Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M411134200 on February 14, 2005

J. Biol. Chem., Vol. 280, Issue 16, 16354-16359, April 22, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/16/16354    most recent
M411134200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, J.
Right arrow Articles by Hao, C.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, J.
Right arrow Articles by Hao, C.-M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

C/EBP{beta} and Its Binding Element Are Required for NF{kappa}B-induced COX2 Expression Following Hypertonic Stress*

Jing Chen{ddagger}§, Min Zhao{ddagger}, Reena Rao{ddagger}, Hiroyasu Inoue¶, and Chuan-Ming Hao{ddagger}§||

From the {ddagger}Division of Nephrology, Department of Medicine, Vanderbilt University, Nashville, Tennessee 37232, the Department of Pharmacology, National Cardiovascular Center Research Institute, 5-7-1 Fujishiro-dai, Suita, Osaka 565-8565, Japan, and the §Division of Nephrology, Huashan Hospital, Fudan University, Shanghai 200040, China

Received for publication, September 28, 2004 , and in revised form, February 7, 2005.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
NF{kappa}B plays a critical role mediating COX2 expression in renal medullary interstitial cells (RMICs). The trans-activating ability of NF{kappa}B can be modified by another nuclear factor C/EBP{beta} that can physically bind to NF{kappa}B and regulate its activity. Because the COX2 promoter also contains a C/EBP{beta} site adjacent to the NF{kappa}B site, the present study examined whether these two transcription factors cooperate to induce COX2 expression following hypertonic stress. Hypertonicity markedly induced COX2 expression in cultured medullary interstitial cells by immunoblot analysis. The tonicity-induced COX2 expression was suppressed by mutant I{kappa}B (I{kappa}Bm) that blocks NF{kappa}B activation, demonstrating that tonicity-induced COX2 expression depends on NF{kappa}B activation. However, mutation of the NF{kappa}B site in the COX2 promoter failed to abolish tonicity-induced COX2 reporter activity. I{kappa}B kinase-1 (IKK1) significantly induced COX2-luciferase activity by 2.3-fold (n = 10, p < 0.01); mutation of the NF{kappa}B site also failed to abolish IKK1-stimulated COX2 reporter activity (86 ± 3.1% of wild type, p > 0.05, n = 4). Interestingly, mutation of the C/EBP{beta} site of the COX2 gene significantly reduced both IKK1 and hypertonicity-induced COX2 reporter activity (p < 0.01). To further examine the potential role of C/EBP{beta} in tonicity-induced COX2 expression, a dominant negative C/EBP{beta}-p20 was transduced into RMICs. C/EBP{beta}-p20 markedly suppressed hypertonic (550 mOsm) induction of COX2 (immunoblot) to a similar extent as I{kappa}Bm. No additional suppression was observed when both NF{kappa}B and C/EBP{beta} were simultaneously blocked by I{kappa}Bm and C/EBP{beta}-p20. Interestingly, IKK-induced COX2 expression was not only blocked by I{kappa}Bm, but also completely abolished by C/EBP{beta}-p20. Further studies demonstrated physical association of C/EBP{beta} to NF{kappa}B p65 by coimmunoprecipitation. Importantly, this interaction between C/EBP{beta} and NF{kappa}B was greatly enhanced following hypertonic stress. These studies indicate C/EBP{beta} is required for the transcriptional activation of COX2 by NF{kappa}B, suggesting a dominant role for the C/EBP{beta} pathway in regulating induction of RMIC COX2 by hypertonicity.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cyclooxygenase (COX)1 is a key enzyme in the conversion of arachidonic acid to prostaglandin H, which is further catalyzed to five major bioactive prostaglandins (e.g. PGE2, PGI2, PGF2{alpha}, PGD2, and TXA2) through their distinct synthases. Two isoforms of COX have been identified, designated COX1 and COX2 (1, 2). COX1 is constitutively expressed in most tissues detected and is thought to carry out housekeeping functions, such as cytoprotection of the gastric mucosa, regulation of renal blood flow, and control of platelet aggregation. In contrast, COX2 mRNA and protein are normally undetectable in most tissues, but can be rapidly induced by a variety of stimuli, including various cytokines, growth factors, oncogenes, endotoxins, and chemicals (2). Accumulating evidence suggests that COX2-mediated prostaglandins play important roles in regulating cellular homeostasis, inflammation, and tumorigenesis (25).

The kidney is one of the few organs where constitutive COX2 expression is detected. Renal medullary interstitial cells (RMICs) are a major site of COX2 expression in the kidney (68). Recent studies indicate that the hypertonic environment in renal medulla is an important factor contributing to COX2 expression (7, 9). Expression of COX2 plays an important role promoting renal medullary interstitial cells to survive otherwise lethal changes in environmental tonicity (7, 10), which is critical to the regulation of urinary concentrating ability. The mechanism by which renal medullary interstitial cell COX2 expression is regulated following hypertonic stress has only been partially characterized (7, 9). Studies suggest that in RMICs, hypertonic stress activates nuclear factor NF{kappa}B, and this is critical for induction of COX2 expression in renal medullary interstitial cells (7). NF{kappa}B has also been reported to be an important signaling pathway promoting COX2 expression by such stimuli as hypoxia and tumor necrosis factor, etc. (1116). NF{kappa}B binding sites have been identified in the promoter region of the COX2 gene (17, 18), making it likely that binding of the NF{kappa}B protein to the NF{kappa}B cis-acting element is responsible for increased COX2 expression. However, recent studies indicate that the mechanism underlying NF{kappa}B-associated COX2 expression is more complex. Interactions between NF{kappa}B and other nuclear factors such as C/EBP, SP1, and PPAR have been reported (1921). Cross-talk among these transcriptional factors can be critical for their transcriptional activity (2224). The present studies examined the mechanism by which NF{kappa}B activates COX2 gene expression in cultured renal medullary interstitial cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—Rabbit medullary interstitial cells were cultured as described previously (6). Briefly, female New Zealand White rabbits were anesthetized (44 mg/kg ketamine and 10 mg/kg xylazine, i.m.). The left kidney was removed, and the medulla was dissected and minced with a razor blade under sterile conditions in 5 ml of sterile RPMI 1640 plus 10% (v/v) fetal bovine serum (Hyclone, Logan, Utah). This homogenate was injected subcutaneously in the abdominal wall using a 14-gauge needle. Twenty days postsurgery, subcutaneous nodules appeared. The rabbits were re-anesthetized and sacrificed by decapitation, and the nodules removed under sterile conditions. Nodules were minced into 1-mm fragments and explanted in 75-cm2 tissue culture plates. Cells were cultured in RPMI 1640 tissue culture medium supplemented with 10% (v/v) fetal bovine serum, and streptomycin and penicillin. Cultures were incubated at 37 °C in 95% O2, 5% CO2. Tissue culture medium was changed every 48–72 h. Mouse RMICs were prepared as reported (7). C57BL/6J mice were sacrificed, and kidneys were rapidly removed and washed in Ringer's solution. The renal medulla was excised, minced, and placed in Ringer's solution containing collagenase (1 mg/ml) at 37 °C for 1 h with occasional agitation. The collagenase-treated tissue was then washed in Dulbecco's modified Eagle's medium (DMEM) three times and cultured in DMEM containing 10% fetal bovine serum. Cells were studied in their third to fourth passages. These cells exhibited characteristic abundant oil red O-positive lipid droplets, a characteristic of type I RMICs (25).

Immunoblotting—Immunoblots were performed on whole cell lysates from cultured RMICs. The protein concentration was determined using the bicinchoninic acid protein assay (Sigma). Thirty micrograms of protein extract were loaded in each lane of a 10% SDS-PAGE minigel and run at 120 V. Protein was transferred to a nitrocellulose membrane at 22 V overnight at 4 °C. The membrane was washed three times with TBST (50 mM Tris, pH 7.5, 150 mM NaCl, 0.05% Tween 20) and then incubated in blocking buffer (150 mM NaCl, 50 mM Tris, 0.05% Tween 20, and 5% Carnation nonfat dry milk, pH 7.5) for 1 h at room temperature. The membrane was then incubated with an antihuman COX2 antibody (1:1,000, 160106, Cayman), anti-C/EBP{beta} (1:400 sc-150, Santa Cruz Biotechnology), or anti-p-C/EBP{beta} (1:500, 3084, Cell Signaling Technology) antibody in blocking buffer overnight at 4 °C. Following washing (3x), the membrane was incubated with a horseradish peroxidase-conjugated secondary antibody (1:20,000, Jackson Immuno-Research Laboratories) for 1 h at room temperature, followed by three 15-min washes. Antibody labeling was visualized by addition of the chemiluminescence reagent (Renaissance, PerkinElmer Life Sciences), and the membrane was exposed to Kodak XAR-5 film.

Nuclear Protein Extraction and Immunoprecipitation—Cultured cells were washed with phosphate-buffered saline and lysed on ice for 15 min in hypotonic lysis buffer (10 mM HEPES, 5 mM KCl, 1.5 mM MgCl2, 1 mM NaF, 1 mM Na3VO3, and 0.08% Nonidet P-40) containing proteinase inhibitor mixture (1 tablet/10 ml, Complete Mini, Roche Applied Science). The cell lysate was centrifuged at 4 °C at 3,000 rpm for 5 min. The supernatant (cytoplasmic proteins) was stored at -80 °C. The pellet was washed with hypotonic lysis buffer two times and centrifuged at 13,000 rpm for 5 s. The supernatant was removed, and the pellet was resuspended in 50 µl of Dignin solution (20 mM HEPES, 1.5 mM MgCl2, 0.2 mM EDTA, 420 mM NaCl, 50 mM {beta}-glycerophosphate, 1 mM NaF, 1 mM Na3VO4,1mM dithiothreitol, 25% glycerol, pH 7.9) for 30 min and centrifuged for 10 min at 13,000 rpm. The supernatant nuclear protein was used for immunoprecipitation. 50 µg of nuclear protein extract was added to 500 µl of IP buffer (Tris 20 mM, pH 7.5, NaCl 150 mM,EDTA1mM, EGTA, 1 mM, Triton-100 1%). The nuclear protein was precleared by adding 0.2 µg of rabbit IgG and 20 µl of 25% protein A-agarose, incubated at 4 °C for 30 min, and centrifuged at 3,000 rpm. The supernatant was collected, and 0.4 µg of anti-C/EBP{beta} antibody was added and incubated at 4 °C for 2 h. 20 µl of 25% protein A-agarose beads were added and incubated at 4 °C overnight with mixing. The beads were washed three times with IP buffer and were resuspended in 30 µl of 2x sample buffer. The samples were boiled for 2 min, and 20 µl of precipitated proteins were added to each lane of an SDS-PAGE gel.

Ad-I{kappa}Bmu, Ad-IKK{alpha}, Ad-CEBP-p20, and Ad-GFP—Adenoviral vectors, encoding a dominant negative I{kappa}B and a constitutively active I{kappa}B kinase 1 (IKK1) or a dominant negative C/EBP{beta}-p20, were used to modulate NF{kappa}B and C/EBP activity, respectively, in cultured renal medullary interstitial cells. The trans-dominant inhibitor of NF{kappa}B, I{kappa}Bmut (avian I{kappa}B{alpha}S36/40A) was provided by Dr. Timothy Blackwell (7). Ad-C/EBP{beta}-p20 was provided by Dr. Linda Sealy. Constitutively active IKK1 (IKK1) cDNA was kindly provided by Dr. Frank Mercurio (Signal Pharmaceutical, San Diego, CA) and subcloned into pACCMV for IKK1 adenovirus construction (7). The IKK1 was made constitutively active by Ser-Glu mutations in Ser176 and Ser180 residues (26). An adenovirus expressing green fluorescent protein was constructed as described (27) for a control adenovirus. For infection of RMICs, 200 µl of virus (multiplicity of infection, 100) was added to each culture dish, and GFP adenovirus was used to adjust for equal loading. After a 2-h incubation, the virus was removed, and fresh Dulbecco's modified Eagle's medium with 10% fetal bovine serum was added. Experiments were carried out 48–72 h after infection.

