![]()
|
|
||||||||
J. Biol. Chem., Vol. 280, Issue 16, 16354-16359, April 22, 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
and Its Binding Element Are Required for NF
B-induced COX2 Expression Following Hypertonic Stress*





||
From the
Division of Nephrology, Department of Medicine, Vanderbilt University, Nashville, Tennessee 37232, the ¶Department of Pharmacology, National Cardiovascular Center Research Institute, 5-7-1 Fujishiro-dai, Suita, Osaka 565-8565, Japan, and the
Division of Nephrology, Huashan Hospital, Fudan University, Shanghai 200040, China
Received for publication, September 28, 2004 , and in revised form, February 7, 2005.
| ABSTRACT |
|---|
|
|
|---|
B plays a critical role mediating COX2 expression in renal medullary interstitial cells (RMICs). The trans-activating ability of NF
B can be modified by another nuclear factor C/EBP
that can physically bind to NF
B and regulate its activity. Because the COX2 promoter also contains a C/EBP
site adjacent to the NF
B site, the present study examined whether these two transcription factors cooperate to induce COX2 expression following hypertonic stress. Hypertonicity markedly induced COX2 expression in cultured medullary interstitial cells by immunoblot analysis. The tonicity-induced COX2 expression was suppressed by mutant I
B (I
Bm) that blocks NF
B activation, demonstrating that tonicity-induced COX2 expression depends on NF
B activation. However, mutation of the NF
B site in the COX2 promoter failed to abolish tonicity-induced COX2 reporter activity. I
B kinase-1 (IKK1) significantly induced COX2-luciferase activity by 2.3-fold (n = 10, p < 0.01); mutation of the NF
B site also failed to abolish IKK1-stimulated COX2 reporter activity (86 ± 3.1% of wild type, p > 0.05, n = 4). Interestingly, mutation of the C/EBP
site of the COX2 gene significantly reduced both IKK1 and hypertonicity-induced COX2 reporter activity (p < 0.01). To further examine the potential role of C/EBP
in tonicity-induced COX2 expression, a dominant negative C/EBP
-p20 was transduced into RMICs. C/EBP
-p20 markedly suppressed hypertonic (550 mOsm) induction of COX2 (immunoblot) to a similar extent as I
Bm. No additional suppression was observed when both NF
B and C/EBP
were simultaneously blocked by I
Bm and C/EBP
-p20. Interestingly, IKK-induced COX2 expression was not only blocked by I
Bm, but also completely abolished by C/EBP
-p20. Further studies demonstrated physical association of C/EBP
to NF
B p65 by coimmunoprecipitation. Importantly, this interaction between C/EBP
and NF
B was greatly enhanced following hypertonic stress. These studies indicate C/EBP
is required for the transcriptional activation of COX2 by NF
B, suggesting a dominant role for the C/EBP
pathway in regulating induction of RMIC COX2 by hypertonicity. | INTRODUCTION |
|---|
|
|
|---|
, PGD2, and TXA2) through their distinct synthases. Two isoforms of COX have been identified, designated COX1 and COX2 (1, 2). COX1 is constitutively expressed in most tissues detected and is thought to carry out housekeeping functions, such as cytoprotection of the gastric mucosa, regulation of renal blood flow, and control of platelet aggregation. In contrast, COX2 mRNA and protein are normally undetectable in most tissues, but can be rapidly induced by a variety of stimuli, including various cytokines, growth factors, oncogenes, endotoxins, and chemicals (2). Accumulating evidence suggests that COX2-mediated prostaglandins play important roles in regulating cellular homeostasis, inflammation, and tumorigenesis (25).
The kidney is one of the few organs where constitutive COX2 expression is detected. Renal medullary interstitial cells (RMICs) are a major site of COX2 expression in the kidney (6 8). Recent studies indicate that the hypertonic environment in renal medulla is an important factor contributing to COX2 expression (7, 9). Expression of COX2 plays an important role promoting renal medullary interstitial cells to survive otherwise lethal changes in environmental tonicity (7, 10), which is critical to the regulation of urinary concentrating ability. The mechanism by which renal medullary interstitial cell COX2 expression is regulated following hypertonic stress has only been partially characterized (7, 9). Studies suggest that in RMICs, hypertonic stress activates nuclear factor NF
B, and this is critical for induction of COX2 expression in renal medullary interstitial cells (7). NF
B has also been reported to be an important signaling pathway promoting COX2 expression by such stimuli as hypoxia and tumor necrosis factor, etc. (1116). NF
B binding sites have been identified in the promoter region of the COX2 gene (17, 18), making it likely that binding of the NF
B protein to the NF
B cis-acting element is responsible for increased COX2 expression. However, recent studies indicate that the mechanism underlying NF
B-associated COX2 expression is more complex. Interactions between NF
B and other nuclear factors such as C/EBP, SP1, and PPAR have been reported (1921). Cross-talk among these transcriptional factors can be critical for their transcriptional activity (2224). The present studies examined the mechanism by which NF
B activates COX2 gene expression in cultured renal medullary interstitial cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
ImmunoblottingImmunoblots were performed on whole cell lysates from cultured RMICs. The protein concentration was determined using the bicinchoninic acid protein assay (Sigma). Thirty micrograms of protein extract were loaded in each lane of a 10% SDS-PAGE minigel and run at 120 V. Protein was transferred to a nitrocellulose membrane at 22 V overnight at 4 °C. The membrane was washed three times with TBST (50 mM Tris, pH 7.5, 150 mM NaCl, 0.05% Tween 20) and then incubated in blocking buffer (150 mM NaCl, 50 mM Tris, 0.05% Tween 20, and 5% Carnation nonfat dry milk, pH 7.5) for 1 h at room temperature. The membrane was then incubated with an antihuman COX2 antibody (1:1,000, 160106, Cayman), anti-C/EBP
(1:400 sc-150, Santa Cruz Biotechnology), or anti-p-C/EBP
(1:500, 3084, Cell Signaling Technology) antibody in blocking buffer overnight at 4 °C. Following washing (3x), the membrane was incubated with a horseradish peroxidase-conjugated secondary antibody (1:20,000, Jackson Immuno-Research Laboratories) for 1 h at room temperature, followed by three 15-min washes. Antibody labeling was visualized by addition of the chemiluminescence reagent (Renaissance, PerkinElmer Life Sciences), and the membrane was exposed to Kodak XAR-5 film.
Nuclear Protein Extraction and ImmunoprecipitationCultured cells were washed with phosphate-buffered saline and lysed on ice for 15 min in hypotonic lysis buffer (10 mM HEPES, 5 mM KCl, 1.5 mM MgCl2, 1 mM NaF, 1 mM Na3VO3, and 0.08% Nonidet P-40) containing proteinase inhibitor mixture (1 tablet/10 ml, Complete Mini, Roche Applied Science). The cell lysate was centrifuged at 4 °C at 3,000 rpm for 5 min. The supernatant (cytoplasmic proteins) was stored at -80 °C. The pellet was washed with hypotonic lysis buffer two times and centrifuged at 13,000 rpm for 5 s. The supernatant was removed, and the pellet was resuspended in 50 µl of Dignin solution (20 mM HEPES, 1.5 mM MgCl2, 0.2 mM EDTA, 420 mM NaCl, 50 mM
-glycerophosphate, 1 mM NaF, 1 mM Na3VO4,1mM dithiothreitol, 25% glycerol, pH 7.9) for 30 min and centrifuged for 10 min at 13,000 rpm. The supernatant nuclear protein was used for immunoprecipitation. 50 µg of nuclear protein extract was added to 500 µl of IP buffer (Tris 20 mM, pH 7.5, NaCl 150 mM,EDTA1mM, EGTA, 1 mM, Triton-100 1%). The nuclear protein was precleared by adding 0.2 µg of rabbit IgG and 20 µl of 25% protein A-agarose, incubated at 4 °C for 30 min, and centrifuged at 3,000 rpm. The supernatant was collected, and 0.4 µg of anti-C/EBP
antibody was added and incubated at 4 °C for 2 h. 20 µl of 25% protein A-agarose beads were added and incubated at 4 °C overnight with mixing. The beads were washed three times with IP buffer and were resuspended in 30 µl of 2x sample buffer. The samples were boiled for 2 min, and 20 µl of precipitated proteins were added to each lane of an SDS-PAGE gel.
Ad-I
Bmu, Ad-IKK
, Ad-CEBP-p20, and Ad-GFPAdenoviral vectors, encoding a dominant negative I
B and a constitutively active I
B kinase 1 (IKK1) or a dominant negative C/EBP
-p20, were used to modulate NF
B and C/EBP activity, respectively, in cultured renal medullary interstitial cells. The trans-dominant inhibitor of NF
B, I
Bmut (avian I
B
S36/40A) was provided by Dr. Timothy Blackwell (7). Ad-C/EBP
-p20 was provided by Dr. Linda Sealy. Constitutively active IKK1 (IKK1) cDNA was kindly provided by Dr. Frank Mercurio (Signal Pharmaceutical, San Diego, CA) and subcloned into pACCMV for IKK1 adenovirus construction (7). The IKK1 was made constitutively active by Ser-Glu mutations in Ser176 and Ser180 residues (26). An adenovirus expressing green fluorescent protein was constructed as described (27) for a control adenovirus. For infection of RMICs, 200 µl of virus (multiplicity of infection, 100) was added to each culture dish, and GFP adenovirus was used to adjust for equal loading. After a 2-h incubation, the virus was removed, and fresh Dulbecco's modified Eagle's medium with 10% fetal bovine serum was added. Experiments were carried out 4872 h after infection.
COX2 Reporter StudiesAn 891-bp human COX2 luciferase reporter construct was generously provided by Dr. Lee-Ho Wang (17). A 327-bp human COX2 luciferase reporter construct, and its NF
B and C/EBP
site mutants were provided by Dr. Hiroyasu Inoue (28). The NF
B and C/EBP
site mutants have been shown to lack the ability to bind to NF
B and C/EBP, respectively (28, 29). Two NF
B sites in the 891-bp COX2 reporter construct were mutated via site-directed mutagenesis using primers: CGGCGGCGGGAGAGCTCATTCCCTGCGCCC (5' sense), CAGGAGAGTGGCCACTACCCCCTCTGCT (3' sense) (30) (QuikChange II Site-Directed Mutagenesis kits, Stratagene, La Jolla, CA). The firefly luciferase COX2 reporter plasmid and a plasmid containing Renilla luciferase driven by the TK promoter (Promega) were transfected into cells using SuperFect (Qiagen). Cells were lysed 48 h after transfection for luciferase activity measurement using the Dual Luciferase assay system (Promega). COX2 luciferase activity was adjusted by Renilla luciferase activity.
Chromatin Immunoprecipitation (ChIP) AssayThe ability of NF
B and C/EBP
to bind to endogenous COX2 promoter was examined using the ChIP assay according to the manufacturer's protocol (Upstate Technologies, Lake Placid, NY). Briefly, cultured mouse renal medullary interstitial cells (7) were exposed to isotonic or hypertonic media for indicated periods of time. Cells were then cross-linked with 1% formaldehyde for 5 min. After washing with phosphate-buffered saline, cells were lysed with SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8.1) containing proteinase inhibitors (Complete Mini, EDTA-free). The chromatin was sheared by sonication (strength, 20%; pulse, 12 s x three times). The cross-linked chromatin was quantified to determine the initial amount of DNA present in the different samples. 100 ng of DNA were used as input. The remaining chromatin fractions were precleared with salmon sperm DNA/protein A-agarose for 1 h and immunoprecipitated with antibodies (NF
B-p65 or CEBP
, 200 µg/ml, Santa Cruz Biotechnology) overnight at 4 °C. The COX2 promoter DNA, bound to p65 and C/EBP
, was analyzed by PCR using primers: sense, CGGAGGGTAGTTCCATGAAA; antisense, CAGGCTTTTACCCACGCAAA. PCR was performed at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s, for 35 cycles.
To further examine whether the C/EBP
site in the COX2 promoter plays an important role in mediating NF
B binding to the COX2 gene, wild type or mutants of COX2 promoter constructs containing 327-bp human COX2 promoter sequences, were transfected into mouse interstitial cells using SuperFect (Qiagen). 24 h after transfection, cells were exposed to hypertonic stress for 1 h. The cells were cross-linked and precipitated as described in ChIP assay. The transfected human COX2 promoter bound to NF
B was detected by PCR using primers specific for the human COX2 gene. PCR primers: sense, CCCCTCTGCTCCCAAATT; antisense, CGCTCACTGCAAGTCGTAT. The PCR was performed at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s, for 35 cycles. Genomic DNA from a human cell line HEK293 cells was used as a positive control. Genomic DNA extracted from mouse renal medullary interstitial cells without transfection was used as a negative control.
| RESULTS |
|---|
|
|
|---|
B site of the COX2 Promoter Fails to Suppress Induction of the COX2 Reporter by Hypertonic StressOur previous studies demonstrate that hypertonicity activates NF
B, and blocking NF
B by a mutant I
B dramatically suppresses hypertonic induction of COX2, suggesting that NF
B mediates hypertonicity-induced COX2 expression (7). Two NF
B binding sites have been identified in the human COX2 promoter (-446 to -437 and -223 to -214) (31). To examine whether hypertonicity-induced COX2 expression is mediated via binding of NF
B protein to the NF
B element of the COX2 gene, a COX2 luciferase transcription reporter system with mutant NF
B element was used. Hypertonic stress in RMICs significantly increased COX2 reporter activity in both 891-bp COX2 luciferase reporter construct (Fig. 1)- and 327-bp COX2 reporter construct (Fig. 2)-transfected cells. Surprisingly, mutation of NF
B sites in the COX2 promoter luciferase reporters failed to abolish hypertonic stress-induced COX2 reporter activity in either COX2 reporter constructs. In contrast, mutation of the C/EBP
binding site completely blocked hypertonic activation of COX2 reporter activity (Fig. 2).
|
|
Suppresses Hypertonic Induction of COX2 Protein ExpressionTo further examine the involvement of C/EBP
in COX2 expression following hypertonic stress, a dominant negative isoform of C/EBP
, C/EBP
-p20 (p20) was used to block C/EBP
activity (32, 33). As shown in Fig. 3, induction of COX2 expression by hypertonic stress was suppressed by I
B mutant that blocked NF
B activation, consistent with our previous findings (7). These studies now find that a dominant negative C/EBP
-p20 also dramatically reduced the ability of hypertonicity to induce COX2 expression. More importantly, combined treatment with C/EBP
-p20 and I
Bm did not further reduce COX2 expression, suggesting these two factors participate in the same signaling pathway.
|
-p20 Suppresses IKK-induced COX2 Protein Expression in RMICsTo further test the hypothesis that NF
B and C/EBP
participate in the same signaling pathway, we examined the effect of inhibiting C/EBP
in NF
B-induced COX2 expression. NF
B was activated by adenoviral transduction with I
B kinase 1 (IKK1). As expected, IKK1, which phosphorylates I
B and activates NF
B, dramatically induced COX2 expression. However, IKK1-induced COX2 expression was blocked not only by an inactive I
Bm, but also by blocking C/EBP
with C/EBP
-p20 adenovirus (Fig. 4).
|
Binding Site Suppresses IKK-activated COX2 Reporter ActivityTo further investigate whether C/EBP
is involved in the transcription mechanisms underlying NF
B-induced COX2 expression in cultured RMICs, the effect of IKK on the COX2 luciferase reporter system was examined. IKK1 increased COX2 reporter activity by 3-fold (p < 0.01, Fig. 5). However unexpectedly, mutation of the NF
B site failed to completely abolish IKK1-induced COX2 reporter activity. In contrast, mutation of C/EBP
site completely abolished IKK-induced COX2 reporter activity.
|
and p65 in Cultured Renal Medullary Interstitial CellsTo further examine whether C/EBP
is associated with NF
B, we examined whether physical interaction between NF
B and C/EBP
could be detected by coimmunoprecipitation. Nuclear protein extract was immunoprecipitated using anti-C/EBP
antibody and separated with SDS-PAGE. As shown in Fig. 6, C/EBP
antibody-immunoprecipitated proteins from cultured medullary interstitial cells include NF
B p65 immunoreactive protein, consistent with a physical association of p65 with C/EBP
. The interaction between p65 and C/EBP
appears to be specific, because no p65 was coprecipitated by PPAR
(data not shown), a transcription factor abundantly expressed in renal medullary interstitial cells (34). More importantly, this physical interaction was dramatically enhanced following hypertonic stress, despite the fact that hypertonic stress did not change C/EBP
protein expression (Fig. 6). Only C/EBP
but not C/EBP
,
, and
were detected in cultured renal medullary interstitial cells by immunoblot. Furthermore, none of these C/EBP isoforms was induced by hypertonic stress (data not shown). Hypertonicity did not change C/EBP
phosphorylation (Thr-235) (Fig. 6C), suggesting that phosphorylation of the Thr-235 residue is not critical for hypertonic activation of C/EBP
.
|
and NF
B p65 to the Endogenous COX2 PromoterTo examine whether hypertonic stress can enhance the binding of C/EBP
and NF
B to the endogenous COX2 promoter, a chromatin precipitation assay was conducted. An expected PCR product (417 bp) was obtained. Nucleotide sequencing confirmed that the PCR product was identical to the mouse COX2 promoter from -568 to -151. As shown in Fig. 7, hypertonic stress enhanced the binding of both NF
B p65 and C/EBP
to the COX2 promoter in a time-dependent manner, with maximal binding at 1 h following hypertonic stress. This binding of p65 and C/EBP to the COX2 promoter was specific, because transcription factor Sp1 antibody failed to pull-down the COX2 gene detected using the same PCR primers (data not shown).
|
Site Is Required for NF
B to Bind to the COX2 PromoterTo further determine whether the C/EBP
site in the COX2 promoter is involved in NF
B binding to the COX2 promoter, human COX2 promoter constructs with or without C/EBP
site mutation were transfected into cultured mouse interstitial cells. The binding ability of NF
B to the COX2 promoter constructs was determined by a modified ChIP assay. Because the transfected constructs were from the human COX2 promoter and the host cells were from mouse, this allowed us to specifically amplify the transfected human COX2 promoter using PCR primers specific for human COX2, to examine the effect of mutation of transcription factor binding elements on NF
B binding. An expected PCR product (241 bp) was obtained from cells transfected with the human COX2 promoter, but not cells transfected with control vector. As shown in Fig. 8, hypertonic stress increased binding of p65 to the wild-type COX2 promoter. This hypertonic stress-associated binding of p65 was not abolished in cells transfected with a NF
B binding site mutant construct, but was abolished by mutation of both the NF
B and C/EBP
binding sites. These results were consistent with functional studies using the luciferase reporter assay (Fig. 2), supporting a role for the C/EBP
site in promoting NF
B-mediated, hypertonicity-induced COX2 expression.
|
| DISCUSSION |
|---|
|
|
|---|
B, SP1, NF-IL6 (C/EBP
), and CRE sites (17, 18). Several transcription factors, including NF
B, C/EBP, CREB, AP-1, and PPAR
, have been reported to regulate COX2 expression (28, 3540). However, the signal transduction pathways leading to activation of these transcription factors are extremely diverse and depend on the cell types studied. The present studies demonstrate a novel transcriptional mechanism underlying NF
B regulation of COX2 expression. In medullary interstitial cells, activation of COX2 by the NF
B pathway relies on an intact C/EBP
element, rather than the NF
B element alone. These studies demonstrate positive interaction between NF
B and C/EBP
binding sites on the COX2 gene.
The presence of mechanisms facilitating survival in the hypertonic conditions is an important characteristic of the cells residing in the renal medulla. The importance of COX activity in maintaining viability of renal medullary cells has long been recognized, based on observations that COX2-inhibiting NSAIDs may cause severe renal medullary injury including papillary necrosis (41). Recent studies show that hypertonicity induces COX2 and that this plays an important role in promoting survival of renal medullary interstitial cells residing in this otherwise lethal hypertonic environment (7, 10, 34, 42). Our previous studies indicate that hypertonicity-induced COX2 expression in RMICs is mediated by NF
B. These studies showed that water deprivation not only increased renal medullary COX2 expression, but also increased renal NF
B activity (7). Blocking NF
B activation using an I
B mutant dramatically suppressed hypertonic induction of COX2 expression in cultured renal medullary interstitial cells (7). Although NF
B activation is also reported to promote COX2 expression by other stimuli (1116), the promoter-based mechanisms have not been fully characterized, partially because the presence of the putative NF
B site in the COX2 gene has led to the assumption that this site is the target of NF
B.
The present study unexpectedly found that mutation of NF
B site in the COX2 gene failed to block COX2 expression by hypertonic stress, suggesting that the NF
B element in the COX2 gene promoter is not critical. In contrast, mutation of the C/EBP
binding site, which is located adjacent to the NF
B site, abolished induction of COX2 expression by hypertonicity. The involvement of C/EBP
in hypertonic trans-activation of COX2 expression is also supported by studies showing increased binding of C/EBP
as well as NF
B p65 to the endogenous COX2 promoter. The C/EBP pathway does not appear to be separate from the NF
B pathway, because the additive effect of C/EBP blockade and NF
B blocking was not observed. Moreover, mutation of C/EBP site not only abolished hypertonicity-induced COX2 expression, but also abolished IKK-induced COX2 expression, whereas mutation of the NF
B site of the COX2 gene failed to abolish IKK-induced COX2 expression, suggesting that the NF
B cis-acting site is not critical for IKK-induced COX2 expression. Rather the C/EBP site appears to be integral to the mechanism of NF
B activation, leading to COX2 expression.
C/EBP belongs to the basic leucine zipper C/EBP family that is comprised of six members, C/EBP
,
,
,
,
, and
. C/EBP
is closely related to C/EBP
and C/EBP
, but is distantly related to C/EBP
, C/EBP
, and C/EBP
(43, 44). Several truncated forms of C/EBP
have been reported (45). The low molecular weight form of C/EBP
(C/EBP
-p20) has been shown to function as a dominant negative form of C/EBP (46). Other studies demonstrate that C/EBP family members are capable of interacting with members of NF
B (Rel) family members (2224). Overlapping or adjacent NF
B/CEBP binding sites are located within the promoter regions of IL-6, IL-8, IL-12, angiotensinogen, serum amyloid A, and COX2 genes (24, 47, 48), indicating a close relationship between NF
B and C/EBP in transcriptional regulation of these proteins (19). Adams et al. (49) reported that nuclear Rel/CEPB
heteromer is important in PGG-glucan-induced Rel-A/CEBP
-related transcription. A p65/CEBP
complex, activated following lipopolysaccharide liver, is a potent activator of serum amyloid-A expression, promoting transcription from either NF
B or C/EBP elements within the promoter (24). The present studies now show that the C/EBP
site of the COX2 promoter is more critical for activation of COX2 expression than the NF
B site, because mutation of the C/EBP site significantly blocked IKK-induced COX2 reporter activity, whereas mutation of the NF
B site failed to block IKK-associated COX2 expression. The in vivo DNA binding studies show that the C/EBP
site on the COX2 promoter plays an important role in mediating p65 binding to the COX2 promoter (Fig. 8). Based on these observations, it may be hypothesized that activated Rel protein(s) may interact with C/EBP(s) in renal medullary interstitial cells. This protein complex may be recruited to COX2 promoter DNA through interaction at the C/EBP
site of the COX2 gene, thereby enhancing transcription of COX2 expression. This hypothesis is further supported by coimmunoprecipitation studies demonstrating increasing physical association between Rel A (p65) and C/EBP
following hypertonic stress.
Although the cis-acting site for the
isoform of C/EBP has been identified in the COX2 promoter, other C/EBP family members could also bind to the C/EBP
site and trans-activate COX2 gene expression (39). Overexpression of murine C/EBP
and C/EBP
produced a dose-dependent increase in basal and IL-1-stimulated COX2 luciferase reporter activity. C/EBP
caused a greater enhancement of basal and IL-1-stimulated COX2 promoter activity than C/EBP
, suggesting that C/EBP
is a stronger trans-activator. Overexpression of C/EBP
-p20, a dominant negative C/EBP inhibitor, which retains the C-terminal DNA binding domain and the leucine zipper region but lacks the N-terminal trans-activating domain of C/EBP
(50), not only blocks C/EBP
-induced COX2 expression, but can also block C/EBP
-induced COX2 expression (51). Nevertheless, in the present study, C/EBP
and -
do not seem to be involved, because immunoblotting failed to detect C/EBP
and -
expression in cultured renal medullary interstitial cells. It has been reported that C/EBP
phosphorylation (Thr-235) is associated with ERK/Ras-induced activation of C/EBP
(52, 53). However, Thr-235 phosphorylation of C/EBP
does not seem to be critical in mediating interaction with p65 and promoting COX2 transcription following hypertonic stress, because hypertonicity did not change C/EBP
phosphorylation (Fig. 6C). The mechanism by which hypertonicity enhanced interaction of C/EBP
and NF
B remains to be explored.
In summary, the present study indicates that C/EBP
is required for the transcriptional activation of COX2 by NF
B following hypertonic stress, suggesting a dominant role for the C/EBP
pathway in regulating induction of RMIC COX2 by hypertonicity.
| FOOTNOTES |
|---|
|| To whom correspondence should be addressed: S3223 MCN, Vanderbilt University Medical Center, Nashville, TN 37232. Tel.: 615-343-9867; Fax: 615-343-4704; E-mail: chuanming.hao{at}vanderbilt.edu.
1 The abbreviations used are: COX, cyclooxygenase; RMIC, renal medullary interstitial cells; IL, interleukin; ChIP, chromatin immunoprecipitation assay; C/EBP, CCAAT/enhancer-binding protein; IKK, I
B kinase; Ad, adenovirus; GFP, green fluorescent protein. ![]()
| ACKNOWLEDGMENTS |
|---|
-p20 construct. We thank Dr. Matthew Breyer for support and critical reading (DK37097). We thank Reyadh Redha for assistance with RMIC preparation. We also thank Dr. Manakin B. Srichai for critical reading of the present manuscript. The IKK1 cDNA was a generous gift from F. Mercurio. | REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
D. Schunke, P. Span, H. Ronneburg, A. Dittmer, M. Vetter, H.-J. Holzhausen, E. Kantelhardt, S. Krenkel, V. Muller, F. C.G.J. Sweep, et al. Cyclooxygenase-2 Is a Target Gene of Rho GDP Dissociation Inhibitor {beta} in Breast Cancer Cells Cancer Res., November 15, 2007; 67(22): 10694 - 10702. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. W. Chung, H. Y. Chung, A. Toriba, T. Kameda, N. Tang, R. Kizu, and K. Hayakawa An Environmental Quinoid Polycyclic Aromatic Hydrocarbon, Acenaphthenequinone, Modulates Cyclooxygenase-2 Expression through Reactive Oxygen Species Generation and Nuclear Factor Kappa B Activation in A549 Cells Toxicol. Sci., February 1, 2007; 95(2): 348 - 355. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Tammali, K. V. Ramana, S. S. Singhal, S. Awasthi, and S. K. Srivastava Aldose Reductase Regulates Growth Factor-Induced Cyclooxygenase-2 Expression and Prostaglandin E2 Production in Human Colon Cancer Cells Cancer Res., October 1, 2006; 66(19): 9705 - 9713. [Abstract] [Full Text] [PDF] |