by S. pneumoniae topo IV in the absence of quinolones.2 In five of the six sites examined, drug-independent cleavage occurred at the same nucleotide position as seen in the presence of gemifloxacin. These results argue strongly that enzyme-DNA interactions play a crucial role in determining DNA cleavage site specificity, with quinolone-DNA interactions promoting efficient cleavage, possibly more enhanced at some sequences compared with others.

In the absence of a high resolution x-ray structure, we propose a tentative model for the cleavage complex involving a single-stranded DNA bubble containing the two scissile bonds and quinolone-binding sites (Fig. 8). We suggest that two quinolone molecules bind to the DNA phosphodiester backbone via an Mg2+ bridge through the drug C-3 and C-4 groups in interactions stabilized by base stacking with the preferred +1G (and, in the case of gyrase, the preferred -1G). The importance of +1G/+4C is reinforced by mutagenesis studies of the 990 site showing that changes at these positions significantly reduced DNA cleavage by E. coli gyrase (30). To explain the strong pneumococcal topo IV and gyrase preference for -2A/+6T, we propose that either the enzyme or the quinolone (shown) interacts with elements of the T-A base pair at -2 (Fig. 8). For topo IV, there is a strong preference against -2T/+6A suggesting that this interaction is specific and not simply the disruption of a weak A:T base pair at -2. The more distal preferences for -4G/+8C and -3G (and especially -9G for gyrase) most probably arise from specific enzyme-DNA interactions. The lack of sequence preferences at +2 and +3 positions either for topo IV or gyrase (Fig. 6 and Table II) argues against models in which quinolones bind intercalatively between +1 and +2 on each DNA strand (44).



View larger version (11K):
[in this window]
[in a new window]
  		FIG. 8.
Schematic model for quinolone-DNA interactions in the gemifloxacin-stabilized cleavage complex of S. pneumoniae topo IV and gyrase. Two quinolone molecules are show in gray. Enz, enzyme.

 
A number of experimental observations fit with the model. First, the effects of negative supercoiling, whose torsional stress unwinds DNA, are in accord with local unwinding at the cleavage site. Thus, quinolones bind supercoiled plasmid DNA with greater affinity than linear DNA (38). Moreover, negative supercoiling accentuated DNA cleavage by both topo IV and gyrase (Fig. 3). Second, that two scissile bonds are associated with each double-strand DNA break suggests there are two sites of drug action in the DNA cleavage complex, as shown for etoposide (45) and idarubicin (46) on eukaryotic topo II and ciprofloxacin on E. coli gyrase (43). However, in principle, binding of a single quinolone molecule at the DNA cleavage site might be sufficient to promote enzymatic breakage of both scissile bonds (Fig. 8), as appears to be the case for the action of the quinolone CP115,953 on human topo II (33). At present, the data are limited as to which particular quinolones follow the "one-drug" or "two-drug" scenario in binding to bacterial topoisomerases. Third, it is interesting that anti-pneumococcal quinolones differing in their C-7 and C-8 substituents induced the same enzyme-specific patterns of cleavage on pBR322 (Fig. 2). The C-7 and C-8 groups have been suggested to interact with the enzyme (40) and appear primarily to affect drug potency by enhancing quinolone binding, perhaps through electrostatic interactions involving the physiologically protonated amine at C-7 (Fig. 1). Presumably, the observed efficiencies and specificities of enzyme cleavage reflect a marriage of requirements involving interactions between quinolone, enzyme, and DNA.

Finally, topo IV appears to have arisen from gyrase by gene duplication (47), accounting for the >50% sequence identity between ParC and GyrA, and ParE and GyrB proteins, respectively (48). Sequence similarity is particularly marked in regions thought to interact with quinolones and DNA, namely a helix-turn-helix region of GyrA (ParC) adjacent to the catalytic tyrosine involved in DNA breakage-reunion, and a segment in the C-terminal Toprim domain of GyrB (ParE) (Fig. 9) (49–52). Further work will be needed in clarifying the role of such motifs in both the overlapping and distinct DNA cleavage preferences of S. pneumoniae topo IV and gyrase. We note that drug-specific selection of sites is unlikely to underlie the in vivo drug targeting of topo IV or gyrase (24–26) as the same cleavage patterns were seen for a variety of quinolones (Fig. 2). Thus, the factors governing quinolone target preferences in S. pneumoniae remain to be elucidated.