COX2 Reporter Studies—An 891-bp human COX2 luciferase reporter construct was generously provided by Dr. Lee-Ho Wang (17). A 327-bp human COX2 luciferase reporter construct, and its NF{kappa}B and C/EBP{beta} site mutants were provided by Dr. Hiroyasu Inoue (28). The NF{kappa}B and C/EBP{beta} site mutants have been shown to lack the ability to bind to NF{kappa}B and C/EBP, respectively (28, 29). Two NF{kappa}B sites in the 891-bp COX2 reporter construct were mutated via site-directed mutagenesis using primers: CGGCGGCGGGAGAGCTCATTCCCTGCGCCC (5' sense), CAGGAGAGTGGCCACTACCCCCTCTGCT (3' sense) (30) (QuikChange II Site-Directed Mutagenesis kits, Stratagene, La Jolla, CA). The firefly luciferase COX2 reporter plasmid and a plasmid containing Renilla luciferase driven by the TK promoter (Promega) were transfected into cells using SuperFect (Qiagen). Cells were lysed 48 h after transfection for luciferase activity measurement using the Dual Luciferase assay system (Promega). COX2 luciferase activity was adjusted by Renilla luciferase activity.

Chromatin Immunoprecipitation (ChIP) Assay—The ability of NF{kappa}B and C/EBP{beta} to bind to endogenous COX2 promoter was examined using the ChIP assay according to the manufacturer's protocol (Upstate Technologies, Lake Placid, NY). Briefly, cultured mouse renal medullary interstitial cells (7) were exposed to isotonic or hypertonic media for indicated periods of time. Cells were then cross-linked with 1% formaldehyde for 5 min. After washing with phosphate-buffered saline, cells were lysed with SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8.1) containing proteinase inhibitors (Complete Mini, EDTA-free). The chromatin was sheared by sonication (strength, 20%; pulse, 12 s x three times). The cross-linked chromatin was quantified to determine the initial amount of DNA present in the different samples. 100 ng of DNA were used as input. The remaining chromatin fractions were precleared with salmon sperm DNA/protein A-agarose for 1 h and immunoprecipitated with antibodies (NF{kappa}B-p65 or CEBP{beta}, 200 µg/ml, Santa Cruz Biotechnology) overnight at 4 °C. The COX2 promoter DNA, bound to p65 and C/EBP{beta}, was analyzed by PCR using primers: sense, CGGAGGGTAGTTCCATGAAA; antisense, CAGGCTTTTACCCACGCAAA. PCR was performed at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s, for 35 cycles.

To further examine whether the C/EBP{beta} site in the COX2 promoter plays an important role in mediating NF{kappa}B binding to the COX2 gene, wild type or mutants of COX2 promoter constructs containing 327-bp human COX2 promoter sequences, were transfected into mouse interstitial cells using SuperFect (Qiagen). 24 h after transfection, cells were exposed to hypertonic stress for 1 h. The cells were cross-linked and precipitated as described in ChIP assay. The transfected human COX2 promoter bound to NF{kappa}B was detected by PCR using primers specific for the human COX2 gene. PCR primers: sense, CCCCTCTGCTCCCAAATT; antisense, CGCTCACTGCAAGTCGTAT. The PCR was performed at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s, for 35 cycles. Genomic DNA from a human cell line HEK293 cells was used as a positive control. Genomic DNA extracted from mouse renal medullary interstitial cells without transfection was used as a negative control.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mutation of the NF{kappa}B site of the COX2 Promoter Fails to Suppress Induction of the COX2 Reporter by Hypertonic Stress—Our previous studies demonstrate that hypertonicity activates NF{kappa}B, and blocking NF{kappa}B by a mutant I{kappa}B dramatically suppresses hypertonic induction of COX2, suggesting that NF{kappa}B mediates hypertonicity-induced COX2 expression (7). Two NF{kappa}B binding sites have been identified in the human COX2 promoter (-446 to -437 and -223 to -214) (31). To examine whether hypertonicity-induced COX2 expression is mediated via binding of NF{kappa}B protein to the NF{kappa}B element of the COX2 gene, a COX2 luciferase transcription reporter system with mutant NF{kappa}B element was used. Hypertonic stress in RMICs significantly increased COX2 reporter activity in both 891-bp COX2 luciferase reporter construct (Fig. 1)- and 327-bp COX2 reporter construct (Fig. 2)-transfected cells. Surprisingly, mutation of NF{kappa}B sites in the COX2 promoter luciferase reporters failed to abolish hypertonic stress-induced COX2 reporter activity in either COX2 reporter constructs. In contrast, mutation of the C/EBP{beta} binding site completely blocked hypertonic activation of COX2 reporter activity (Fig. 2).



View larger version (11K):
[in this window]
[in a new window]
 
FIG. 1.
Effect of NF{kappa}B site mutation on hypertonicity-induced COX2 luciferase reporter activity in cultured renal medullary interstitial cells. Cultured RMICs were co-transfected with wild-type or mutant COX2 promoter-driven firefly luciferase vector and TK-driven Renilla luciferase plasmid. Cells were exposed to isotonic (300 mOsm) or hypertonic (500 mOsm) medium. 24 h later, luciferase activities were determined as described under "Materials and Methods." **, p < 0.01 versus isotonic medium, n = 6. KBM, NF{kappa}B site mutation.

 



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 2.
COX2 luciferase reporter activity following hypertonic stress. Cultured RMICs were co-transfected with wild-type or mutant COX2 promoter-driven firefly luciferase vector and TK-driven Renilla luciferase plasmid. Cells were cultured in isotonic or hypertonic (500 mOsm) medium for 24 h. Luciferase activities were determined as described under "Materials and Methods." WT, wild type; KBM, NF{kappa}B site mutant; CEBPM, C/EBP{beta} site mutant. **, p < 0.01 versus 300 mOsm.

 
Blocking of C/EBP{beta} Suppresses Hypertonic Induction of COX2 Protein Expression—To further examine the involvement of C/EBP{beta} in COX2 expression following hypertonic stress, a dominant negative isoform of C/EBP{beta}, C/EBP{beta}-p20 (p20) was used to block C/EBP{beta} activity (32, 33). As shown in Fig. 3, induction of COX2 expression by hypertonic stress was suppressed by I{kappa}B mutant that blocked NF{kappa}B activation, consistent with our previous findings (7). These studies now find that a dominant negative C/EBP{beta}-p20 also dramatically reduced the ability of hypertonicity to induce COX2 expression. More importantly, combined treatment with C/EBP{beta}-p20 and I{kappa}Bm did not further reduce COX2 expression, suggesting these two factors participate in the same signaling pathway.



View larger version (57K):
[in this window]
[in a new window]
 
FIG. 3.
Effect of C/EBP{beta}-p20 on hypertonicity-induced COX2 expression. Cultured RMICs were transduced with GFP, I{kappa}Bm, C/EBP-p20, or p20 plus I{kappa}Bm via adenoviral vectors. Cells were then exposed to isotonic (I, 300 mOsm) or hypertonic medium (H, 550 mOsm). 24 h later, cellular proteins were extracted and immunoblotted for COX2.

 
C/EBP{beta}-p20 Suppresses IKK-induced COX2 Protein Expression in RMICs—To further test the hypothesis that NF{kappa}B and C/EBP{beta} participate in the same signaling pathway, we examined the effect of inhibiting C/EBP{beta} in NF{kappa}B-induced COX2 expression. NF{kappa}B was activated by adenoviral transduction with I{kappa}B kinase 1 (IKK1). As expected, IKK1, which phosphorylates I{kappa}B and activates NF{kappa}B, dramatically induced COX2 expression. However, IKK1-induced COX2 expression was blocked not only by an inactive I{kappa}Bm, but also by blocking C/EBP{beta} with C/EBP{beta}-p20 adenovirus (Fig. 4).



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 4.
Effect of C/EBP{beta}-p20 on IKK1-induced COX2 expression. Cultured RMICs were transduced with GFP, IKK1, IKK1 plus I{kappa}Bm, or IKK plus C/EBP-p20 via adenoviral vectors. 24 h later, cellular proteins were extracted and immunoblotted for COX2. A, representative autoradiograph of immunoblot for COX2. B, densitometry analysis of immunoblot for COX2. **, p < 0.01; n = 6

 
Mutation of the COX2 Promoter C/EBP{beta} Binding Site Suppresses IKK-activated COX2 Reporter Activity—To further investigate whether C/EBP{beta} is involved in the transcription mechanisms underlying NF{kappa}B-induced COX2 expression in cultured RMICs, the effect of IKK on the COX2 luciferase reporter system was examined. IKK1 increased COX2 reporter activity by 3-fold (p < 0.01, Fig. 5). However unexpectedly, mutation of the NF{kappa}B site failed to completely abolish IKK1-induced COX2 reporter activity. In contrast, mutation of C/EBP{beta} site completely abolished IKK-induced COX2 reporter activity.



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 5.
IKK-associated COX2 luciferase reporter activity. Cultured RMICs were co-transfected with wild-type or mutant COX2 promoter-driven firefly luciferase vector and TK-driven Renilla luciferase plasmid. Cells were transduced with AdGFP or AdIKK. 24 h later, luciferase activities were determined as described under "Materials and Methods." WT, wild type; KBM, NF{kappa}B site mutant; CEBPM, C/EBP{beta} site mutant. **, p < 0.01 versus AdGFP

 
Hypertonic Stress Enhances Interaction of C/EBP{beta} and p65 in Cultured Renal Medullary Interstitial Cells—To further examine whether C/EBP{beta} is associated with NF{kappa}B, we examined whether physical interaction between NF{kappa}B and C/EBP{beta} could be detected by coimmunoprecipitation. Nuclear protein extract was immunoprecipitated using anti-C/EBP{beta} antibody and separated with SDS-PAGE. As shown in Fig. 6, C/EBP{beta} antibody-immunoprecipitated proteins from cultured medullary interstitial cells include NF{kappa}B p65 immunoreactive protein, consistent with a physical association of p65 with C/EBP{beta}. The interaction between p65 and C/EBP{beta} appears to be specific, because no p65 was coprecipitated by PPAR{delta} (data not shown), a transcription factor abundantly expressed in renal medullary interstitial cells (34). More importantly, this physical interaction was dramatically enhanced following hypertonic stress, despite the fact that hypertonic stress did not change C/EBP{beta} protein expression (Fig. 6). Only C/EBP{beta} but not C/EBP{alpha}, {delta}, and {gamma} were detected in cultured renal medullary interstitial cells by immunoblot. Furthermore, none of these C/EBP isoforms was induced by hypertonic stress (data not shown). Hypertonicity did not change C/EBP{beta} phosphorylation (Thr-235) (Fig. 6C), suggesting that phosphorylation of the Thr-235 residue is not critical for hypertonic activation of C/EBP{beta}.



View larger version (48K):
[in this window]
[in a new window]
 
FIG. 6.
Effect of hypertonic stress on C/EBP{beta} expression (A), interaction between C/EBP{beta} and NF{kappa}B p65 (B), and C/EBP{beta} phosphorylation (C). Renal medullary interstitial cells were cultured to confluent and exposed to hypertonic stress (550 mOsm) for indicated periods of time. A, whole cell protein extracts were separated on SDS-PAGE and blotted for C/EBP{beta}. B, nuclear protein extracts were immunoprecipitated by C/EBP{beta} antibody. C/EBP{beta} immunoprecipitated proteins were blotted for p65 as described under "Materials and Methods." C, whole cell protein extracts were blotted with anti-pC/EBP and C/EBP antibodies.

 
Hypertonic Stress Increases Binding of C/EBP{beta} and NF{kappa}B p65 to the Endogenous COX2 Promoter—To examine whether hypertonic stress can enhance the binding of C/EBP{beta} and NF{kappa}B to the endogenous COX2 promoter, a chromatin precipitation assay was conducted. An expected PCR product (417 bp) was obtained. Nucleotide sequencing confirmed that the PCR product was identical to the mouse COX2 promoter from -568 to -151. As shown in Fig. 7, hypertonic stress enhanced the binding of both NF{kappa}B p65 and C/EBP{beta} to the COX2 promoter in a time-dependent manner, with maximal binding at 1 h following hypertonic stress. This binding of p65 and C/EBP to the COX2 promoter was specific, because transcription factor Sp1 antibody failed to pull-down the COX2 gene detected using the same PCR primers (data not shown).



View larger version (53K):
[in this window]
[in a new window]
 
FIG. 7.
Effect of hypertonicity on binding of p65 (A) and C/EBP{beta} (B) to the COX2 promoter in renal medullary interstitial cells in vivo. Cultured renal medullary interstitial cells were exposed to hypertonic medium for 0, 0.5, 1, and 3 h. Cells were fixed with formaldehyde. p65- or C/EBP{beta}-bound DNA was isolated via immunoprecipitation using anti-p65 or anti-C/EBP{beta} antibodies. 100 ng of genomic DNA was used as input. The p65- or C/EBP{beta}-bound COX2 promoter DNA was detected by PCR as described under "Materials and Methods."

 
C/EBP{beta} Site Is Required for NF{kappa}B to Bind to the COX2 Promoter—To further determine whether the C/EBP{beta} site in the COX2 promoter is involved in NF{kappa}B binding to the COX2 promoter, human COX2 promoter constructs with or without C/EBP{beta} site mutation were transfected into cultured mouse interstitial cells. The binding ability of NF{kappa}B to the COX2 promoter constructs was determined by a modified ChIP assay. Because the transfected constructs were from the human COX2 promoter and the host cells were from mouse, this allowed us to specifically amplify the transfected human COX2 promoter using PCR primers specific for human COX2, to examine the effect of mutation of transcription factor binding elements on NF{kappa}B binding. An expected PCR product (241 bp) was obtained from cells transfected with the human COX2 promoter, but not cells transfected with control vector. As shown in Fig. 8, hypertonic stress increased binding of p65 to the wild-type COX2 promoter. This hypertonic stress-associated binding of p65 was not abolished in cells transfected with a NF{kappa}B binding site mutant construct, but was abolished by mutation of both the NF{kappa}B and C/EBP{beta} binding sites. These results were consistent with functional studies using the luciferase reporter assay (Fig. 2), supporting a role for the C/EBP{beta} site in promoting NF{kappa}B-mediated, hypertonicity-induced COX2 expression.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 8.
Effect of mutation of NF{kappa}B and C/EBP{beta} sites on hypertonicity-induced binding of p65 to the COX2 promoter. Cultured mouse renal medullary interstitial cells were transfected with the human COX2 327-bp promoter construct with or without mutations of NF{kappa}B and C/EBP binding sites and exposed to hypertonic medium for 1 h. Cells were fixed with formaldehyde. p65-bound DNA was isolated via immunoprecipitation using anti-p65 antibody. The p65-bound-transfected COX2 promoter DNA was detected by PCR as described under "Materials and Methods." +, genomic DNA from human HEK293 cells was used as a positive control; -, DNA from mouse renal medullary interstitial cells without transfection was used as a negative control.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
COX2 is an inducible form of cyclooxygenase, and its expression levels regulate endogenous prostaglandin synthesis. Numerous studies have indicated that COX2-derived prostaglandins play an important role in modulating organ development, cardiovascular homeostasis, and inflammatory reaction. Conversely, aberrant expression of COX2 is associated with tumorigenesis. Elucidating the mechanism by which COX2 expression is regulated will be crucial in understanding these COX2-regulated physiological and/or pathophysiological processes. COX2 expression is regulated at multiple levels, including transcriptional and post-transcriptional levels. Several putative cis-acting elements have been identified in the 5'-upstream region flanking the COX2 gene, including AP2, STAT1, STAT3, NF{kappa}B, SP1, NF-IL6 (C/EBP{beta}), and CRE sites (17, 18). Several transcription factors, including NF{kappa}B, C/EBP, CREB, AP-1, and PPAR{gamma}, have been reported to regulate COX2 expression (28, 3540). However, the signal transduction pathways leading to activation of these transcription factors are extremely diverse and depend on the cell types studied. The present studies demonstrate a novel transcriptional mechanism underlying NF{kappa}B regulation of COX2 expression. In medullary interstitial cells, activation of COX2 by the NF{kappa}B pathway relies on an intact C/EBP{beta} element, rather than the NF{kappa}B element alone. These studies demonstrate positive interaction between NF{kappa}B and C/EBP{beta} binding sites on the COX2 gene.

The presence of mechanisms facilitating survival in the hypertonic conditions is an important characteristic of the cells residing in the renal medulla. The importance of COX activity in maintaining viability of renal medullary cells has long been recognized, based on observations that COX2-inhibiting NSAIDs may cause severe renal medullary injury including papillary necrosis (41). Recent studies show that hypertonicity induces COX2 and that this plays an important role in promoting survival of renal medullary interstitial cells residing in this otherwise lethal hypertonic environment (7, 10, 34, 42). Our previous studies indicate that hypertonicity-induced COX2 expression in RMICs is mediated by NF{kappa}B. These studies showed that water deprivation not only increased renal medullary COX2 expression, but also increased renal NF{kappa}B activity (7). Blocking NF{kappa}B activation using an I{kappa}B mutant dramatically suppressed hypertonic induction of COX2 expression in cultured renal medullary interstitial cells (7). Although NF{kappa}B activation is also reported to promote COX2 expression by other stimuli (1116), the promoter-based mechanisms have not been fully characterized, partially because the presence of the putative NF{kappa}B site in the COX2 gene has led to the assumption that this site is the target of NF{kappa}B.

The present study unexpectedly found that mutation of NF{kappa}B site in the COX2 gene failed to block COX2 expression by hypertonic stress, suggesting that the NF{kappa}B element in the COX2 gene promoter is not critical. In contrast, mutation of the C/EBP{beta} binding site, which is located adjacent to the NF{kappa}B site, abolished induction of COX2 expression by hypertonicity. The involvement of C/EBP{beta} in hypertonic trans-activation of COX2 expression is also supported by studies showing increased binding of C/EBP{beta} as well as NF{kappa}B p65 to the endogenous COX2 promoter. The C/EBP pathway does not appear to be separate from the NF{kappa}B pathway, because the additive effect of C/EBP blockade and NF{kappa}B blocking was not observed. Moreover, mutation of C/EBP site not only abolished hypertonicity-induced COX2 expression, but also abolished IKK-induced COX2 expression, whereas mutation of the NF{kappa}B site of the COX2 gene failed to abolish IKK-induced COX2 expression, suggesting that the NF{kappa}B cis-acting site is not critical for IKK-induced COX2 expression. Rather the C/EBP site appears to be integral to the mechanism of NF{kappa}B activation, leading to COX2 expression.

C/EBP belongs to the basic leucine zipper C/EBP family that is comprised of six members, C/EBP{alpha}, {beta}, {gamma}, {epsilon}, {delta}, and {zeta}. C/EBP{beta} is closely related to C/EBP{alpha} and C/EBP{delta}, but is distantly related to C/EBP{gamma}, C/EBP{epsilon}, and C/EBP{zeta} (43, 44). Several truncated forms of C/EBP{beta} have been reported (45). The low molecular weight form of C/EBP{beta} (C/EBP{beta}-p20) has been shown to function as a dominant negative form of C/EBP (46). Other studies demonstrate that C/EBP family members are capable of interacting with members of NF{kappa}B (Rel) family members (2224). Overlapping or adjacent NF{kappa}B/CEBP binding sites are located within the promoter regions of IL-6, IL-8, IL-12, angiotensinogen, serum amyloid A, and COX2 genes (24, 47, 48), indicating a close relationship between NF{kappa}B and C/EBP in transcriptional regulation of these proteins (19). Adams et al. (49) reported that nuclear Rel/CEPB{beta} heteromer is important in PGG-glucan-induced Rel-A/CEBP{beta}-related transcription. A p65/CEBP{delta} complex, activated following lipopolysaccharide liver, is a potent activator of serum amyloid-A expression, promoting transcription from either NF{kappa}B or C/EBP elements within the promoter (24). The present studies now show that the C/EBP{beta} site of the COX2 promoter is more critical for activation of COX2 expression than the NF{kappa}B site, because mutation of the C/EBP site significantly blocked IKK-induced COX2 reporter activity, whereas mutation of the NF{kappa}B site failed to block IKK-associated COX2 expression. The in vivo DNA binding studies show that the C/EBP{beta} site on the COX2 promoter plays an important role in mediating p65 binding to the COX2 promoter (Fig. 8). Based on these observations, it may be hypothesized that activated Rel protein(s) may interact with C/EBP(s) in renal medullary interstitial cells. This protein complex may be recruited to COX2 promoter DNA through interaction at the C/EBP{beta} site of the COX2 gene, thereby enhancing transcription of COX2 expression. This hypothesis is further supported by coimmunoprecipitation studies demonstrating increasing physical association between Rel A (p65) and C/EBP{beta} following hypertonic stress.

Although the cis-acting site for the {beta} isoform of C/EBP has been identified in the COX2 promoter, other C/EBP family members could also bind to the C/EBP{beta} site and trans-activate COX2 gene expression (39). Overexpression of murine C/EBP{beta} and C/EBP{delta} produced a dose-dependent increase in basal and IL-1-stimulated COX2 luciferase reporter activity. C/EBP{delta} caused a greater enhancement of basal and IL-1-stimulated COX2 promoter activity than C/EBP{beta}, suggesting that C/EBP{delta} is a stronger trans-activator. Overexpression of C/EBP{beta}-p20, a dominant negative C/EBP inhibitor, which retains the C-terminal DNA binding domain and the leucine zipper region but lacks the N-terminal trans-activating domain of C/EBP{beta} (50), not only blocks C/EBP{beta}-induced COX2 expression, but can also block C/EBP{delta}-induced COX2 expression (51). Nevertheless, in the present study, C/EBP{alpha} and -{delta} do not seem to be involved, because immunoblotting failed to detect C/EBP{alpha} and -{delta} expression in cultured renal medullary interstitial cells. It has been reported that C/EBP{beta} phosphorylation (Thr-235) is associated with ERK/Ras-induced activation of C/EBP{beta} (52, 53). However, Thr-235 phosphorylation of C/EBP{beta} does not seem to be critical in mediating interaction with p65 and promoting COX2 transcription following hypertonic stress, because hypertonicity did not change C/EBP{beta} phosphorylation (Fig. 6C). The mechanism by which hypertonicity enhanced interaction of C/EBP{beta} and NF{kappa}B remains to be explored.

In summary, the present study indicates that C/EBP{beta} is required for the transcriptional activation of COX2 by NF{kappa}B following hypertonic stress, suggesting a dominant role for the C/EBP{beta} pathway in regulating induction of RMIC COX2 by hypertonicity.


    FOOTNOTES
 
* This work was supported by NIDDK, National Institutes of Health Grant DK065024 (to C.-M. H.) and a Vanderbilt Discovery grant. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

|| To whom correspondence should be addressed: S3223 MCN, Vanderbilt University Medical Center, Nashville, TN 37232. Tel.: 615-343-9867; Fax: 615-343-4704; E-mail: chuanming.hao{at}vanderbilt.edu.

1 The abbreviations used are: COX, cyclooxygenase; RMIC, renal medullary interstitial cells; IL, interleukin; ChIP, chromatin immunoprecipitation assay; C/EBP, CCAAT/enhancer-binding protein; IKK, I{kappa}B kinase; Ad, adenovirus; GFP, green fluorescent protein. Back


    ACKNOWLEDGMENTS
 
We thank Dr. Linda Sealy from Vanderbilt University for providing the C/EBP{beta}-p20 construct. We thank Dr. Matthew Breyer for support and critical reading (DK37097). We thank Reyadh Redha for assistance with RMIC preparation. We also thank Dr. Manakin B. Srichai for critical reading of the present manuscript. The IKK1 cDNA was a generous gift from F. Mercurio.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hla, T., Bishop-Bailey, D., Liu, C. H., Schaefers, H. J., and Trifan, O. C. (1999) Int. J. Biochem. Cell Biol. 31, 551-557[CrossRef][Medline] [Order article via Infotrieve]
  2. Smith, W. L., and Langenbach, R. (2001) J. Clin. Investig. 107, 1491-1495[Medline] [Order article via Infotrieve]
  3. FitzGerald, G. A., and Loll, P. (2001) J. Clin. Investig. 107, 1335-1337[Medline] [Order article via Infotrieve]
  4. Subbaramaiah, K., and Dannenberg, A. J. (2003) Trends Pharmacol. Sci. 24, 96-102[CrossRef][Medline] [Order article via Infotrieve]
  5. Breyer, M. D., Hao, C., and Qi, Z. (2001) Curr. Opin. Crit. Care 7, 393-400[CrossRef][Medline] [Order article via Infotrieve]
  6. Guan, Y., Chang, M., Cho, W., Zhang, Y., Redha, R., Davis, L., Chang, S., DuBois, R. N., Hao, C. M., and Breyer, M. (1997) Am. J. Physiol. 273, F18-F26[Medline] [Order article via Infotrieve]
  7. Hao, C. M., Yull, F., Blackwell, T., Komhoff, M., Davis, L. S., and Breyer, M. D. (2000) J. Clin. Investig. 106, 973-982[Medline] [Order article via Infotrieve]
  8. Zhang, M. Z., Hao, C. M., Breyer, M. D., Harris, R. C., and McKanna, J. A. (2002) Am. J. Physiol. Renal Physiol. 283, F509-516[Abstract/Free Full Text]
  9. Yang, T., Huang, Y., Heasley, L. E., Berl, T., Schnermann, J. B., and Briggs, J. P. (2000) J. Biol. Chem. 275, 23281-23286[Abstract/Free Full Text]
  10. Moeckel, G. W., Zhang, L., Fogo, A. B., Hao, C. M., Pozzi, A., and Breyer, M. D. (2003) J. Biol. Chem. 278, 19352-19357[Abstract/Free Full Text]
  11. Lo, C. J., Cryer, H. G., Fu, M., and Lo, F. R. (1998) J. Trauma 45, 19-23; discussion 23-14[Medline] [Order article via Infotrieve]
  12. Nakao, S., Ogata, Y., Shimizu-Sasaki, E., Yamazaki, M., Furuyama, S., and Sugiya, H. (2000) Mol. Cell Biochem. 209, 113-118[CrossRef][Medline] [Order article via Infotrieve]
  13. Paik, J. H., Ju, J. H., Lee, J. Y., Boudreau, M. D., and Hwang, D. H. (2000) J. Biol. Chem. 275, 28173-28179[Abstract/Free Full Text]
  14. Roshak, A. K., Jackson, J. R., McGough, K., Chabot-Fletcher, M., Mochan, E., and Marshall, L. A. (1996) J. Biol. Chem. 271, 31496-31501[Abstract/Free Full Text]
  15. Yan, X., Wu Xiao, C., Sun, M., Tsang, B. K., and Gibb, W. (2002) Biol. Reprod. 66, 1667-1671[Abstract/Free Full Text]
  16. Tsai, S. H., Liang, Y. C., Chen, L., Ho, F. M., Hsieh, M. S., and Lin, J. K. (2002) J. Cell. Biochem. 84, 750-758[CrossRef][Medline] [Order article via Infotrieve]
  17. Tazawa, R., Xu, X. M., Wu, K. K., and Wang, L. H. (1994) Biochem. Biophys. Res. Commun. 203, 190-199[CrossRef][Medline] [Order article via Infotrieve]
  18. Okada, Y., Voznesensky, O., Herschman, H., Harrison, J., and Pilbeam, C. (2000) J. Cell. Biochem. 78, 197-209[CrossRef][Medline] [Order article via Infotrieve]
  19. Perkins, N. D. (1997) Int. J. Biochem. Cell Biol. 29, 1433-1448[CrossRef][Medline] [Order article via Infotrieve]
  20. Kleemann, R., Gervois, P. P., Verschuren, L., Staels, B., Princen, H. M., and Kooistra, T. (2003) Blood 101, 545-551[Abstract/Free Full Text]
  21. Ikawa, H., Kameda, H., Kamitani, H., Baek, S. J., Nixon, J. B., Hsi, L. C., and Eling, T. E. (2001) Exp. Cell Res. 267, 73-80[CrossRef][Medline] [Order article via Infotrieve]
  22. Stein, B., Cogswell, P. C., and Baldwin, A. S., Jr. (1993) Mol. Cell. Biol. 13, 3964-3974[Abstract/Free Full Text]
  23. Diehl, J. A., and Hannink, M. (1994) Mol. Cell. Biol. 14, 6635-6646[Abstract/Free Full Text]
  24. Ray, A., Hannink, M., and Ray, B. K. (1995) J. Biol. Chem. 270, 7365-7374[Abstract/Free Full Text]
  25. Muirhead, E. E., Germain, G. S., Leach, B. E., Brooks, B., and Stephenson, P. (1973) Prostaglandins 3, 581-594[Medline] [Order article via Infotrieve]
  26. Mercurio, F., Zhu, H., Murray, B. W., Shevchenko, A., Bennett, B. L., Li, J., Young, D. B., Barbosa, M., Mann, M., Manning, A., and Rao, A. (1997) Science 278, 860-866[Abstract/Free Full Text]
  27. Hao, C. M., Komhoff, M., Guan, Y., Redha, R., and Breyer, M. D. (1999) Am. J. Physiol. 277, F352-F359[Medline] [Order article via Infotrieve]
  28. Inoue, H., Yokoyama, C., Hara, S., Tone, Y., and Tanabe, T. (1995) J. Biol. Chem. 270, 24965-24971[Abstract/Free Full Text]
  29. Inoue, H., and Tanabe, T. (1998) Biochem. Biophys. Res. Commun. 244, 143-148[CrossRef][Medline] [Order article via Infotrieve]
  30. Schmedtje, J. F., Jr., Ji, Y. S., Liu, W. L., DuBois, R. N., and Runge, M. S. (1997) J. Biol. Chem. 272, 601-608[Abstract/Free Full Text]
  31. Appleby, S. B., Ristimaki, A., Neilson, K., Narko, K., and Hla, T. (1994) Biochem. J. 302, 723-727[Medline] [Order article via Infotrieve]
  32. Duong, D. T., Waltner-Law, M. E., Sears, R., Sealy, L., and Granner, D. K. (2002) J. Biol. Chem. 277, 32234-32242[Abstract/Free Full Text]
  33. Jover, R., Bort, R., Gomez-Lechon, M. J., and Castell, J. V. (2002) FASEB J. 16, 1799-1801[Abstract/Free Full Text]
  34. Hao, C. M., Redha, R., Morrow, J., and Breyer, M. D. (2002) J. Biol. Chem. 277, 21341-21345[Abstract/Free Full Text]
  35. Wadleigh, D. J., Reddy, S. T., Kopp, E., Ghosh, S., and Herschman, H. R. (2000) J. Biol. Chem. 275, 6259-6266[Abstract/Free Full Text]
  36. Xie, W., and Herschman, H. R. (1995) J. Biol. Chem. 270, 27622-27628[Abstract/Free Full Text]
  37. Thomas, B., Thirion, S., Humbert, L., Tan, L., Goldring, M. B., Bereziat, G., and Berenbaum, F. (2002) Biochem. J. 362, 367-373[CrossRef][Medline] [Order article via Infotrieve]
  38. Thomas, B., Berenbaum, F., Humbert, L., Bian, H., Bereziat, G., Crofford, L., and Olivier, J. L. (2000) Eur. J. Biochem. 267, 6798-6809[Medline] [Order article via Infotrieve]
  39. Zhu, Y., Saunders, M. A., Yeh, H., Deng, W. G., and Wu, K. K. (2002) J. Biol. Chem. 277, 6923-6928[Abstract/Free Full Text]
  40. Subbaramaiah, K., Lin, D. T., Hart, J. C., and Dannenberg, A. J. (2001) J. Biol. Chem. 276, 12440-12448[Abstract/Free Full Text]
  41. Segasothy, M., Samad, S. A., Zulfigar, A., and Bennett, W. M. (1994) Am. J. Kidney Dis. 24, 17-24[Medline] [Order article via Infotrieve]
  42. Rao, R., Hao, C. M., and Breyer, M. D. (2004) J. Biol. Chem. 279, 3949-3955[Abstract/Free Full Text]
  43. Wedel, A., and Ziegler-Heitbrock, H. W. (1995) Immunobiology 193, 171-185[Medline] [Order article via Infotrieve]
  44. Akira, S., and Kishimoto, T. (1997) Adv. Immunol. 65, 1-46[Medline] [Order article via Infotrieve]
  45. Ossipow, V., Descombes, P., and Schibler, U. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 8219-8223[Abstract/Free Full Text]
  46. Liao, J., Piwien-Pilipuk, G., Ross, S. E., Hodge, C. L., Sealy, L., MacDougald, O. A., and Schwartz, J. (1999) J. Biol. Chem. 274, 31597-31604[Abstract/Free Full Text]
  47. Ruocco, M. R., Chen, X., Ambrosino, C., Dragonetti, E., Liu, W., Mallardo, M., De Falco, G., Palmieri, C., Franzoso, G., Quinto, I., Venuta, S., and Scala, G. (1996) J. Biol. Chem. 271, 22479-22486[Abstract/Free Full Text]
  48. Yoshimoto, T., Kojima, K., Funakoshi, T., Endo, Y., Fujita, T., and Nariuchi, H. (1996) J. Immunol. 156, 1082-1088[Abstract]
  49. Adams, D. S., Nathans, R., Pero, S. C., Sen, A., and Wakshull, E. (2000) J. Cell. Biochem. 77, 221-233[CrossRef][Medline] [Order article via Infotrieve]
  50. Descombes, P., and Schibler, U. (1991) Cell 67, 569-579[CrossRef][Medline] [Order article via Infotrieve]
  51. Harrison, J. R., Kelly, P. L., and Pilbeam, C. C. (2000) J. Bone Miner Res. 15, 1138-1146[CrossRef][Medline] [Order article via Infotrieve]
  52. Hanlon, M., Sturgill, T. W., and Sealy, L. (2001) J. Biol. Chem. 276, 38449-38456[Abstract/Free Full Text]
  53. Shuman, J. D., Sebastian, T., Kaldis, P., Copeland, T. D., Zhu, S., Smart, R. C., and Johnson, P. F. (2004) Mol. Cell. Biol. 24, 7380-7391[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
D. Schunke, P. Span, H. Ronneburg, A. Dittmer, M. Vetter, H.-J. Holzhausen, E. Kantelhardt, S. Krenkel, V. Muller, F. C.G.J. Sweep, et al.
Cyclooxygenase-2 Is a Target Gene of Rho GDP Dissociation Inhibitor {beta} in Breast Cancer Cells
Cancer Res., November 15, 2007; 67(22): 10694 - 10702.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
S. W. Chung, H. Y. Chung, A. Toriba, T. Kameda, N. Tang, R. Kizu, and K. Hayakawa
An Environmental Quinoid Polycyclic Aromatic Hydrocarbon, Acenaphthenequinone, Modulates Cyclooxygenase-2 Expression through Reactive Oxygen Species Generation and Nuclear Factor Kappa B Activation in A549 Cells
Toxicol. Sci., February 1, 2007; 95(2): 348 - 355.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Tammali, K. V. Ramana, S. S. Singhal, S. Awasthi, and S. K. Srivastava
Aldose Reductase Regulates Growth Factor-Induced Cyclooxygenase-2 Expression and Prostaglandin E2 Production in Human Colon Cancer Cells
Cancer Res., October 1, 2006; 66(19): 9705 - 9713.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Ding, J. Li, C. Xue, K. Wu, W. Ouyang, D. Zhang, Y. Yan, and C. Huang
Cyclooxygenase-2 Induction by Arsenite Is through a Nuclear Factor of Activated T-cell-dependent Pathway and Plays an Antiapoptotic Role in Beas-2B Cells
J. Biol. Chem., August 25, 2006; 281(34): 24405 - 24413.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Syeda, J. Grosjean, R. A. Houliston, R. J. Keogh, T. D. Carter, E. Paleolog, and C. P. D. Wheeler-Jones
Cyclooxygenase-2 Induction and Prostacyclin Release by Protease-activated Receptors in Endothelial Cells Require Cooperation between Mitogen-activated Protein Kinase and NF-{kappa}B Pathways
J. Biol. Chem., April 28, 2006; 281(17): 11792 - 11804.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/16/16354    most recent
M411134200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, J.
Right arrow Articles by Hao, C.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, J.
Right arrow Articles by Hao, C.-M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement