HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 280, Issue 16, 16354-16359, April 22, 2005

This Article Abstract Full Text (PDF) All Versions of this Article: 280/16/16354    most recent M411134200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Chen, J. Articles by Hao, C.-M. Search for Related Content PubMed PubMed Citation Articles by Chen, J. Articles by Hao, C.-M. Social Bookmarking                      What's this?

C/EBP and Its Binding Element Are Required for NFB-induced COX2 Expression Following Hypertonic Stress^*

Jing Chen, Min Zhao, Reena Rao, Hiroyasu Inoue¶, and Chuan-Ming Hao||

From the Division of Nephrology, Department of Medicine, Vanderbilt University, Nashville, Tennessee 37232, the ^¶Department of Pharmacology, National Cardiovascular Center Research Institute, 5-7-1 Fujishiro-dai, Suita, Osaka 565-8565, Japan, and the Division of Nephrology, Huashan Hospital, Fudan University, Shanghai 200040, China

Received for publication, September 28, 2004 , and in revised form, February 7, 2005.

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
NFB plays a critical role mediating COX2 expression in renal medullary interstitial cells (RMICs). The trans-activating ability of NFB can be modified by another nuclear factor C/EBP that can physically bind to NFB and regulate its activity. Because the COX2 promoter also contains a C/EBP site adjacent to the NFB site, the present study examined whether these two transcription factors cooperate to induce COX2 expression following hypertonic stress. Hypertonicity markedly induced COX2 expression in cultured medullary interstitial cells by immunoblot analysis. The tonicity-induced COX2 expression was suppressed by mutant IB (IBm) that blocks NFB activation, demonstrating that tonicity-induced COX2 expression depends on NFB activation. However, mutation of the NFB site in the COX2 promoter failed to abolish tonicity-induced COX2 reporter activity. IB kinase-1 (IKK1) significantly induced COX2-luciferase activity by 2.3-fold (n = 10, p < 0.01); mutation of the NFB site also failed to abolish IKK1-stimulated COX2 reporter activity (86 ± 3.1% of wild type, p > 0.05, n = 4). Interestingly, mutation of the C/EBP site of the COX2 gene significantly reduced both IKK1 and hypertonicity-induced COX2 reporter activity (p < 0.01). To further examine the potential role of C/EBP in tonicity-induced COX2 expression, a dominant negative C/EBP-p20 was transduced into RMICs. C/EBP-p20 markedly suppressed hypertonic (550 mOsm) induction of COX2 (immunoblot) to a similar extent as IBm. No additional suppression was observed when both NFB and C/EBP were simultaneously blocked by IBm and C/EBP-p20. Interestingly, IKK-induced COX2 expression was not only blocked by IBm, but also completely abolished by C/EBP-p20. Further studies demonstrated physical association of C/EBP to NFB p65 by coimmunoprecipitation. Importantly, this interaction between C/EBP and NFB was greatly enhanced following hypertonic stress. These studies indicate C/EBP is required for the transcriptional activation of COX2 by NFB, suggesting a dominant role for the C/EBP pathway in regulating induction of RMIC COX2 by hypertonicity.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Cyclooxygenase (COX)¹ is a key enzyme in the conversion of arachidonic acid to prostaglandin H, which is further catalyzed to five major bioactive prostaglandins (e.g. PGE2, PGI2, PGF2, PGD2, and TXA2) through their distinct synthases. Two isoforms of COX have been identified, designated COX1 and COX2 (1, 2). COX1 is constitutively expressed in most tissues detected and is thought to carry out housekeeping functions, such as cytoprotection of the gastric mucosa, regulation of renal blood flow, and control of platelet aggregation. In contrast, COX2 mRNA and protein are normally undetectable in most tissues, but can be rapidly induced by a variety of stimuli, including various cytokines, growth factors, oncogenes, endotoxins, and chemicals (2). Accumulating evidence suggests that COX2-mediated prostaglandins play important roles in regulating cellular homeostasis, inflammation, and tumorigenesis (2–5).

The kidney is one of the few organs where constitutive COX2 expression is detected. Renal medullary interstitial cells (RMICs) are a major site of COX2 expression in the kidney (6 –8). Recent studies indicate that the hypertonic environment in renal medulla is an important factor contributing to COX2 expression (7, 9). Expression of COX2 plays an important role promoting renal medullary interstitial cells to survive otherwise lethal changes in environmental tonicity (7, 10), which is critical to the regulation of urinary concentrating ability. The mechanism by which renal medullary interstitial cell COX2 expression is regulated following hypertonic stress has only been partially characterized (7, 9). Studies suggest that in RMICs, hypertonic stress activates nuclear factor NFB, and this is critical for induction of COX2 expression in renal medullary interstitial cells (7). NFB has also been reported to be an important signaling pathway promoting COX2 expression by such stimuli as hypoxia and tumor necrosis factor, etc. (11–16). NFB binding sites have been identified in the promoter region of the COX2 gene (17, 18), making it likely that binding of the NFB protein to the NFB cis-acting element is responsible for increased COX2 expression. However, recent studies indicate that the mechanism underlying NFB-associated COX2 expression is more complex. Interactions between NFB and other nuclear factors such as C/EBP, SP1, and PPAR have been reported (19–21). Cross-talk among these transcriptional factors can be critical for their transcriptional activity (22–24). The present studies examined the mechanism by which NFB activates COX2 gene expression in cultured renal medullary interstitial cells.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Cell Culture—Rabbit medullary interstitial cells were cultured as described previously (6). Briefly, female New Zealand White rabbits were anesthetized (44 mg/kg ketamine and 10 mg/kg xylazine, i.m.). The left kidney was removed, and the medulla was dissected and minced with a razor blade under sterile conditions in 5 ml of sterile RPMI 1640 plus 10% (v/v) fetal bovine serum (Hyclone, Logan, Utah). This homogenate was injected subcutaneously in the abdominal wall using a 14-gauge needle. Twenty days postsurgery, subcutaneous nodules appeared. The rabbits were re-anesthetized and sacrificed by decapitation, and the nodules removed under sterile conditions. Nodules were minced into 1-mm fragments and explanted in 75-cm² tissue culture plates. Cells were cultured in RPMI 1640 tissue culture medium supplemented with 10% (v/v) fetal bovine serum, and streptomycin and penicillin. Cultures were incubated at 37 °C in 95% O₂, 5% CO₂. Tissue culture medium was changed every 48–72 h. Mouse RMICs were prepared as reported (7). C57BL/6J mice were sacrificed, and kidneys were rapidly removed and washed in Ringer's solution. The renal medulla was excised, minced, and placed in Ringer's solution containing collagenase (1 mg/ml) at 37 °C for 1 h with occasional agitation. The collagenase-treated tissue was then washed in Dulbecco's modified Eagle's medium (DMEM) three times and cultured in DMEM containing 10% fetal bovine serum. Cells were studied in their third to fourth passages. These cells exhibited characteristic abundant oil red O-positive lipid droplets, a characteristic of type I RMICs (25).

Immunoblotting—Immunoblots were performed on whole cell lysates from cultured RMICs. The protein concentration was determined using the bicinchoninic acid protein assay (Sigma). Thirty micrograms of protein extract were loaded in each lane of a 10% SDS-PAGE minigel and run at 120 V. Protein was transferred to a nitrocellulose membrane at 22 V overnight at 4 °C. The membrane was washed three times with TBST (50 mM Tris, pH 7.5, 150 mM NaCl, 0.05% Tween 20) and then incubated in blocking buffer (150 mM NaCl, 50 mM Tris, 0.05% Tween 20, and 5% Carnation nonfat dry milk, pH 7.5) for 1 h at room temperature. The membrane was then incubated with an antihuman COX2 antibody (1:1,000, 160106, Cayman), anti-C/EBP (1:400 sc-150, Santa Cruz Biotechnology), or anti-p-C/EBP (1:500, 3084, Cell Signaling Technology) antibody in blocking buffer overnight at 4 °C. Following washing (3x), the membrane was incubated with a horseradish peroxidase-conjugated secondary antibody (1:20,000, Jackson Immuno-Research Laboratories) for 1 h at room temperature, followed by three 15-min washes. Antibody labeling was visualized by addition of the chemiluminescence reagent (Renaissance, PerkinElmer Life Sciences), and the membrane was exposed to Kodak XAR-5 film.

Nuclear Protein Extraction and Immunoprecipitation—Cultured cells were washed with phosphate-buffered saline and lysed on ice for 15 min in hypotonic lysis buffer (10 mM HEPES, 5 mM KCl, 1.5 mM MgCl₂, 1 mM NaF, 1 mM Na₃VO₃, and 0.08% Nonidet P-40) containing proteinase inhibitor mixture (1 tablet/10 ml, Complete Mini, Roche Applied Science). The cell lysate was centrifuged at 4 °C at 3,000 rpm for 5 min. The supernatant (cytoplasmic proteins) was stored at -80 °C. The pellet was washed with hypotonic lysis buffer two times and centrifuged at 13,000 rpm for 5 s. The supernatant was removed, and the pellet was resuspended in 50 µl of Dignin solution (20 mM HEPES, 1.5 mM MgCl₂, 0.2 mM EDTA, 420 mM NaCl, 50 mM -glycerophosphate, 1 mM NaF, 1 mM Na₃VO₄,1mM dithiothreitol, 25% glycerol, pH 7.9) for 30 min and centrifuged for 10 min at 13,000 rpm. The supernatant nuclear protein was used for immunoprecipitation. 50 µg of nuclear protein extract was added to 500 µl of IP buffer (Tris 20 mM, pH 7.5, NaCl 150 mM,EDTA1mM, EGTA, 1 mM, Triton-100 1%). The nuclear protein was precleared by adding 0.2 µg of rabbit IgG and 20 µl of 25% protein A-agarose, incubated at 4 °C for 30 min, and centrifuged at 3,000 rpm. The supernatant was collected, and 0.4 µg of anti-C/EBP antibody was added and incubated at 4 °C for 2 h. 20 µl of 25% protein A-agarose beads were added and incubated at 4 °C overnight with mixing. The beads were washed three times with IP buffer and were resuspended in 30 µl of 2x sample buffer. The samples were boiled for 2 min, and 20 µl of precipitated proteins were added to each lane of an SDS-PAGE gel.