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 9.
Alignment of S. pneumoniae ParC-GyrA and ParE-GyrB sequences thought to reside at the quinolone-DNA interface, the "quinolone resistance-determining regions." Conserved sequences are boxed. Residues whose mutation commonly results in quinolone resistance are shown in boldface including Ser-79 in ParC (Ser-81 in GyrA) (see asterisk) (24–27, 49–52). The catalytic tyrosine of ParC (GyrA) engaged in DNA breakage-reunion is indicated by a vertical arrow. Lines and dark arrows show the location of {alpha}-helices and {beta}-sheets predicted from the x-ray crystal structure of the 59-kDa N-terminal GyrA fragment of E. coli (39). Numbers at right denote the amino acid residue.

 

   FOOTNOTES
 
* This work was supported by Project Grant 117/C16747 (to L. M. F. and M. R. S.) from the Biotechnology and Biological Sciences Research Council of the United Kingdom. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Supported by a grant from PRIN 2003, Ministero dell'Istruzione, Universita e Ricerca, Rome, and Bologna University, Italy. Back

{ddagger}{ddagger} To whom correspondence should be addressed: Molecular Genetics Group, Dept. of Basic Medical Sciences-Biochemistry and Immunology, St. George's Hospital Medical School, University of London, London, SW17 0RE, UK. Tel.: 44-208-725-5782; Fax: 44-208-725-2992; E-mail: lfisher{at}sghms.ac.uk.

1 The abbreviations used are: topo, topoisomerase; DTT, dithiothreitol; GST, glutathione S-transferase; BSA, bovine serum albumin; DTT, dithiothreitol. Back

2 E. Leo and L. M. Fisher, unpublished results. Back


   ACKNOWLEDGMENTS
 
We are grateful to Claire Bouthier de la Tour and Michel Duguet for providing a sample of reverse gyrase and Sue Cotterill for pGEX-6P1, glutathione-Sepharose resin, and PreScission protease.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Wang, J. C. (1996) Annu. Rev. Biochem. 65, 635-692[CrossRef][Medline] [Order article via Infotrieve]
  2. Wang, J. C. (1998) Q. Rev. Biophys. 31, 107-144[CrossRef][Medline] [Order article via Infotrieve]
  3. Champoux, J. J. (2001) Annu. Rev. Biochem. 70, 369-413[CrossRef][Medline] [Order article via Infotrieve]
  4. Wang, J. C. (2002) Nat. Rev. Mol. Cell. Biol. 3, 430-440[CrossRef][Medline] [Order article via Infotrieve]
  5. Drlica, K., and Zhao, X. (1997) Microbiol. Mol. Biol. Rev. 61, 377-392[Abstract]
  6. Levine, C., Hiasa, H., and Marians, K. J. (1998) Biochim. Biophys. Acta 1400, 29-43[Medline] [Order article via Infotrieve]
  7. Gellert, M., Mizuuchi, K., O'Dea, M. H., and Nash, H. A. (1976) Proc. Natl. Acad. Sci. U. S. A. 73, 3872-3876[Abstract/Free Full Text]
  8. Kato, J., Nishimura, Y., Imamura, R., Niki, H., Higara, S., and Suzuki, H. (1990) Cell 63, 393-404[CrossRef][Medline] [Order article via Infotrieve]
  9. Zechiedrich, E. L., and Cozzarelli, N. R. (2000) Genes Dev. 9, 2859-2869
  10. Gellert, M., Mizuuchi, K., O'Dea, M. H., Itoh, T., and Tomizawa, J.-I. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 4772-4776[Abstract/Free Full Text]
  11. Corbett, K. D., and Berger, J. M. (2004) Annu. Rev. Biophys. Biomol. Struct. 33, 95-118[CrossRef][Medline] [Order article via Infotrieve]
  12. Brown, P. O., and Cozzarelli, N. R. (1979) Science 206, 1081-1083[Abstract/Free Full Text]
  13. Mizuuchi, K., Fisher, L. M., O'Dea, M. H., and Gellert, M. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 1847-1851[Abstract/Free Full Text]
  14. Fisher, L. M., Mizuuchi, K., O'Dea, M. H., Ohmori, H., and Gellert, M. (1981) Proc. Natl. Acad. Sci. U. S. A. 78, 4165-4169[Abstract/Free Full Text]
  15. Kirkegaard, K., and Wang, J. C. (1981) Cell 23, 721-729[CrossRef][Medline] [Order article via Infotrieve]
  16. Morrison A., and Cozzarelli, N. R. (1981) Proc. Natl. Acad. Sci. U. S. A. 78, 1416-1420[Abstract/Free Full Text]
  17. Marians, K. J., and Hiasa, H. (1997) J. Biol. Chem. 272, 9401-9409[Abstract/Free Full Text]
  18. Lockshon, D., and Morris, D. R. (1985) J. Mol. Biol. 181, 63-74[CrossRef][Medline] [Order article via Infotrieve]
  19. Khodursky, A. B., and Cozzarelli, N. R. (1998) J. Biol. Chem. 272, 27668-27677
  20. Espeli, O., and Marians, K. J. (2004) Mol. Microbiol. 52, 925-931[CrossRef][Medline] [Order article via Infotrieve]
  21. Crisona, N. J., Strick, T. R., Bensimon, D., Croquette, V., and Cozzarelli, N. R. (2000) Genes Dev. 14, 2881-2892[Abstract/Free Full Text]
  22. Khodursky, A. B., Peter, B. J., Schmid, M. B., DeRisi, J., Botstein, D., Brown, P. O., and Cozzarelli, N. R. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 11801-11805
  23. Pan, X.-S., and Fisher, L. M. (1999) Antimicrob. Agents Chemother. 43, 1129-1136[Abstract/Free Full Text]
  24. Pan, X.-S., Ambler, J., Mehtar, S., and Fisher, L. M. (1996) Antimicrob. Agents Chemother. 40, 2321-2326[Abstract]
  25. Pan, X.-S., and Fisher, L. M. (1997) Antimicrob. Agents Chemother. 41, 471-474[Abstract]
  26. Pan, X.-S., Yague, G., and Fisher, L. M. (2001) Antimicrob. Agents Chemother. 45, 3140-3147[Abstract/Free Full Text]
  27. Yague, G., Morris, J. E., Pan, X.-S., Gould, K. A., and Fisher, L. M. (2002) Antimicrob. Agents Chemother. 46, 413-419[Abstract/Free Full Text]
  28. Pan, X.-S., and Fisher, L. M. (1996) J. Bacteriol. 178, 4060-4069[Abstract/Free Full Text]
  29. Capranico, G., Guano, F., Moro, S., Zagotto, G., Sissi, C., Gatto, B., Zunino, F., Menta, E., and Palumbo, M. (1998) J. Biol. Chem. 273, 12732-12739, and references therein[Abstract/Free Full Text]
  30. Fisher, L. M., Barot, H. A., and Cullen, M. E. (1986) EMBO J. 5, 1411-1418[Medline] [Order article via Infotrieve]
  31. Bouthier de la Tour, C., Portemer, C., Kaltoum, H., and Duguet, M. (1998) J. Bacteriol. 180, 274-281[Abstract/Free Full Text]
  32. Peng, H., and Marians, K. J. (1995) J. Biol. Chem. 270, 25286-25290[Abstract/Free Full Text]
  33. Bromberg, K. D., Burgin, A. D., and Osheroff, N. (2003) Biochemistry 42, 3393-3398[CrossRef][Medline] [Order article via Infotrieve]
  34. Wahle, E., and Kornberg, A. (1988) EMBO J. 7, 1889-1895[Medline] [Order article via Infotrieve]
  35. Pato, M. L., Howe, M. H., and Higgins, N. P. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 8716-8720[Abstract/Free Full Text]
  36. Oram, M., Howells, A. J., Maxwell, A., and Pato, M. L. (2003) Mol. Microbiol. 50, 333-347[CrossRef][Medline] [Order article via Infotrieve]
  37. Noble, C. G., Barnard, F. M., and Maxwell, A. (2003) Antimicrob. Agents Chemother. 47, 854-862[Abstract/Free Full Text]
  38. Shen, L. L., Baranowski, J., and Pernet, A. G. (1989) Biochemistry 28, 3879-3885[CrossRef][Medline] [Order article via Infotrieve]
  39. Morais-Cabral, J. H., Jackson, A. P., Smith, C. V., Shikotra, N., Maxwell, A., and Liddington, R. C. (1997) Nature 388, 903-906[CrossRef][Medline] [Order article via Infotrieve]
  40. Shen, L. L., Mitscher, L. A., Sharma, P. N., O'Donnell, T. J., Chu, W. T., Cooper, C. S., Rosen, T., and Pernet, A. G. (1989) Biochemistry 28, 3886-3894[CrossRef][Medline] [Order article via Infotrieve]
  41. Palú, G., Valisena, G., Ciarrochi, G., Gatto, B., and Palumbo, M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 9671-9675[Abstract/Free Full Text]
  42. Leconte, S., Baron, M. H., Chenon, M. T., Coupry, C., and Moreau, N. J. (1994) Antimicrob. Agents Chemother. 38, 2810-2816[Abstract/Free Full Text]
  43. Critchlow, S. E., and Maxwell, A. (1996) Biochemistry 35, 7387-7393[CrossRef][Medline] [Order article via Infotrieve]
  44. Kwok, Y., Zeng, Q. P., and Hurley, L. H. (1999) J. Biol. Chem. 274, 17226-17235[Abstract/Free Full Text]
  45. Bromberg, K. D., Burgin, A. D., and Osheroff, N. (2003) J. Biol. Chem. 278, 7406-7412[Abstract/Free Full Text]
  46. Bigioni, M., Zunino, F., and Capranico, G. (1994) Nucleic Acids Res. 22, 2274-2281[Abstract/Free Full Text]
  47. Huang, W. M. (1996) Annu. Rev. Genet. 30, 79-107[CrossRef][Medline] [Order article via Infotrieve]
  48. Pan, X.-S. (1998) Quinolone Action and Resistance in Streptococcus pneumoniae: Selective Targeting of DNA Gyrase or Topoisomerase IV by Quinolones. Ph.D. thesis, University of London
  49. Cullen, M. E., Wyke, A. W., Kuroda, R., and Fisher, L. M. (1989) Antimicrob. Agents Chemother. 33, 886-894[Abstract/Free Full Text]
  50. Oram, M., and Fisher, L. M. (1991) Antimicrob. Agents Chemother. 35, 387-389[Abstract/Free Full Text]
  51. Yoshida, H., Bogaki, M., Nakamura, M., and Nakamura, S. (1990) Antimicrob. Agents Chemother. 34, 1271-1272[Abstract/Free Full Text]
  52. Yoshida, H., Bogaki, M., Nakamura, M., Yamanaka, L. M., and Nakamura, S. (1991) Antimicrob. Agents Chemother. 35, 1647-1650[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Nucleic Acids ResHome page
X. S. Pan, M. Dias, M. Palumbo, and L. M. Fisher
Clerocidin selectively modifies the gyrase-DNA gate to induce irreversible and reversible DNA damage
Nucleic Acids Res., October 1, 2008; 36(17): 5516 - 5529.
[Abstract] [Full Text] [PDF]

Home page
 Antimicrob. Agents Chemother.Home page
K. Drlica, M. Malik, R. J. Kerns, and X. Zhao
Quinolone-Mediated Bacterial Death
Antimicrob. Agents Chemother., February 1, 2008; 52(2): 385 - 392.
[Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
S. N. Richter, G. Giaretta, V. Comuzzi, E. Leo, L. A. Mitchenall, L. M. Fisher, A. Maxwell, and M. Palumbo
Hot-spot consensus of fluoroquinolone-mediated DNA cleavage by Gram-negative and Gram-positive type II DNA topoisomerases
Nucleic Acids Res., September 25, 2007; 35(18): 6075 - 6085.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
S. N. Richter, E. Leo, G. Giaretta, B. Gatto, L. M. Fisher, and M. Palumbo
Clerocidin interacts with the cleavage complex of Streptococcus pneumoniae topoisomerase IV to induce selective irreversible DNA damage
Nucleic Acids Res., April 13, 2006; 34(7): 1982 - 1991.
[Abstract] [Full Text] [PDF]

Home page
 J. Bacteriol.Home page
M. Oram, A. A. Travers, A. J. Howells, A. Maxwell, and M. L. Pato
Dissection of the Bacteriophage Mu Strong Gyrase Site (SGS): Significance of the SGS Right Arm in Mu Biology and DNA Gyrase Mechanism
J. Bacteriol., January 15, 2006; 188(2): 619 - 632.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/14/14252    most recent
M500156200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leo, E.
Right arrow Articles by Fisher, L. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leo, E.
Right arrow Articles by Fisher, L. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement