Originally published In Press as doi:10.1074/jbc.M413488200 on February 10, 2005
J. Biol. Chem., Vol. 280, Issue 16, 16045-16052, April 22, 2005
Survival Function of Protein Kinase C
as a Novel Nitrosamine 4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone-activated Bad Kinase*
Zhaohui Jin,
Meiguo Xin, and
Xingming Deng
From the
University of Florida Shands Cancer Center, Department of Medicine and Department of Anatomy and Cell Biology, University of Florida, Gainesville, Florida 32610-0232
Received for publication, November 30, 2004
, and in revised form, February 4, 2005.
 |
ABSTRACT
|
|---|
Nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) is formed by nitrosation of nicotine and has been identified as the most potent carcinogen in cigarette smoke. NNK cannot only induce DNA damage but also promotes the survival of human lung cancer cells. Protein kinase C (PKC)
is an atypical PKC isoform and plays an important role in cell survival, but the downstream survival substrate(s) is not yet identified. Bad, a proapoptotic BH3-only member of Bcl2 family, is co-expressed with PKC
in both small cell lung cancer and non-small cell lung cancer cells. We discovered that NNK potently induces multisite Bad phosphorylation at Ser-112, Ser-136, and Ser-155 via activation of PKC
in association with increased survival of human lung cancer cells. Purified, active PKC
can directly phosphorylate both endogenous and recombinant Bad at these three sites and disrupt Bad/Bcl-XL binding in vitro. Overexpression of PKC
results in an enhancement of Bad phosphorylation. NNK also stimulates activation of c-Src, which is a known PKC
upstream kinase. Treatment of cells with the PKC inhibitor (staurosporine) or a Src-specific inhibitor (PP2) can block NNK-induced Bad phosphorylation and promote apoptotic cell death. The
-adrenergic receptor inhibitor propranolol blocks both NNK-induced activation of PKC
and Bad phosphorylation, indicating that NNK-induced Bad phosphorylation occurs at least in part through the upstream
-adrenergic receptor. Mechanistically, NNK-induced Bad phosphorylation prevents its interaction with Bcl-XL. Because the specific depletion of PKC
by RNA interference inhibits both NNK-induced Bad phosphorylation and survival, this confirms that PKC
is a necessary component in NNK-mediated survival signaling. Collectively, these findings reveal a novel role for PKC
as an NNK-activated physiological Bad kinase that can directly phosphorylate and inactivate this proapoptotic BH3-only protein, which leads to enhanced survival and chemoresistance of human lung cancer cells.
 |
INTRODUCTION
|
|---|
Lung cancer is one leading cause of cancer deaths in both men and women, and the 5-year relative survival rate for all stages combined is only 15% (1). The World Health Organization reported that almost 1 billion men and 250 million women are daily smokers and cigarette smoking causes 90% of lung cancer cases and
1.2 million deaths annually all over the world (1, 2). It is estimated that
90% of male and 7580% of female lung cancer deaths in the United States each year are caused by smoking (3, 4).
One piece of evidence for the connection between cigarette smoking and lung cancer is that lung cancer in women has increased by 600% since 1950 and has reached epidemic levels. This dramatic rise in lung cancer incidence is likely due to the increased prevalence of cigarette smoking, particularly in women over the same time period (5, 6).
There are more than 60 known carcinogens in cigarette smoke. Nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK),1 a nicotine-nitrosated derivative, has been identified as the most potent carcinogen and is thought to contribute significantly to smoking-related lung cancer (7). NNK can induce DNA damage (8), formation of DNA adducts, increased oxidative stress (9) as well as p53 and RAS mutation (7, 8). Because DNA damage and oxidative stress may potentially trigger cells to undergo apoptosis, the mechanism(s) that promotes cell survival is critical in NNK-initiated carcinogenesis. Recent studies indicate that NNK potently activates both phosphatidylinositol 3-kinase/AKT and MAPKs ERK1/2 in association with prolonged cell survival of human airway epithelial cells (10).
Protein kinase C (PKC) is a multigene family consisting of at least 12 distinct lipid-regulated protein-serine/threonine kinases that play pivotal roles in regulating cell proliferation, differentiation and survival (11). This family can be divided into three subtypes: the classic isoforms (PKC
,
I,
II, and
), which are Ca2+- and diacylglycerol-dependent; the novel isoforms (PKC
,
,
,
, and µ), which are diacylglycerol-dependent but Ca2+-independent; and the atypical isoforms (PKC
and
/
), which possess only one zinc finger and lack the characteristic C-2 domain, hence they are insensitive to both Ca2+ and diacylglycerol (1113). PKC isoenzymes exhibit distinct tissue distribution and play a distinct role in various cellular events including cell survival, proliferation, and tumorigenesis (13, 14). For example, PKC
, an atypical PKC isoform, presents predominantly in the lung and brain (15), suggesting a potential role in lung cancer development. Recent studies indicate that PKC
can potently suppress apoptosis following treatment with chemotherapeutic drugs, but the downstream survival substrate(s) is not clear (16).