Ad-IBmu, Ad-IKK, Ad-CEBP-p20, and Ad-GFP—Adenoviral vectors, encoding a dominant negative IB and a constitutively active IB kinase 1 (IKK1) or a dominant negative C/EBP-p20, were used to modulate NFB and C/EBP activity, respectively, in cultured renal medullary interstitial cells. The trans-dominant inhibitor of NFB, IBmut (avian IBS36/40A) was provided by Dr. Timothy Blackwell (7). Ad-C/EBP-p20 was provided by Dr. Linda Sealy. Constitutively active IKK1 (IKK1) cDNA was kindly provided by Dr. Frank Mercurio (Signal Pharmaceutical, San Diego, CA) and subcloned into pACCMV for IKK1 adenovirus construction (7). The IKK1 was made constitutively active by Ser-Glu mutations in Ser¹⁷⁶ and Ser¹⁸⁰ residues (26). An adenovirus expressing green fluorescent protein was constructed as described (27) for a control adenovirus. For infection of RMICs, 200 µl of virus (multiplicity of infection, 100) was added to each culture dish, and GFP adenovirus was used to adjust for equal loading. After a 2-h incubation, the virus was removed, and fresh Dulbecco's modified Eagle's medium with 10% fetal bovine serum was added. Experiments were carried out 48–72 h after infection.

COX2 Reporter Studies—An 891-bp human COX2 luciferase reporter construct was generously provided by Dr. Lee-Ho Wang (17). A 327-bp human COX2 luciferase reporter construct, and its NFB and C/EBP site mutants were provided by Dr. Hiroyasu Inoue (28). The NFB and C/EBP site mutants have been shown to lack the ability to bind to NFB and C/EBP, respectively (28, 29). Two NFB sites in the 891-bp COX2 reporter construct were mutated via site-directed mutagenesis using primers: CGGCGGCGGGAGAGCTCATTCCCTGCGCCC (5' sense), CAGGAGAGTGGCCACTACCCCCTCTGCT (3' sense) (30) (QuikChange II Site-Directed Mutagenesis kits, Stratagene, La Jolla, CA). The firefly luciferase COX2 reporter plasmid and a plasmid containing Renilla luciferase driven by the TK promoter (Promega) were transfected into cells using SuperFect (Qiagen). Cells were lysed 48 h after transfection for luciferase activity measurement using the Dual Luciferase assay system (Promega). COX2 luciferase activity was adjusted by Renilla luciferase activity.

Chromatin Immunoprecipitation (ChIP) Assay—The ability of NFB and C/EBP to bind to endogenous COX2 promoter was examined using the ChIP assay according to the manufacturer's protocol (Upstate Technologies, Lake Placid, NY). Briefly, cultured mouse renal medullary interstitial cells (7) were exposed to isotonic or hypertonic media for indicated periods of time. Cells were then cross-linked with 1% formaldehyde for 5 min. After washing with phosphate-buffered saline, cells were lysed with SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8.1) containing proteinase inhibitors (Complete Mini, EDTA-free). The chromatin was sheared by sonication (strength, 20%; pulse, 12 s x three times). The cross-linked chromatin was quantified to determine the initial amount of DNA present in the different samples. 100 ng of DNA were used as input. The remaining chromatin fractions were precleared with salmon sperm DNA/protein A-agarose for 1 h and immunoprecipitated with antibodies (NFB-p65 or CEBP, 200 µg/ml, Santa Cruz Biotechnology) overnight at 4 °C. The COX2 promoter DNA, bound to p65 and C/EBP, was analyzed by PCR using primers: sense, CGGAGGGTAGTTCCATGAAA; antisense, CAGGCTTTTACCCACGCAAA. PCR was performed at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s, for 35 cycles.

To further examine whether the C/EBP site in the COX2 promoter plays an important role in mediating NFB binding to the COX2 gene, wild type or mutants of COX2 promoter constructs containing 327-bp human COX2 promoter sequences, were transfected into mouse interstitial cells using SuperFect (Qiagen). 24 h after transfection, cells were exposed to hypertonic stress for 1 h. The cells were cross-linked and precipitated as described in ChIP assay. The transfected human COX2 promoter bound to NFB was detected by PCR using primers specific for the human COX2 gene. PCR primers: sense, CCCCTCTGCTCCCAAATT; antisense, CGCTCACTGCAAGTCGTAT. The PCR was performed at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s, for 35 cycles. Genomic DNA from a human cell line HEK293 cells was used as a positive control. Genomic DNA extracted from mouse renal medullary interstitial cells without transfection was used as a negative control.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Mutation of the NFB site of the COX2 Promoter Fails to Suppress Induction of the COX2 Reporter by Hypertonic Stress—Our previous studies demonstrate that hypertonicity activates NFB, and blocking NFB by a mutant IB dramatically suppresses hypertonic induction of COX2, suggesting that NFB mediates hypertonicity-induced COX2 expression (7). Two NFB binding sites have been identified in the human COX2 promoter (-446 to -437 and -223 to -214) (31). To examine whether hypertonicity-induced COX2 expression is mediated via binding of NFB protein to the NFB element of the COX2 gene, a COX2 luciferase transcription reporter system with mutant NFB element was used. Hypertonic stress in RMICs significantly increased COX2 reporter activity in both 891-bp COX2 luciferase reporter construct (Fig. 1)- and 327-bp COX2 reporter construct (Fig. 2)-transfected cells. Surprisingly, mutation of NFB sites in the COX2 promoter luciferase reporters failed to abolish hypertonic stress-induced COX2 reporter activity in either COX2 reporter constructs. In contrast, mutation of the C/EBP binding site completely blocked hypertonic activation of COX2 reporter activity (Fig. 2).

View larger version (11K): [in this window] [in a new window]   FIG. 1. Effect of NFB site mutation on hypertonicity-induced COX2 luciferase reporter activity in cultured renal medullary interstitial cells. Cultured RMICs were co-transfected with wild-type or mutant COX2 promoter-driven firefly luciferase vector and TK-driven Renilla luciferase plasmid. Cells were exposed to isotonic (300 mOsm) or hypertonic (500 mOsm) medium. 24 h later, luciferase activities were determined as described under "Materials and Methods." **, p < 0.01 versus isotonic medium, n = 6. KBM, NFB site mutation.

View larger version (22K): [in this window] [in a new window]   FIG. 2. COX2 luciferase reporter activity following hypertonic stress. Cultured RMICs were co-transfected with wild-type or mutant COX2 promoter-driven firefly luciferase vector and TK-driven Renilla luciferase plasmid. Cells were cultured in isotonic or hypertonic (500 mOsm) medium for 24 h. Luciferase activities were determined as described under "Materials and Methods." WT, wild type; KBM, NFB site mutant; CEBPM, C/EBP site mutant. **, p < 0.01 versus 300 mOsm.

Blocking of C/EBP Suppresses Hypertonic Induction of COX2 Protein Expression—

View larger version (57K): [in this window] [in a new window]   FIG. 3. Effect of C/EBP-p20 on hypertonicity-induced COX2 expression. Cultured RMICs were transduced with GFP, IBm, C/EBP-p20, or p20 plus IBm via adenoviral vectors. Cells were then exposed to isotonic (I, 300 mOsm) or hypertonic medium (H, 550 mOsm). 24 h later, cellular proteins were extracted and immunoblotted for COX2.

C/EBP-p20 Suppresses IKK-induced COX2 Protein Expression in RMICs—

View larger version (30K): [in this window] [in a new window]   FIG. 4. Effect of C/EBP-p20 on IKK1-induced COX2 expression. Cultured RMICs were transduced with GFP, IKK1, IKK1 plus IBm, or IKK plus C/EBP-p20 via adenoviral vectors. 24 h later, cellular proteins were extracted and immunoblotted for COX2. A, representative autoradiograph of immunoblot for COX2. B, densitometry analysis of immunoblot for COX2. **, p < 0.01; n = 6

Mutation of the COX2 Promoter C/EBP Binding Site Suppresses IKK-activated COX2 Reporter Activity—

View larger version (26K): [in this window] [in a new window]   FIG. 5. IKK-associated COX2 luciferase reporter activity. Cultured RMICs were co-transfected with wild-type or mutant COX2 promoter-driven firefly luciferase vector and TK-driven Renilla luciferase plasmid. Cells were transduced with AdGFP or AdIKK. 24 h later, luciferase activities were determined as described under "Materials and Methods." WT, wild type; KBM, NFB site mutant; CEBPM, C/EBP site mutant. **, p < 0.01 versus AdGFP

Hypertonic Stress Enhances Interaction of C/EBP and p65 in Cultured Renal Medullary Interstitial Cells—

View larger version (48K): [in this window] [in a new window]   FIG. 6. Effect of hypertonic stress on C/EBP expression (A), interaction between C/EBP and NFB p65 (B), and C/EBP phosphorylation (C). Renal medullary interstitial cells were cultured to confluent and exposed to hypertonic stress (550 mOsm) for indicated periods of time. A, whole cell protein extracts were separated on SDS-PAGE and blotted for C/EBP. B, nuclear protein extracts were immunoprecipitated by C/EBP antibody. C/EBP immunoprecipitated proteins were blotted for p65 as described under "Materials and Methods." C, whole cell protein extracts were blotted with anti-pC/EBP and C/EBP antibodies.

Hypertonic Stress Increases Binding of C/EBP and NFB p65 to the Endogenous COX2 Promoter—

View larger version (53K): [in this window] [in a new window]   FIG. 7. Effect of hypertonicity on binding of p65 (A) and C/EBP (B) to the COX2 promoter in renal medullary interstitial cells in vivo. Cultured renal medullary interstitial cells were exposed to hypertonic medium for 0, 0.5, 1, and 3 h. Cells were fixed with formaldehyde. p65- or C/EBP-bound DNA was isolated via immunoprecipitation using anti-p65 or anti-C/EBP antibodies. 100 ng of genomic DNA was used as input. The p65- or C/EBP-bound COX2 promoter DNA was detected by PCR as described under "Materials and Methods."

C/EBP Site Is Required for NFB to Bind to the COX2 Promoter—

View larger version (19K): [in this window] [in a new window]   FIG. 8. Effect of mutation of NFB and C/EBP sites on hypertonicity-induced binding of p65 to the COX2 promoter. Cultured mouse renal medullary interstitial cells were transfected with the human COX2 327-bp promoter construct with or without mutations of NFB and C/EBP binding sites and exposed to hypertonic medium for 1 h. Cells were fixed with formaldehyde. p65-bound DNA was isolated via immunoprecipitation using anti-p65 antibody. The p65-bound-transfected COX2 promoter DNA was detected by PCR as described under "Materials and Methods." +, genomic DNA from human HEK293 cells was used as a positive control; -, DNA from mouse renal medullary interstitial cells without transfection was used as a negative control.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The presence of mechanisms facilitating survival in the hypertonic conditions is an important characteristic of the cells residing in the renal medulla. The importance of COX activity in maintaining viability of renal medullary cells has long been recognized, based on observations that COX2-inhibiting NSAIDs may cause severe renal medullary injury including papillary necrosis (41). Recent studies show that hypertonicity induces COX2 and that this plays an important role in promoting survival of renal medullary interstitial cells residing in this otherwise lethal hypertonic environment (7, 10, 34, 42). Our previous studies indicate that hypertonicity-induced COX2 expression in RMICs is mediated by NFB. These studies showed that water deprivation not only increased renal medullary COX2 expression, but also increased renal NFB activity (7). Blocking NFB activation using an IB mutant dramatically suppressed hypertonic induction of COX2 expression in cultured renal medullary interstitial cells (7). Although NFB activation is also reported to promote COX2 expression by other stimuli (11–16), the promoter-based mechanisms have not been fully characterized, partially because the presence of the putative NFB site in the COX2 gene has led to the assumption that this site is the target of NFB.

The present study unexpectedly found that mutation of NFB site in the COX2 gene failed to block COX2 expression by hypertonic stress, suggesting that the NFB element in the COX2 gene promoter is not critical. In contrast, mutation of the C/EBP binding site, which is located adjacent to the NFB site, abolished induction of COX2 expression by hypertonicity. The involvement of C/EBP in hypertonic trans-activation of COX2 expression is also supported by studies showing increased binding of C/EBP as well as NFB p65 to the endogenous COX2 promoter. The C/EBP pathway does not appear to be separate from the NFB pathway, because the additive effect of C/EBP blockade and NFB blocking was not observed. Moreover, mutation of C/EBP site not only abolished hypertonicity-induced COX2 expression, but also abolished IKK-induced COX2 expression, whereas mutation of the NFB site of the COX2 gene failed to abolish IKK-induced COX2 expression, suggesting that the NFB cis-acting site is not critical for IKK-induced COX2 expression. Rather the C/EBP site appears to be integral to the mechanism of NFB activation, leading to COX2 expression.

C/EBP belongs to the basic leucine zipper C/EBP family that is comprised of six members, C/EBP, , , , , and . C/EBP is closely related to C/EBP and C/EBP, but is distantly related to C/EBP, C/EBP, and C/EBP (43, 44). Several truncated forms of C/EBP have been reported (45). The low molecular weight form of C/EBP (C/EBP-p20) has been shown to function as a dominant negative form of C/EBP (46). Other studies demonstrate that C/EBP family members are capable of interacting with members of NFB (Rel) family members (22–24). Overlapping or adjacent NFB/CEBP binding sites are located within the promoter regions of IL-6, IL-8, IL-12, angiotensinogen, serum amyloid A, and COX2 genes (24, 47, 48), indicating a close relationship between NFB and C/EBP in transcriptional regulation of these proteins (19). Adams et al. (49) reported that nuclear Rel/CEPB heteromer is important in PGG-glucan-induced Rel-A/CEBP-related transcription. A p65/CEBP complex, activated following lipopolysaccharide liver, is a potent activator of serum amyloid-A expression, promoting transcription from either NFB or C/EBP elements within the promoter (24). The present studies now show that the C/EBP site of the COX2 promoter is more critical for activation of COX2 expression than the NFB site, because mutation of the C/EBP site significantly blocked IKK-induced COX2 reporter activity, whereas mutation of the NFB site failed to block IKK-associated COX2 expression. The in vivo DNA binding studies show that the C/EBP site on the COX2 promoter plays an important role in mediating p65 binding to the COX2 promoter (Fig. 8). Based on these observations, it may be hypothesized that activated Rel protein(s) may interact with C/EBP(s) in renal medullary interstitial cells. This protein complex may be recruited to COX2 promoter DNA through interaction at the C/EBP site of the COX2 gene, thereby enhancing transcription of COX2 expression. This hypothesis is further supported by coimmunoprecipitation studies demonstrating increasing physical association between Rel A (p65) and C/EBP following hypertonic stress.

Although the cis-acting site for the isoform of C/EBP has been identified in the COX2 promoter, other C/EBP family members could also bind to the C/EBP site and trans-activate COX2 gene expression (39). Overexpression of murine C/EBP and C/EBP produced a dose-dependent increase in basal and IL-1-stimulated COX2 luciferase reporter activity. C/EBP caused a greater enhancement of basal and IL-1-stimulated COX2 promoter activity than C/EBP, suggesting that C/EBP is a stronger trans-activator. Overexpression of C/EBP-p20, a dominant negative C/EBP inhibitor, which retains the C-terminal DNA binding domain and the leucine zipper region but lacks the N-terminal trans-activating domain of C/EBP (50), not only blocks C/EBP-induced COX2 expression, but can also block C/EBP-induced COX2 expression (51). Nevertheless, in the present study, C/EBP and - do not seem to be involved, because immunoblotting failed to detect C/EBP and - expression in cultured renal medullary interstitial cells. It has been reported that C/EBP phosphorylation (Thr-235) is associated with ERK/Ras-induced activation of C/EBP (52, 53). However, Thr-235 phosphorylation of C/EBP does not seem to be critical in mediating interaction with p65 and promoting COX2 transcription following hypertonic stress, because hypertonicity did not change C/EBP phosphorylation (Fig. 6C). The mechanism by which hypertonicity enhanced interaction of C/EBP and NFB remains to be explored.

In summary, the present study indicates that C/EBP is required for the transcriptional activation of COX2 by NFB following hypertonic stress, suggesting a dominant role for the C/EBP pathway in regulating induction of RMIC COX2 by hypertonicity.

	FOOTNOTES

 
^* This work was supported by NIDDK, National Institutes of Health Grant DK065024 (to C.-M. H.) and a Vanderbilt Discovery grant. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^|| To whom correspondence should be addressed: S3223 MCN, Vanderbilt University Medical Center, Nashville, TN 37232. Tel.: 615-343-9867; Fax: 615-343-4704; E-mail: chuanming.hao{at}vanderbilt.edu.

¹ The abbreviations used are: COX, cyclooxygenase; RMIC, renal medullary interstitial cells; IL, interleukin; ChIP, chromatin immunoprecipitation assay; C/EBP, CCAAT/enhancer-binding protein; IKK, IB kinase; Ad, adenovirus; GFP, green fluorescent protein.

	ACKNOWLEDGMENTS

 
We thank Dr. Linda Sealy from Vanderbilt University for providing the C/EBP-p20 construct. We thank Dr. Matthew Breyer for support and critical reading (DK37097). We thank Reyadh Redha for assistance with RMIC preparation. We also thank Dr. Manakin B. Srichai for critical reading of the present manuscript. The IKK1 cDNA was a generous gift from F. Mercurio.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Hla, T., Bishop-Bailey, D., Liu, C. H., Schaefers, H. J., and Trifan, O. C. (1999) Int. J. Biochem. Cell Biol. 31, 551-557[CrossRef][Medline] [Order article via Infotrieve]
2. Smith, W. L., and Langenbach, R. (2001) J. Clin. Investig. 107, 1491-1495[Medline] [Order article via Infotrieve]
3. FitzGerald, G. A., and Loll, P. (2001) J. Clin. Investig. 107, 1335-1337[Medline] [Order article via Infotrieve]
4. Subbaramaiah, K., and Dannenberg, A. J. (2003) Trends Pharmacol. Sci. 24, 96-102[CrossRef][Medline] [Order article via Infotrieve]
5. Breyer, M. D., Hao, C., and Qi, Z. (2001) Curr. Opin. Crit. Care 7, 393-400[CrossRef][Medline] [Order article via Infotrieve]
6. Guan, Y., Chang, M., Cho, W., Zhang, Y., Redha, R., Davis, L., Chang, S., DuBois, R. N., Hao, C. M., and Breyer, M. (1997) Am. J. Physiol. 273, F18-F26[Medline] [Order article via Infotrieve]
7. Hao, C. M., Yull, F., Blackwell, T., Komhoff, M., Davis, L. S., and Breyer, M. D. (2000) J. Clin. Investig. 106, 973-982[Medline] [Order article via Infotrieve]
8. Zhang, M. Z., Hao, C. M., Breyer, M. D., Harris, R. C., and McKanna, J. A. (2002) Am. J. Physiol. Renal Physiol. 283, F509-516[Abstract/Free Full Text]
9. Yang, T., Huang, Y., Heasley, L. E., Berl, T., Schnermann, J. B., and Briggs, J. P. (2000) J. Biol. Chem. 275, 23281-23286[Abstract/Free Full Text]
10. Moeckel, G. W., Zhang, L., Fogo, A. B., Hao, C. M., Pozzi, A., and Breyer, M. D. (2003) J. Biol. Chem. 278, 19352-19357[Abstract/Free Full Text]
11. Lo, C. J., Cryer, H. G., Fu, M., and Lo, F. R. (1998) J. Trauma 45, 19-23; discussion 23-14[Medline] [Order article via Infotrieve]
12. Nakao, S., Ogata, Y., Shimizu-Sasaki, E., Yamazaki, M., Furuyama, S., and Sugiya, H. (2000) Mol. Cell Biochem. 209, 113-118[CrossRef][Medline] [Order article via Infotrieve]
13. Paik, J. H., Ju, J. H., Lee, J. Y., Boudreau, M. D., and Hwang, D. H. (2000) J. Biol. Chem. 275, 28173-28179[Abstract/Free Full Text]
14. Roshak, A. K., Jackson, J. R., McGough, K., Chabot-Fletcher, M., Mochan, E., and Marshall, L. A. (1996) J. Biol. Chem. 271, 31496-31501[Abstract/Free Full Text]
15. Yan, X., Wu Xiao, C., Sun, M., Tsang, B. K., and Gibb, W. (2002) Biol. Reprod. 66, 1667-1671[Abstract/Free Full Text]
16. Tsai, S. H., Liang, Y. C., Chen, L., Ho, F. M., Hsieh, M. S., and Lin, J. K. (2002) J. Cell. Biochem. 84, 750-758[CrossRef][Medline] [Order article via Infotrieve]
17. Tazawa, R., Xu, X. M., Wu, K. K., and Wang, L. H. (1994) Biochem. Biophys. Res. Commun. 203, 190-199[CrossRef][Medline] [Order article via Infotrieve]
18. Okada, Y., Voznesensky, O., Herschman, H., Harrison, J., and Pilbeam, C. (2000) J. Cell. Biochem. 78, 197-209[CrossRef][Medline] [Order article via Infotrieve]
19. Perkins, N. D. (1997) Int. J. Biochem. Cell Biol. 29, 1433-1448[CrossRef][Medline] [Order article via Infotrieve]
20. Kleemann, R., Gervois, P. P., Verschuren, L., Staels, B., Princen, H. M., and Kooistra, T. (2003) Blood 101, 545-551[Abstract/Free Full Text]
21. Ikawa, H., Kameda, H., Kamitani, H., Baek, S. J., Nixon, J. B., Hsi, L. C., and Eling, T. E. (2001) Exp. Cell Res. 267, 73-80[CrossRef][Medline] [Order article via Infotrieve]
22. Stein, B., Cogswell, P. C., and Baldwin, A. S., Jr. (1993) Mol. Cell. Biol. 13, 3964-3974[Abstract/Free Full Text]
23. Diehl, J. A., and Hannink, M. (1994) Mol. Cell. Biol. 14, 6635-6646[Abstract/Free Full Text]
24. Ray, A., Hannink, M., and Ray, B. K. (1995) J. Biol. Chem. 270, 7365-7374[Abstract/Free Full Text]
25. Muirhead, E. E., Germain, G. S., Leach, B. E., Brooks, B., and Stephenson, P. (1973) Prostaglandins 3, 581-594[Medline] [Order article via Infotrieve]
26. Mercurio, F., Zhu, H., Murray, B. W., Shevchenko, A., Bennett, B. L., Li, J., Young, D. B., Barbosa, M., Mann, M., Manning, A., and Rao, A. (1997) Science 278, 860-866[Abstract/Free Full Text]
27. Hao, C. M., Komhoff, M., Guan, Y., Redha, R., and Breyer, M. D. (1999) Am. J. Physiol. 277, F352-F359[Medline] [Order article via Infotrieve]
28. Inoue, H., Yokoyama, C., Hara, S., Tone, Y., and Tanabe, T. (1995) J. Biol. Chem. 270, 24965-24971[Abstract/Free Full Text]
29. Inoue, H., and Tanabe, T. (1998) Biochem. Biophys. Res. Commun. 244, 143-148[CrossRef][Medline] [Order article via Infotrieve]
30. Schmedtje, J. F., Jr., Ji, Y. S., Liu, W. L., DuBois, R. N., and Runge, M. S. (1997) J. Biol. Chem. 272, 601-608[Abstract/Free Full Text]
31. Appleby, S. B., Ristimaki, A., Neilson, K., Narko, K., and Hla, T. (1994) Biochem. J. 302, 723-727[Medline] [Order article via Infotrieve]
32. Duong, D. T., Waltner-Law, M. E., Sears, R., Sealy, L., and Granner, D. K. (2002) J. Biol. Chem. 277, 32234-32242[Abstract/Free Full Text]
33. Jover, R., Bort, R., Gomez-Lechon, M. J., and Castell, J. V. (2002) FASEB J. 16, 1799-1801[Abstract/Free Full Text]
34. Hao, C. M., Redha, R., Morrow, J., and Breyer, M. D. (2002) J. Biol. Chem. 277, 21341-21345[Abstract/Free Full Text]
35. Wadleigh, D. J., Reddy, S. T., Kopp, E., Ghosh, S., and Herschman, H. R. (2000) J. Biol. Chem. 275, 6259-6266[Abstract/Free Full Text]
36. Xie, W., and Herschman, H. R. (1995) J. Biol. Chem. 270, 27622-27628[Abstract/Free Full Text]
37. Thomas, B., Thirion, S., Humbert, L., Tan, L., Goldring, M. B., Bereziat, G., and Berenbaum, F. (2002) Biochem. J. 362, 367-373[CrossRef][Medline] [Order article via Infotrieve]
38. Thomas, B., Berenbaum, F., Humbert, L., Bian, H., Bereziat, G., Crofford, L., and Olivier, J. L. (2000) Eur. J. Biochem. 267, 6798-6809[Medline] [Order article via Infotrieve]
39. Zhu, Y., Saunders, M. A., Yeh, H., Deng, W. G., and Wu, K. K. (2002) J. Biol. Chem. 277, 6923-6928[Abstract/Free Full Text]
40. Subbaramaiah, K., Lin, D. T., Hart, J. C., and Dannenberg, A. J. (2001) J. Biol. Chem. 276, 12440-12448[Abstract/Free Full Text]
41. Segasothy, M., Samad, S. A., Zulfigar, A., and Bennett, W. M. (1994) Am. J. Kidney Dis. 24, 17-24[Medline] [Order article via Infotrieve]
42. Rao, R., Hao, C. M., and Breyer, M. D. (2004) J. Biol. Chem. 279, 3949-3955[Abstract/Free Full Text]
43. Wedel, A., and Ziegler-Heitbrock, H. W. (1995) Immunobiology 193, 171-185[Medline] [Order article via Infotrieve]
44. Akira, S., and Kishimoto, T. (1997) Adv. Immunol. 65, 1-46[Medline] [Order article via Infotrieve]
45. Ossipow, V., Descombes, P., and Schibler, U. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 8219-8223[Abstract/Free Full Text]
46. Liao, J., Piwien-Pilipuk, G., Ross, S. E., Hodge, C. L., Sealy, L., MacDougald, O. A., and Schwartz, J. (1999) J. Biol. Chem. 274, 31597-31604[Abstract/Free Full Text]
47. Ruocco, M. R., Chen, X., Ambrosino, C., Dragonetti, E., Liu, W., Mallardo, M., De Falco, G., Palmieri, C., Franzoso, G., Quinto, I., Venuta, S., and Scala, G. (1996) J. Biol. Chem. 271, 22479-22486[Abstract/Free Full Text]
48. Yoshimoto, T., Kojima, K., Funakoshi, T., Endo, Y., Fujita, T., and Nariuchi, H. (1996) J. Immunol. 156, 1082-1088[Abstract]
49. Adams, D. S., Nathans, R., Pero, S. C., Sen, A., and Wakshull, E. (2000) J. Cell. Biochem. 77, 221-233[CrossRef][Medline] [Order article via Infotrieve]
50. Descombes, P., and Schibler, U. (1991) Cell 67, 569-579[CrossRef][Medline] [Order article via Infotrieve]
51. Harrison, J. R., Kelly, P. L., and Pilbeam, C. C. (2000) J. Bone Miner Res. 15, 1138-1146[CrossRef][Medline] [Order article via Infotrieve]
52. Hanlon, M., Sturgill, T. W., and Sealy, L. (2001) J. Biol. Chem. 276, 38449-38456[Abstract/Free Full Text]
53. Shuman, J. D., Sebastian, T., Kaldis, P., Copeland, T. D., Zhu, S., Smart, R. C., and Johnson, P. F. (2004) Mol. Cell. Biol. 24, 7380-7391[Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				D. Schunke, P. Span, H. Ronneburg, A. Dittmer, M. Vetter, H.-J. Holzhausen, E. Kantelhardt, S. Krenkel, V. Muller, F. C.G.J. Sweep, et al. Cyclooxygenase-2 Is a Target Gene of Rho GDP Dissociation Inhibitor {beta} in Breast Cancer Cells Cancer Res., November 15, 2007; 67(22): 10694 - 10702. [Abstract] [Full Text] [PDF]

				S. W. Chung, H. Y. Chung, A. Toriba, T. Kameda, N. Tang, R. Kizu, and K. Hayakawa An Environmental Quinoid Polycyclic Aromatic Hydrocarbon, Acenaphthenequinone, Modulates Cyclooxygenase-2 Expression through Reactive Oxygen Species Generation and Nuclear Factor Kappa B Activation in A549 Cells Toxicol. Sci., February 1, 2007; 95(2): 348 - 355. [Abstract] [Full Text] [PDF]

				R. Tammali, K. V. Ramana, S. S. Singhal, S. Awasthi, and S. K. Srivastava Aldose Reductase Regulates Growth Factor-Induced Cyclooxygenase-2 Expression and Prostaglandin E2 Production in Human Colon Cancer Cells Cancer Res., October 1, 2006; 66(19): 9705 - 9713. [Abstract] [Full Text] [PDF]

				J. Ding, J. Li, C. Xue, K. Wu, W. Ouyang, D. Zhang, Y. Yan, and C. Huang Cyclooxygenase-2 Induction by Arsenite Is through a Nuclear Factor of Activated T-cell-dependent Pathway and Plays an Antiapoptotic Role in Beas-2B Cells J. Biol. Chem., August 25, 2006; 281(34): 24405 - 24413. [Abstract] [Full Text] [PDF]

				F. Syeda, J. Grosjean, R. A. Houliston, R. J. Keogh, T. D. Carter, E. Paleolog, and C. P. D. Wheeler-Jones Cyclooxygenase-2 Induction and Prostacyclin Release by Protease-activated Receptors in Endothelial Cells Require Cooperation between Mitogen-activated Protein Kinase and NF-{kappa}B Pathways J. Biol. Chem., April 28, 2006; 281(17): 11792 - 11804. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 280/16/16354    most recent M411134200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Chen, J. Articles by Hao, C.-M. Search for Related Content PubMed PubMed Citation Articles by Chen, J. Articles by Hao, C.-M. Social Bookmarking                      What's this?