The Bcl2 family is comprised of at least 20 members that function as key regulators of cell survival and apoptosis (17). The subfamily including Bcl2 and Bcl-XL inhibits apoptosis, whereas the Bax subfamily consisting of Bax and Bak as well as the BH3-only subfamily including Bad, Bid, Bok, Bik, and Bim promotes apoptosis (18). Functional studies have identified the importance of conserved Bcl2 homology domains (BH1, BH2, BH3, and BH4) in functionally related family members and the hydrophobic region in the C terminus is predicted to be the membrane-spanning domain that anchors these molecules to the outer mitochondrial membrane. Bcl2 and Bcl-XL have hydrophobic crevices on their surfaces that can bind to the BH3 domain of other family members (19, 20). Upon death stresses, the BH3-only proteins can couple death signals to mitochondria and bind and inactivate Bcl2/Bcl-XL via their BH3 domain (21). Bad, a BH3-only protein that lacks the typical hydrophobic C-terminal signal anchor, is a unique proapoptotic Bcl2 family member, because its function is tightly regulated by serine (Ser) phosphorylation at Ser-112, Ser-136, and Ser-155 (22). Bad represents a bridging molecule interconnecting signal transduction pathways from extracellular survival factors with the Bcl2 intracellular checkpoint for cell death. Bad is phosphorylated on serine residues embedded in canonical 14-3-3 binding sites in response to a survival factor (23). Biologically active Bad is a dephosphorylated form and interacts with Bcl2/Bcl-XL to quench their antiapoptotic function. By contrast, the inactive form of Bad is highly phosphorylated and binds to 14-3-3 scaffold proteins and cannot interact with Bcl2/Bcl-XL (2329). Thus, phosphorylation and dephosphorylation can switch the binding target of Bad to regulate its proapoptotic function. Although it is now clear that phosphorylation of Bad is able to abrogate its proapoptotic activity (27, 30), the signaling mechanism(s) by which Bad is regulated remains enigmatic.
Our previous study indicates that NNK-induced Bcl2 phosphorylation may be one of the mechanisms of NNK-enhanced cell survival (31). Because some lung cancer cells express low or undetectable levels of endogenous Bcl2 (32), it is possible that other Bcl2 family member(s), for example, Bad, may be involved in NNK-induced survival signal pathway(s). We and others (22, 33) recently discovered that nicotine can stimulate Bad phosphorylation in association with increased cell survival. In this study, we identified that Bad can function as a physiological PKC
downstream substrate in the NNK-induced survival signaling pathway.
 |
EXPERIMENTAL PROCEDURES
|
|---|
MaterialsRecombinant, active PKC
was purchased from Invitrogen Corporation. PKC
, PKC
, Bcl2, Bad, phosphospecific Bad, Bcl-XL,
-tubulin, and c-Src antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Recombinant Bad protein was purchased from Upstate (Charlottesville, VA). NNK was obtained from Toronto Research Chemicals (Toronto, Canada). Propranolol, etoposide (VP-16), and cisplatin were purchased from Sigma. Puromycin, staurosporine, hygromycin, and PP2 were purchased from Calbiochem. The PKC
/pAXneoRX construct is a kind gift from Dr. Alan P. Fields (16). All reagents used were obtained from commercial sources unless otherwise stated.
Cell Lines and Cell CultureA549 cells were maintained in F-12K medium with 10% fetal bovine serum and 4 mM L-glutamine. NCI-H69, NCI-H82, NCI-H157, NCI-H23, NCI-H358, NCI-H460, and NCI-H1299 cells were maintained in RPMI 1640 medium with 10% fetal bovine serum.
Metabolic Labeling, Immunoprecipitation, and Western Blot AnalysisCells were washed with phosphate-free RPMI 1640 medium and metabolically labeled with [32P]orthophosphoric acid for 90 min. After treatment with NNK or inhibitors, cells were washed with ice-cold phosphate-buffered saline and lysed in 0.5% Nonidet P-40 lysis buffer containing a mixture of protease inhibitors as described (22, 31). Bad was immunoprecipitated using an agarose-conjugated Bad antibody. The samples were subjected to 12% SDS-PAGE, transferred to a nitrocellulose membrane, and exposed to Kodak X-Omat film at 80 °C. Bad phosphorylation was determined by autoradiography. The same filter was then probed by Western blot using a Bad antibody and developed using an ECL kit from Amersham Biosciences.
Immunofluorescent Staining5 x 106 of A549 cells were washed with 1x phosphate-buffered saline, plated on a glass slide, fixed with ice-cold methanol, and blocked with 10% donkey serum. Then, cells were incubated with a mouse Bad and rabbit PKC
primary antibodies for 90 min. After washing, samples were incubated with rhodamine-conjugated anti-rabbit and fluorescein isothiocyanate-conjugated anti-mouse secondary antibodies for 60 min. Cells were washed with phosphate-buffered saline and observed under a fluorescent microscope (Zeiss). Pictures were taken and colored with the same exposure setting for each experiment. To determine subcellular regions of protein colocalization, individual red- and green-stained images derived from the same field were merged using Openlab 3.1.5 software from Improvision, Inc. (Lexington, MA). Areas of protein co-localization appear yellow.
Assay of PKC
Activity in VitroPKC
was immunoprecipitated from cell lysates with an agarose-conjugated PKC
antibody. Immunoprecipitated PKC
was washed and resuspended in 50 µl of kinase assay buffer containing 50 mM Tris, pH 7.5, 10 mM MgCl2, 0.5 mM EGTA, 0.1 mM CaCl2,10 µM ATP, 40 µg/ml phosphatidylserine, 10 µg of histone-1, and 10 µCi of [
-32P]ATP. The reactions were incubated at room temperature for 30 min and terminated by the addition of SDS sample buffer and boiling prior to SDS-polyacrylamide gel electrophoresis. The activity of PKC
was determined by autoradiography.
Measurement of Intracellular c-Src ActivityA549 cells were stimulated with NNK, harvested, and lysed in 0.5% Nonidet P-40 lysis buffer. The c-Src was immunoprecipitated from the lysates using a c-Src antibody. The complexes were washed three times with 500 µl of lysis buffer and twice with c-Src kinase assay buffer (20 mM HEPES, pH 7.0, 10 mM MnCl2, 0.05% Triton X-100). Then the immune complex beads were suspended in 45 µl of kinase assay buffer containing 1 µg of acid-treated enolase as described (34). The kinase reaction was initiated by the addition of 2µCi of [
-32P]ATP, and the reaction mixture was incubated at 30 °C for 10 min. The reaction was stopped by the addition of 50 µl of 2x SDS-PAGE sample buffer. Radiolabeled proteins were resolved by 10% SDS-PAGE, transferred to a nitrocellulose membrane, and exposed to Kodak X-Omat film at 80 °C for 24 h. The activity of c-Src was determined by autoradiography. The same filter was then probed by Western blot analysis using a c-Src antibody.
Vector-based Gene Silencing of Bad or PKC
by RNA Interference (RNAi)The Bad or PKC
DNA target sequence for siRNA design is AAGAAGGGACTTCCTCGCCCG or AACTTCCTGAAGAACATGCCA, respectively. This was determined by siRNA Target Finder (Ambion, Austin, TX) according to human Bad or PKC
cDNA sequence. The Bad- or PKC
-specific hairpin siRNA insert (sense-loop-antisense) was determined using a computerized insert design tool based on a target sequence following instructions from the Ambion web site. Then, the oligonucleotide encoding the Bad- or PKC
-specific hairpin siRNA insert was synthesized and ligated into pSilencerTM 2.1-U6 hygro vector from Ambion. The pSilencerTM 2.1-U6 hygro plasmids bearing the Bad or PKC
hairpin siRNA were transfected into A549 cells using LipofectamineTM 2000 according to the manufacturer's instructions. The stable clones persistently producing Bad or PKC
siRNA were selected using hygromycin (0.8 mg/ml). The levels of Bad or PKC
expression were analyzed by Western blot using Bad or PKC
antibody, respectively.
Cell Viability AssayThe apoptotic and viable cells were detected using an ApoAlert Annexin-V kit from Clontech according to the manufacturer's instructions. The percentage of annexin-Vlow cells (percentage of viable cells) or annexin-Vhigh cells (percentage of apoptotic cells) was determined by fluorescence-activated cell sorter analysis as described (35). Cell viability was also confirmed using the trypan blue dye exclusion method (36).
 |
RESULTS
|
|---|
NNK Induces Activation of PKC
and Multisite Phosphorylation of Bad in Association with Increased Cell SurvivalPKC
mRNA has been reported to predominantly express in brain and lung (15), suggesting that PKC
may play a role in the development and/or chemoresistance of human lung cancer. Because PKC
plays a role in supporting cell survival (16), and both small and non-small cell lung cancer cells express high levels of endogenous PKC
(Fig. 1A), NNK may activate PKC
to promote cell survival. To test this, A549 cells were treated with increasing concentrations of NNK as indicated. PKC
was immunoprecipitated using an agarose-conjugated PKC
antibody. Activity of PKC
was measured by an immune complex kinase assay using purified histone-1 as a substrate as described (37). The same filter was then probed by Western blot using a PKC
antibody to quantify PKC
protein. Results indicate that NNK potently activates PKC
in association with prolonged survival of A549 cells following treatment of cells with cisplatin or VP-16 (Fig. 1). PKC
protein is recognized only by the PKC
antibody but not by the PKC
antibody (Fig. 1B), demonstrating its specificity for PKC
as reported previously (16). Importantly, Bad is co-expressed with PKC
in various human lung cancer cells (Fig. 1A), and NNK can potently induce Bad phosphorylation at Ser-112, Ser-136, and Ser-155 sites (Fig. 1D). Similar results were obtained using NCI-H1299 cells (data not shown), indicating that NNK-activated PKC
may have the potential to phosphorylate Bad and regulate the proapoptotic activity of Bad and cell survival.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 1. NNK activates PKC in association with multisite Bad phosphorylation and increased cell survival. A, expression levels of endogenous PKC , Bcl2, and Bad in various human lung cancer cells were analyzed by Western blot using a PKC , Bcl2, or Bad antibody, respectively. SCLC, small cell lung cancer; NSCLC, non-small cell lung cancer. B, A549 cells were treated with increasing concentrations of NNK for 60 min. PKC was immunoprecipitated and incubated with purified histone 1 in an in vitro kinase assay as described under "Experimental Procedures." PKC activity was analyzed by autoradiography. PKC protein was quantified by Western blot using a PKC antibody. To confirm the specificity of the PKC antibody, the same filter was reprobed using a PKC antibody. C, A549 cells were treated with cisplatin (Cis) (40 µM) or VP-16 (50 µM) in the absence or presence of NNK for 24 h. Samples were harvested and analyzed for annexin-V and phosphatidylinositol binding by flow cytometry. Cell viability was determined by a fluorescence-activated cell sorter as described previously (35). Data represent the mean ± S.D. of three determinations. D, A549 cells expressing high levels of endogenous Bad were treated with NNK (1 µM) for various times. Phosphorylation of Bad was determined by Western blot using phosphospecific Bad Ser-112 (S112), Ser-136 (S136), or Ser-155 (S155) antibodies, respectively. Total Bad protein was quantified using a Bad antibody.
|
|
PKC
Co-localizes with Bad in the Cytoplasm of Lung Cancer Cells and Active PKC
Can Directly Phosphorylate Bad at Ser-112, Ser-136, and Ser-155 Sites in Vitro and in VivoTo assess a potential direct role for PKC
as a physiological Bad kinase, subcellular distribution of PKC
and Bad was examined by immunofluorescent staining. A mouse polyclonal antibody against human Bad, rabbit polyclonal PKC
antibody, and fluorescein isothiocyanate-conjugated anti-mouse (green) or rhodamine-conjugated anti-rabbit (red) secondary antibodies were used so that cells could be simultaneously stained without cross-reaction. As shown in Fig. 2A, Bad is primarily co-localized with PKC
in the cytoplasm of A549 cells. To test whether PKC
can directly phosphorylate endogenous Bad, the Bad protein was immunoprecipitated from A549 cells and incubated with purified, active PKC
in a kinase assay buffer containing [
-32P]ATP as described under "Experimental Procedures." Results indicate that active PKC
directly phosphorylates Bad in vitro (Fig. 2B). In addition, active PKC
can also directly phosphorylate recombinant Bad protein at Ser-112, Ser-136, and Ser-155 sites in a time-dependent manner (Fig. 2C). These findings suggest that PKC
is a strong candidate for being the direct Bad kinase. To determine whether PKC
may be a Bad kinase in vivo, a PKC
/pAXneoRX expression construct was transfected into NCI-H157 cells that express relatively low levels of endogenous PKC
. After transfection for 48 h, expression levels of exogenous PKC
and Bad phosphorylation were analyzed by Western blotting using PKC
or phosphospecific Bad antibodies, respectively. Results reveal that overexpression of PKC
results in an increased Bad phosphorylation at Ser-112, Ser-136, and Ser-155 (Fig. 3). Importantly, phosphorylation sites are consistent with in vitro results (Fig. 2C). These findings provide both biochemical and genetic evidence that Bad is a novel physiological PKC
survival substrate.
NNK Stimulates Activation of c-Src, Which Is a PKC
Upstream Kinase and the Src-specific Inhibitor PP2 Blocks NNK-induced PKC
Activation, Bad Phosphorylation, and Enhances ApoptosisOur data showed that NNK potently stimulates activation of PKC
in association with enhanced cell survival (Fig. 1). However, the upstream protein kinase(s) involved remains unclear. PKC
is insensitive to Ca2+ due to the absence of the calcium-binding domain (13). Thus, NNK-induced activation of PKC
may occur through a calcium-independent mechanism. Because c-Src has been reported to directly induce tyrosine phosphorylation of PKC
at tyrosine 256, 271, and 325 sites along with activation of enzyme activity (34), and c-Src is ubiquitously expressed in both small and non-small cell lung cancer cells (Fig. 4A), we postulate that NNK may stimulate c-Src activity to activate PKC
. To test this, A549 cells expressing high levels of endogenous c-Src were treated with NNK for various times followed by immunoprecipitation of c-Src and measurement of its activity by an immune complex kinase assay with acid-treated enolase as a substrate as described under "Experimental Procedures." Results reveal that NNK potently enhances c-Src activity in a time-dependent manner (Fig. 4B). To pharmacologically test whether c-Src functions upstream of PKC
/Bad in NNK survival signaling, A549 cells were treated with NNK in the absence or presence of increasing concentrations of the Src-specific tyrosine kinase inhibitor PP2 (34). Results show that PP2 inhibits NNK-induced PKC
activation in association with decreased Bad phosphorylation and enhanced cell death (Fig. 4, C and D). Collectively, these findings suggest that NNK-induced survival of human lung cancer cells may occur in a mechanism involving the c-Src/PKC
/Bad signal pathway.
PKC Inhibitor Staurosporine Inhibits NNK-induced Bad Phosphorylation and Enhances ApoptosisStaurosporine is a potent, cell-permeable inhibitor of PKC that can block conventional, novel, and atypical PKC isoenzymes (38, 39). To test whether staurosporine affects NNK-stimulated Bad phosphorylation and cell survival, A549 cells were treated with NNK in the absence or presence of increasing concentrations of staurosporine. Results indicate that staurosporine potently blocks NNK-induced multisite Bad phosphorylation and promotes apoptotic cell death following treatment of cells with cisplatin or VP-16 (Fig. 5). These findings reveal that staurosporine-sensitive PKC (i.e. PKC
) may be involved in NNK-induced Bad phosphorylation and survival of A549 cells.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 5. PKC inhibitor staurosporine (Stauro) reduces NNK-induced Bad phosphorylation and enhances apoptosis. A, A549 cells were treated with NNK (1 µM) in the absence or presence of increasing concentrations of staurosporine for 30 min. Phosphorylation of Bad was analyzed as described in the legend for Fig. 1. B, A549 cells were treated with cisplatin (Cis) or VP-16 in absence or presence of NNK or increasing concentrations of staurosporine for 24 h. Cell viability was assessed as described in the legend for Fig. 1. Data represent the mean ± S.D. of three determinations.
|
|
The
-Adrenergic Receptor-specific Inhibitor Propranolol Potently Inhibits NNK-induced Bad Phosphorylation and Enhances ApoptosisNNK is a
-adrenergic receptor agonist which can stimulate DNA synthesis in lung adenocarcinoma (40). To test whether the
-adrenergic receptor is involved in NNK/c-Src/PKC
/Bad signaling, A549 cells were treated with NNK in the absence or presence of increasing concentrations of propranolol (a
-adrenergic receptor-specific inhibitor (22)). Results show that propranolol potently inhibits both NNK-induced PKC
activation and Bad phosphorylation (Fig. 6A). Importantly, propranolol abrogates NNK-induced cell survival following treatment with cisplatin or VP-16 (Fig. 6B). These results implicate NNK-induced Bad phosphorylation in a mechanism involving the upstream
-adrenergic receptor in pulmonary adenocarcinoma cells.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 6. The -adrenergic receptor-specific inhibitor propranolol potently inhibits NNK-induced Bad phosphorylation and enhances apoptosis. A, A549 cells were treated with NNK (1 µM) in the absence or presence of increasing concentrations of propranolol for 30 min. PKC activity was analyzed as described in Fig. 1. For Bad phosphorylation, A549 cells were metabolically labeled with [32P]orthophosphoric acid for 90 min and then treated with NNK (1 µM) in the absence or presence of increasing concentrations of propranolol. Phosphorylation of Bad was analyzed by autoradiography. B, A549 cells were treated with cisplatin (Cis) or VP-16 in the absence or presence of NNK or increasing concentrations of propranolol for 24 h. Cell viability was assessed as described in the legend for Fig. 1. Data represent the mean ± S.D. of three determinations.
|
|
NNK- or PKC
-induced Bad Phosphorylation Disrupts Bad/Bcl-XL InteractionThe proapoptotic activity of Bad is regulated by serine phosphorylation. Dephosphorylated Bad can potently bind to Bcl-XL and quench the survival function of Bcl-XL (23). To test whether NNK-induced Bad phosphorylation inhibits Bad/Bcl-XL association, A549 cells were treated with increasing concentrations of NNK as indicated. A co-immunoprecipitation experiment was carried out using an agarose-conjugated Bad antibody. Bad-associated Bcl-XL (i.e. bound Bcl-XL) and Bad were analyzed by Western blotting using Bcl-XL or Bad antibody, respectively. Results reveal that the treatment of cells with NNK results in Bad dissociation from Bcl-XL in a dose-dependent manner, although NNK does not affect expression levels of Bcl-XL (Fig. 7, A and B). Because our results indicate that NNK-induced Bad phosphorylation occurs through activation of PKC
, activated PKC
may directly phosphorylate Bad and disrupt Bad/Bcl-XL binding. To test this, the Bad/Bcl-XL complex was co-immunoprecipitated from A549 cells using an agarose-conjugated Bad antibody and incubated with purified, active PKC
in a kinase assay buffer containing [
-32P]ATP as described under "Experimental Procedures." The phosphorylation of Bad was determined by autoradiography. Bad-associated Bcl-XL (i.e. bound Bcl-XL), non-bound Bcl-XL, and Bad were analyzed as above. The results indicate that PKC
induces a time-dependent phosphorylation of Bad in association with decreased interaction with Bcl-XL, which is characterized by a reduced amount of bound Bcl-XL and enhanced level of non-bound Bcl-XL (Fig. 7C). These findings suggest that PKC
can directly disrupt the Bad/Bcl-XL complex in a mechanism that likely involves Bad phosphorylation.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 7. NNK- or PKC -induced Bad phosphorylation disrupts Bad/Bcl-XL interaction. A, A549 cells were treated with increasing concentrations of NNK for 30 min. The cells were then harvested, washed, and lysed in detergent buffer. The levels of Bcl-XL in total lysate were analyzed by Western blot using a Bcl-XL antibody. B, A549 cells were treated with increasing concentrations of NNK for 30 min. A co-immunoprecipitation (IP) experiment was performed using an agarose-conjugated Bad antibody. Bad-associated Bcl-XL (i.e. Bound Bcl-XL) or total Bad was analyzed by Western blot using a Bcl-XL or a Bad antibody, respectively. C, the Bad/Bcl-XL complex was co-immunoprecipitated from A549 cells using an agarose-conjugated Bad antibody and incubated with purified, active PKC in a kinase assay buffer in vitro for various times. The samples were centrifuged at 14,000 x g for 5 min. The resulting supernatant and immunocomplex beads were subjected to SDS-PAGE. Phosphorylation of Bad was determined by autoradiography. Bad, bound Bcl-XL, and non-bound Bcl-XL were analyzed by Western blot using a Bad or Bcl-XL antibody, respectively.
|
|
Depletion of PKC
by RNAi Suppresses NNK-induced Bad Phosphorylation and Enhances Bad/Bcl-XL Interaction as Well as ApoptosisOur data strongly indicated that PKC
functions as a NNK-activated Bad kinase in human lung cancer cells (Figs. 1, 2, 3). To test whether PKC
is required for NNK-stimulated multisite Bad phosphorylation, a vector-based stable gene silencing approach was employed for specific depletion of PKC
from human lung cancer cells. The pSilencerTM 2.1-U6 hygro plasmids bearing the PKC
hairpin siRNA insert were transfected into A549 cells using LipofectamineTM 2000. The stable clones persistently producing PKC
siRNA were selected using hygromycin. The results indicated that cells expressing PKC
siRNA display more than a 95% reduction of PKC
protein expression (Fig. 8A). This silencing effect for PKC
is specific, because it does not affect expression of other PKCs (i.e. PKC
or -
; Fig. 8A). A specific disruption of PKC
expression by RNAi blocks NNK-induced Bad phosphorylation in association with enhanced Bad/Bcl-XL interaction and apoptotic cell death following treatment of cells with cisplatin or VP-16 in the absence or presence of NNK (Fig. 8). In addition, NNK can reduce Bad/Bcl-XL interaction in cells expressing vector control but not in cells expressing PKC
siRNA (Fig. 8B). These findings indicate that PKC
is required for both NNK-induced Bad phosphorylation and dissociation of the Bad/Bcl-XL complex. Because NNK has no additional survival effect on cells expressing PKC
siRNA, PKC
may be essential for NNK-induced survival of human lung cancer cells.
Bad May Be a Required Target for NNK-induced Survival and Chemoresistance of Human Lung Cancer CellsOur results indicated that NNK can abrogate the proapoptotic activity of Bad by inducing its phosphorylation at multiple sites (i.e. Ser-112, Ser-136, and Ser-155) through activation of PKC
in human lung cancer cells. This suggests that Bad may be a potential target for treatment of patients with lung cancer. To test this, a vector-based stable silencing approach was employed for specific knockdown of the Bad gene as described under "Experimental Procedures." The results indicated that depletion of Bad expression by RNAi enhances cell survival following treatment with cisplatin or VP-16 in the absence or presence of NNK (Fig. 9). This suggests that Bad may be a potential therapeutic target for patients with lung cancer.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 9. Bad is a required target for NNK-enhanced cell survival. A, the pSilencerTM 2.1-U6 hygro plasmids bearing the Bad hairpin siRNA insert were transfected into A549 cells using LipofectamineTM 2000. The levels of Bad expression were analyzed by Western blot using a Bad antibody. B, A549 cells expressing Bad siRNA were treated with cisplatin (Cis) or VP-16 in the absence or presence of NNK for 24 h. Cell viability was assessed as described in the legend for Fig. 1.
|
|
 |
DISCUSSION
|
|---|
Both nicotine and NNK have been found to prolong cell survival, which may be associated with increased chemoresistance of human lung cancer cells but our understanding of the molecular mechanism(s) is fragmentary (22, 31). PKC isoforms that appear to be anti-apoptotic include PKC
, PKC
II, PKC
, and the atypical isoforms PKC
and PKC
(41). Previous studies reveal that the drug-resistant phenotype is associated with expression and/or activity of PKCs in lung cancer cell lines and lung carcinomas (41). PKC
is an atypical PKC isoform, and Northern blot analysis, using the full-length PKC
cDNA as a probe, revealed that the PKC
transcript presents predominantly in the lung and brain (15). Consistently, our data show that PKC
is ubiquitously expressed in both human small cell and non-small cell lung cancer cells (Fig. 1A). Because NNK can potently activate PKC
and enhances survival of human lung cancer cells (Fig. 1B), NNK-stimulated survival and/or chemoresistance may occur, at least in part, through activation of PKC
. PKC
has been reported to be an anti-apoptotic protein kinase (16), but the downstream survival effector(s) involved remains unknown. Because the decision phase for cell survival and cell death is largely regulated by the Bcl2 family of apoptotic regulators (42), a Bcl2 family member(s) may be the most attractive candidate for the substrate of PKC
in NNK/survival signaling. Importantly, Bad, a BH3-only proapoptotic protein, is widely expressed in various lung cancer cells, and NNK potently induces multisite Bad phosphorylation (i.e. Ser-112, Ser-136, and Ser-155), which is known to abrogate the proapoptotic activity of Bad (Fig. 1), suggesting that Bad may function as a survival target of PKC
in human lung cancer cells.
Evidence reported here suggests that PKC
may be a physiological Bad kinase, because PKC
can co-localize with Bad in the cytoplasm and directly phosphorylate either endogenous or recombinant Bad in vitro at Ser-112, Ser-136, and Ser-155 sites, indicating its potential direct role as a Bad kinase (Fig. 2). Confirmation of PKC
as a physiological Bad kinase was obtained in vivo from results of transfection studies demonstrating that PKC
, when overexpressed in NCI-H157 cells, resulted in enhanced phosphorylation of Bad at all three sites, which is consistent with in vitro results (Fig. 3 versus Fig. 2C). Importantly, specific knockdown of PKC
expression by RNAi can significantly inhibit NNK-stimulated Bad phosphorylation at these three sites (Fig. 8). These findings strongly indicate that PKC
is a physiological NNK-activated Bad kinase.
PKC
belongs to an atypical PKC isoenzyme category that differs significantly from other PKC family members in their regulatory domain in that it lacks both the calcium-binding domain and one of the two zinc finger motifs required for diacylglycerol binding (13). These domain variations result in a different requirement for activation. Because PKC
is insensitive to both Ca2+ and diacylglycerol (13), other mechanisms, for example, phosphorylation or protein-protein interaction may be required for PKC
activation. Recent studies reveal that c-Src not only induces tyrosine phosphorylation of PKC
but also directly binds to PKC
, which leads to its activation (34). Because NNK can induce activation of c-Src, which could then in turn phosphorylate PKC
, and the Src-specific inhibitor PP2 blocks NNK-stimulated PKC
activation (Fig. 4), these findings strongly suggest that c-Src most likely functions as a NNK-activated upstream PKC
kinase.
High levels of
-adrenergic receptor are expressed in pulmonary adenocarcinoma cells (43). NNK functions as a
-adrenergic receptor agonist, and its effect could be abrogated by propranolol (a
-adrenergic receptor inhibitor (44, 45)). Src, an upstream kinase of PKC
(34), has been found to play an active role in the agonist-induced activation of
-adrenergic receptors (46, 47). Our results reveal that the
-adrenergic receptor-specific inhibitor propranolol can block NNK-induced activation of PKC
in association with reduced Bad phosphorylation and enhanced apoptosis of A549 cells (Fig. 6), suggesting that the
-adrenergic receptor may be the major upstream receptor in NNK-mediated survival signaling. Thus, propranolol may potentially be developed as a therapeutic drug that specifically targets
-adrenergic receptors to enhance chemosensitivity in patients with lung cancer expressing high levels of
-adrenergic receptor, PKC
and Bad.
In addition to PKC
, previous reports and our data have demonstrated that NNK can also activate other known Bad kinases including MAPKs ERK1/2, AKT, and PKA (Refs. 10, 22, and 48 and data not shown). These various types of Bad kinases may cooperatively regulate the proapoptotic function of Bad through phosphorylation. However, distinct Bad kinases phosphorylate Bad at distinct sites. For example, ERK1/2 is a Bad Ser-112, AKT is a Bad Ser-136, and PKA is a Bad Ser-155 kinase, respectively (29, 4951). By contrast, PKC
is a three-site Bad kinase that can phosphorylate Bad at Ser-112, Ser-136, and Ser-155 sites (Figs. 2 and 3). Thus, PKC
may play a more extensive and/or more important role in NNK survival signaling than that of other Bad kinases. This helps to explain why depletion of PKC
by RNAi potently blocks NNK-induced Bad phosphorylation and enhances cell death (Fig. 8).
Bad phosphorylation at Ser-112, Ser-136, and Ser-155 has been demonstrated to abrogate its proapoptotic function but the mechanism(s) is not fully understood (23, 2527, 30). Our data showed that NNK not only induced Bad phosphorylation via activation of PKC
but also facilitated a dissociation of Bad/Bcl-XL heterodimers (Fig. 7B). As direct evidence for this potential mechanism, purified active PKC
can directly disrupt the Bad/Bcl-XL complex in vitro in a phosphorylation-dependent manner (Fig. 7C). This phosphorylated and unbound form of Bad is no longer able to quench the survival activity of Bcl-XL. Importantly, the specific knockdown of PKC
expression by RNAi enhances the Bad/Bcl-XL interaction in association with inhibition of Bad phosphorylation (Fig. 8). These findings reveal that PKC
may be required for NNK-induced Bad/Bcl-XL dissociation. Therefore, NNK-induced Bad phosphorylation resulting in inactivation of Bad via dissociation from Bcl-XL, which in turn contributes to cell survival (Fig. 10).
In summary, our findings have identified PKC
as a NNK-activated protein kinase that can directly phosphorylate the BH3-only proapoptotic protein Bad at Ser-112, Ser-136, and Ser-155. In addition to single site Bad kinases (i.e. ERK1/2, AKT, and PKA), PKC
can apparently function as a three-site physiological Bad kinase. Thus, NNK-induced cell survival may occur, at least in part, through a novel signaling pathway involving
-adrenergic receptor/c-Src/PKC
/Bad (Fig. 10). PKC
-induced Bad phosphorylation can disrupt the Bad/Bcl-XL complex to abrogate the proapoptotic function of Bad, which may lead to enhanced survival and/or chemoresistance of human lung cancer cells.
 |
FOOTNOTES
|
|---|
* This work was supported by Grant R01 CA112183-01 from the NCI, National Institutes of Health (to X. D.) The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 
To whom correspondence should be addressed: University of Florida Shands, Cancer Center, 1600 SW Archer Rd., Academic Research Bldg., R4-216, P.O. Box 100232, Gainesville, FL 32610-0232. Tel.: 352-392-9232; Fax: 352-392-5802; E-mail: xdeng{at}ufscc.ufl.edu.
1 The abbreviations used are: NNK, nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone; PKC
, protein kinase C iota; MAPK, mitogen-activated protein kinase; ERK, extracellular signal-regulated kinase; PKA, cAMP-dependent protein kinase A; PP2, 4-amino-5-(4-chlorophrnyl)-7-(tert-buty)pyrazolo [3,4-d]pyrimidine; BH, Bcl2 homology domain; siRNA, small interfering RNA; RNAi, RNA interference. 
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Alan P. Fields for kindly providing the human PKC
cDNA.
 |
REFERENCES
|
|---|
- American Cancer Society (2003) Cancer Facts & Figures, pp. 1314, American Cancer Society Inc., Atlanta, GA
- Hecht, S. S. (2003) Nat. Rev. Cancer 3, 733744[CrossRef][Medline]
[Order article via Infotrieve]
- Shopland, D. R. (1995) Environ. Health Perspect. 103, 131142
- Hecht, S. S. (1999) J. Natl. Cancer Inst. 91, 11941210[Abstract/Free Full Text]
- Zheng, T., Holford, T. R., Chen, Y., Ma, J. Z., Mayne, S. T., Liu, W., Flannery, J., and Boyle, P. (1996) Int. J. Cancer 68, 172176[CrossRef][Medline]
[Order article via Infotrieve]
- Kelly, A., Blair, N., and Pechacek, T. F. (2001) J. Womens Health Gend. Based Med. 10, 515518[CrossRef][Medline]
[Order article via Infotrieve]
- Schuller, H. M. (2002) Nat. Rev. Cancer 2, 455 463[CrossRef][Medline]
[Order article via Infotrieve]
- Cloutier, J. F., Drouin, R., Weinfeld, M., O'Connor, T. R., and Castonguay, A. (2001) J. Mol. Biol. 313, 539557[CrossRef][Medline]
[Order article via Infotrieve]
- Bhagwat, S. V., Vijayasarathy, C., Raza, H., Mullick, J., and Avadhani, N. G. (1998) Biochem. Pharmacol. 56, 831839[CrossRef][Medline]
[Order article via Infotrieve]
- West, K. A., Brognard, J., Clark, A. S., Linnoila, I. R., Yang, X., Swain, S. M., Harris, C., Belinsky, S., and Dennis, P. A. (2003) J. Clin. Investig. 111, 8190[CrossRef][Medline]
[Order article via Infotrieve]
- Zhang, J., Anastasiadis, P. Z., Liu, Y., Thompson, E. A., and Fields, A. P. (2004) J. Biol. Chem. 279, 2211822123[Abstract/Free Full Text]
- Mellor, H., and Parker, P. J. (1998) Biochem. J. 332, 281292
- Spitaler, M., Villunger, A., Grunicke, H., and Uberall, F. (2000) J. Biol. Chem. 275, 3328933296[Abstract/Free Full Text]
- Dumont, J. A., and Bitonti, A. J. (1994) Biochem. Biophys. Res. Commun. 204, 264272[CrossRef][Medline]
[Order article via Infotrieve]
- Selbie, L. A., Schmitz-Peiffer, C., Sheng, Y., and Biden, T. J. (1993) J. Biol. Chem. 268, 2429624302[Abstract/Free Full Text]
- Murray, N. R., and Fields, A. P. (1997) J. Biol. Chem. 272, 2752127524[Abstract/Free Full Text]
- Cory, S., and Adams, J. M. (2002) Nat. Rev. Cancer 2, 647 656[CrossRef][Medline]
[Order article via Infotrieve]
- Suzuki, M., Youle, R. J., and Tjandra, N. (2000) Cell 103, 645654[CrossRef][Medline]
[Order article via Infotrieve]
- Lin, B., Kumar, S., Lin, F., Liu, W., Han, Y., Cao, X., Dawson, M. I., Reed, J. C., and Zhang, X. (2004) Cell 116, 527540[CrossRef][Medline]
[Order article via Infotrieve]
- Sattler, M., Liang, H., Nettesheim, D., Meadows, R., Harlan, J., Eberstadt, M., Yoon, H., Shuker, S., Chang, B., Minn, A., Thompson, C., and Fesik, S. (1997) Science 275, 983986[Abstract/Free Full Text]
- Huang, D. C., and Strasser, A. (2000) Cell 103, 839842[CrossRef][Medline]
[Order article via Infotrieve]
- Jin, Z., Gao, F., Flagg, T., and Deng, X. (2004) J. Biol. Chem. 279, 2383723844[Abstract/Free Full Text]
- Zha, J., Harada, H., Yang, E., Jockel, J., and Korsmeyer, S. J. (1996) Cell 87, 619628[CrossRef][Medline]
[Order article via Infotrieve]
- Bergmann, A. (2002) Dev. Cell 3, 607608[CrossRef][Medline]
[Order article via Infotrieve]
- Datta, S. R., Katsov, A., Hu, L., Petros, A., Fesik, S. W., Yaffe, M. B., and Greenberg, M. E. (2000) Mol. Cell 6, 4151[CrossRef][Medline]
[Order article via Infotrieve]
- Harada, H., Becknell, B., Wilm, M., Mann, M., Huang, L. J., Taylor, S. S., Scott, J. D., and Korsmeyer, S. J. (1999) Mol. Cell 3, 413422[CrossRef][Medline]
[Order article via Infotrieve]
- Hirai, I., and Wang, H. G. (2001) Biochem. J. 359, 345352[CrossRef][Medline]
[Order article via Infotrieve]
- Masters, S. C., Yang, H., Datta, S. R., Greenberg, M. E., and Fu, H. (2001) Mol. Pharmacol. 60, 13251331[Abstract/Free Full Text]
- Scheid, M. P., Schubert, K. M., and Duronio, V. (1999) J. Biol. Chem. 274, 3110831113[Abstract/Free Full Text]
- Tan, Y., Demeter, M. R., Ruan, H., and Comb, M. J. (2000) J. Biol. Chem. 275, 2586525869[Abstract/Free Full Text]
- Jin, Z., Gao, F., Flagg, T., and Deng, X. (2004) J. Biol. Chem. 279, 4020940219[Abstract/Free Full Text]
- Ikegaki, N., Katsumata, M., Minna, J., and Tsujimoto, Y. (1994) Cancer Res. 54, 68[Abstract/Free Full Text]
- Trombino, S., Cesario, A., Margaritora, S., Granone, P., Motta, G., Falugi, C., and Russo, P. (2004) Cancer Res. 64, 135145[Abstract/Free Full Text]
- Wooten, M. W., Vandenplas, M. L., Seibenhener, M. L., Geetha, T., and Diaz-Meco, M. T. (2001) Mol. Cell. Biol. 21, 84148427[Abstract/Free Full Text]
- Deng, X., Xiao, L., Lang, W., Gao, F., Ruvolo, P., and May, W. S., Jr. (2001) J. Biol. Chem. 276, 2368123688[Abstract/Free Full Text]
- Deng, X., Ruvolo, P., Carr, B., and May, W. S., Jr. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 15781583[Abstract/Free Full Text]
- Jamieson, L., Carpenter, L., Biden, T. J., and Fields, A. P. (1999) J. Biol. Chem. 274, 39273930[Abstract/Free Full Text]
- Tamaoki, T., Nomoto, H., Takahashi, I., Kato, Y., Morimoto, M., and Tomita, F. (1986) Biochem. Biophys. Res. Commun. 135, 397402[CrossRef][Medline]
[Order article via Infotrieve]
- Gescher, A. (2000) Crit. Rev. Oncol. Hematol. 34, 127135[Medline]
[Order article via Infotrieve]
- Schuller, H. M., Tithof, P. K., Williams, M., and Plummer, H. (1999) Cancer Res. 59, 45104515[Abstract/Free Full Text]
- Ding, L., Wang, H., Lang, W., and Xiao, L. (2002) J. Biol. Chem. 277, 3530535313[Abstract/Free Full Text]
- Adams, J. M., and Cory, S. (1998) Science 281, 13221326[Abstract/Free Full Text]
- Park, P. G., Merryman, J., Orloff, M., and Schuller, H. M. (1995) Cancer Res. 55, 35043508[Abstract/Free Full Text]
- Suemaru, K., Kawasaki, H., Oishi, R., Gomita, Y., and Tanizaki, Y. (1997) Naunyn-Schmiedeberg's Arch. Pharmacol. 355, 571575[CrossRef][Medline]
[Order article via Infotrieve]
- Uchida, S., Kawashima, K., and Lee, T. J. (2002) Auton. Neurosci. 96, 126130[CrossRef][Medline]
[Order article via Infotrieve]
- Huang, J., Sun, Y., and Huang, X. Y. (2004) J. Biol. Chem. 279, 2163721642[Abstract/Free Full Text]
- Fan, G., Shumay, E., Malbon, C. C., and Wang, H. (2001) J. Biol. Chem. 276, 1324013247[Abstract/Free Full Text]
- Jull, B. A., Plummer, H. K., III, and Schuller, H. M. (2001) J. Cancer Res. Clin. Oncol. 127, 707717[Medline]
[Order article via Infotrieve]
- Datta, S. R., Dudek, H., Tao, X., Masters, S., Fu, H., Gotoh, Y., and Greenberg, M. E. (1997) Cell 91, 231241[CrossRef][Medline]
[Order article via Infotrieve]
- Zhou, X., Liu, Y., Payne, G., Lutz, R. J., and Chittenden, T. (2000) J. Biol. Chem. 275, 2504625051[Abstract/Free Full Text]
- Fang, X., Yu, S., Eder, A., Mao, M., Bast, R. C., Boyd, D., and Mills, G. (1999) Oncogene 18, 66356640[CrossRef][Medline]
[Order article via Infotrieve]
