Originally published In Press as doi:10.1074/jbc.M413897200 on February 15, 2005
J. Biol. Chem., Vol. 280, Issue 16, 16393-16401, April 22, 2005
The SPRY Domain-containing SOCS Box Protein 1 (SSB-1) Interacts with MET and Enhances the Hepatocyte Growth Factor-induced Erk-Elk-1-Serum Response Element Pathway*
Dakun Wang
,
Zaibo Li
,
Edward M. Messing
¶, and
Guan Wu
¶||
From the
Department of Urology,
Department of Pathology and Laboratory Medicine, and ¶The James P. Wilmot Cancer Center, University of Rochester Medical Center, Rochester, New York 14642
Received for publication, December 9, 2004
, and in revised form, February 4, 2005.
 |
ABSTRACT
|
|---|
The suppressor of cytokine signaling (SOCS) protein family includes a SPRY (repeats in splA and RyR) domain-containing SOCS box protein (SSB) subfamily, which consists of four members, SSB-1, SSB-2, SSB-3, and SSB-4. These proteins contain a central SPRY domain and a C-terminal SOCS box. Although some of the SOCS protein subfamilies function as adaptors for a large family of ubiquitin-protein isopeptide ligases to regulate certain signaling pathways, the function of the SSB subfamily remains to be determined. In our previous studies, we have found that two SPRY domain-containing proteins, RanBP9 and RanBP10, interact with MET through the SPRY domain. In the present study, we explored the function of SSB proteins in the regulation of the hepatocyte growth factor (HGF)-MET signaling. Our results showed that all four SSB proteins also interacted with the MET. The MET interaction with SSB-1 was further investigated. We demonstrated that SSB-1 bound to MET tyrosine kinase domain through its SPRY domain. MET interacted with SSB-1 in both the absence and the presence of HGF, but HGF treatment resulted in the recruitment of more SSB-1 by MET. We showed that overexpression of SSB-1 but not other SSB proteins enhanced the HGF-induced serum response element (SRE)-luciferase activity. Overexpression of SSB-1 exhibited no effect on the basal level or epidermal growth factor-induced SRE-luciferase activity. SSB-1 also enhanced HGF-induced Erk phosphorylation. Suppression of SSB-1 by the RNA interference method down-regulated HGF-induced SRE-luciferase activity and decreased Elk-1 activation. These results suggest that SSB-1 may play an important role in enhancing the HGF-induced Erk-Elk-1-SRE pathway. Furthermore, we demonstrated that in response to HGF stimulation, the SSB-1 protein became phosphorylated at tyrosine residue 31. The phosphorylated SSB-1 protein bound to p120Ras-GTPase-activating protein (GAP) but did not promote the degradation of p120RasGAP, indicating that enhanced HGF-MET signaling by overexpression of SSB-1 was not dependent on p120RasGAP degradation.
 |
INTRODUCTION
|
|---|
MET, a receptor protein-tyrosine kinase for hepatocyte growth factor (HGF),1 is a 190-kDa transmembrane protein, consisting of an extracellular
-subunit of 45 kDa linked by disulfide bonds to a transmembrane
-subunit of 145 kDa (1, 2). Similar to other members of the receptor tyrosine kinase superfamily, the MET receptor contains three functionally distinct domains: a large ligand-binding domain derived from the extracellular
-subunit and the N-terminal portion of the
-subunit; a single hydrophobic transmembrane domain; and an intracellular tyrosine kinase domain (2, 3). Activation of MET depends on receptor dimerization, which is induced by HGF stimulation. The dimerized MET proteins result in intermolecular transphosphorylation and activation of their tyrosine kinase domains. The activation of the kinase activity and the association of adaptor proteins to MET elicit the activation of signaling cascades, including the Ras pathway (2, 3).
Ras is localized at the cytoplasmic surface of the cell membrane and has two interconvertible forms: GDP-bound inactive and GTP-bound active forms (46). The GDP-GTP exchange reaction is stimulated by guanine nucleotide-exchanging proteins (7). The resultant GTP-Ras activates downstream signaling proteins until Ras returns to its inactive GDP-bound state by hydrolysis of the GTP through its intrinsic GTPase activity. The rate of Ras-GTP hydrolysis is strongly accelerated by the binding of Ras GTPase-activating proteins (GAPs) (5). Functionally, Ras proteins lie at the center of signal transduction pathways, linking signals from cell surface receptors to the cytosol and the nucleus (5, 8). An upstream signal stimulates the dissociation of GDP from the GDP-bound form followed by formation of the GTP-bound form, which leads to the conformational change of the downstream effector-binding region and facilitates the interaction between Ras and its downstream effectors. After binding to Ras, Raf-1 (a Ras effector) is translocated to the plasma membrane on which its serine-threonine kinase activity becomes activated. Activated Raf-1 then phosphorylates and activates mitogen-activated protein kinase/extracellular signal-regulated kinase kinase (a dual kinase), resulting in the phosphorylation and activation of downstream serine/threonine kinases Erk1 and Erk2 (mitogen-activated protein kinases), which in turn activate Elk-1, a transcription factor involved in the ternary complex formation at serum response elements (SREs) (9). There are several types of GAP of Ras in mammals, including the neurofibromatosis type 1 gene product GAP1m, as well as GAP1IP4BP, IQGAP1, and RasGAP (11). RasGAP, also called p120RasGAP according to its molecular weight, is one of the first identified and best characterized GAPs of Ras (10, 11). A splice variant encoding a shorter 100-kDa form of RasGAP is expressed only in placenta (12). The established role of p120RasGAP is its ability to stimulate the return of Ras to the inactive GDP-bound form. p120RasGAP binds preferentially to GTP-bound Ras and greatly enhances the hydrolysis of GTP from Ras (5, 6).
The suppressor of cytokine signaling (SOCS) protein family consists of more than 40 members. The SOCS box is about 50 amino acids in length and contains two blocks of well conserved amino acid residues. The C-terminal conserved region is an L/P-rich sequence of unknown function, whereas the N-terminal conserved region is a consensus BC box (13, 14). The BC box structure is also found in elongin B and elongin C, two important proteins present in the E3 complex containing the von Hippel-Lindau tumor suppressor (15). Based on their other domain structures, SOCS box-containing proteins can be divided into several subfamilies, including the SOCS subfamily (containing a SH2 domain), SSB subfamily (a SPRY domain), WD-40 repeat-containing SOCS box protein (WSB) subfamily (a WD-40 repeat), and ankyrin repeat-containing SOCS box protein (ASB) subfamily (an ankyrin repeat), and so forth (13, 14). Ras and some Ras-like GTPases also contain SOCS box-like structures (14). In all of these proteins, the SOCS box is located in their C termini, and other different domain structures are located in their middle or N-terminal regions (14). Although some of these subfamilies are components of or function as adaptors for a large family of E3 ligases to regulate certain signaling pathways (15), the function of certain members, such as the SSB subfamily, remains to be determined.
In our previous studies, we have demonstrated that the SPRY domain of RanBP9 and RanBP10 is involved in the interaction between these two proteins and the MET tyrosine kinase domain (16, 17). RanBP9 and RanBP10 exhibit functional differences on MET signaling (16, 17). We hypothesized that the SPRY domain is a general protein-protein interaction interface mainly involved in the interaction of SPRY domain-containing proteins with receptor protein-tyrosine kinase kinase domains. Because the SPRY domains of the SSB subfamily show significant amino acid sequence similarity with RanBP9 and RanBP10, we investigated whether these SPRY domain-containing SOCS box proteins played a role in the regulation of MET signaling pathways. The SSB protein subfamily contains four members: SSB-1 (NP_079382
[GenBank]
), SSB-2 (NP_116030
[GenBank]
), SSB-3 (NP_543137
[GenBank]
), and SSB-4 (NP_543138
[GenBank]
). We demonstrated that all four SSB proteins can interact with MET. SSB-1 through its SPRY domain interacts with the MET tyrosine kinase domain, and the interaction was regulated positively by HGF. We also demonstrated that, upon HGF stimulation, SSB-1 is phosphorylated at its tyrosine residue 31 and phosphorylated SSB-1 can interact with p120RasGAP. Furthermore, SSB-1 enhances the HGF-MET-induced Erk-Elk-1-SRE pathway. These results suggest that SSB-1 is an important regulator in the HGF-MET signaling.
 |
MATERIALS AND METHODS
|
|---|
Cell Culture, Transient Transfection, and Other ReagentsHeLa and HEK293 cells were maintained in Dulbecco's modified Eagle's medium containing penicillin (25 units/ml), streptomycin (25 µg/ml), and 10% fetal bovine serum. Serum-starved cells were maintained in Dulbecco's modified Eagle's medium containing 0.1% fetal bovine serum. Transient transfection of plasmids, except for the transfection of RNAi constructs, was performed using SuperFect (Qiagen) transfection solution according to the manufacturer's protocol.
Plasmid ConstructionpcDNA4C-SSB-1, pcDNA4C-SSB-2, pcDNA4C-SSB-3, and pcDNA4C-SSB-4 were constructed by inserting the corresponding PCR products into the pcDNA4C vector. The primers harboring the BamHI (forward primer) and EcoRI (reverse primer) site, respectively, were used to amplify the open reading frames of different human SSB cDNAs from a Marathone-ready kidney cDNA library (Clontech) for SSB-1 and SSB-2 and from Mammalian Gene Collection full-length cDNA clones for SSB-3 and SSB-4. pGFP-C3-SSB-1 and pcDNA4C-p120RasGAP-N were constructed with a similar strategy. pcDNA4C-p120RasGAP-N contains the N terminus of p120RasGAP, nucleotide 11333 of p120RasGAP open reading frame amplified from a first-strand human kidney cDNA. pKH3-SSB-1 was constructed by transferring the open reading frame of SSB-1 from pcDNA4C-SSB-1 to pKH3 through EcoRI and BamHI sites. pcDNA4C-SSB-1 (Y2P) and pKH3-SSB-1 (Y2P) were constructed based on wild-type pcDNA4C-SSB-1 by PCR-based mutagenesis. The codon for tyrosine residue 31 (Y2) of SSB-1 was mutated from TAT to TTT, corresponding to a tyrosine to phenylalanine change at the amino acid level. All inserts of the constructs involved in PCR amplification were confirmed by direct DNA sequencing.
GST Pull-down AssayThis assay was performed as described previously (17). Briefly, GST or GST fusion proteins were expressed in BL21 cells and purified using glutathione-Sepharose 4B MicroSpin columns (Amersham Biosciences). Equal amounts of GST or GST fusion proteins were added into glutathione-Sepharose 4B MicroSpin columns and incubated for 2 h at 4 °C. The in vitro expressed c-Myc-fused MET C-terminal fragment (amino acids 11021408) produced in the TNT system (Promega) was then added into each reaction and incubated at 4 °C for 2 h. Bound proteins were eluted, and 20 µl of each eluted protein was resolved on a SDS polyacrylamide gel followed by Western blot analysis using anti-c-Myc antibody.
Co-immunoprecipitation AssayHGF (Sigma), EGF (Amersham Biosciences), antibodies including anti-His and anti-GFP monoclonal antibodies, anti-HA, anti-actin polyclonal antibody (Santa Cruz Biotechnology), anti-MET monoclonal antibody, anti-phosphotyrosine (anti-pTyr), anti-p120RasGAP polyclonal antibodies (Upstate Biotechnology), and anti-c-Myc antibody (BD Biosciences) were purchased from commercial sources as indicated. Co-immunoprecipitation assays were performed as described previously (16). Cell lysates (500 µg of total proteins) were incubated with immunoprecipitation antibody and incubated at 4 °C for 2 h. Thirty µl of protein A/G-agarose was then added into each mixture, which was then rotated at 4 °C for 2 h, centrifuged, washed three times, and resolved on a SDS polyacrylamide gel followed by Western blot analysis.
SRE Dual Luciferase AssayHeLa Cells were plated in 12-well dishes and transfected with different combinations of testing plasmids and the SRE-luciferase (SRE-LUC) reporter plasmid plus internal control plasmid pRL-SV40. Twelve h after transfection, cells were serumstarved for 1618 h and then treated with or without HGF (30 ng/ml) or EGF (200 ng/ml) for 8 h. Cells were lysed, and the dual luciferase assay was performed using the Dual-Luciferase Reporter 1000 Assay System (Promega) according to the manufacturer's protocol. Mean values of luciferase activity relative to the HGF-untreated and pcDNA4C-transfected control were calculated from triplicate wells.
pG5 Dual Luciferase AssayHeLa Cells were plated in 12-well dishes and transfected with different combinations of testing plasmids and the pGal4-Elk-1 plasmid and the pG5-LUC reporter plasmid plus internal control plasmid pRL-SV40. Twelve h after transfection, cells were serum-starved for 1618 h and then treated with or without HGF (30 ng/ml) for 8 h. Cells were lysed, and the dual luciferase assay was performed using the Dual-Luciferase Reporter 1000 Assay System (Promega) according to the manufacturer's protocol. Mean values of luciferase activity relative to the HGF-untreated and pMCV-U6-transfected control were calculated from triplicate wells.
Construction and Transfection of DNA Vector-based RNA Interference PlasmidsSmall interfering RNA (siRNA) target sites were selected by scanning the cDNA sequence for AA dinucleotides via siRNA target finder (Ambion), recording the 19 nucleotides that start with G or A immediately downstream of the AA, and then analyzing them by the BLAST search to eliminate any sequences with significant homology to other genes. The siRNA inserts, containing selected 19-nucleotide coding sequences followed by a 9-nucleotide spacer, an inverted repeat of the coding sequences, plus 6 threonine residues, were generated as double-stranded DNAs with ApaI and EcoRI sites with primer extension and then subcloned into plasmid pMSCV/U6 at the ApaI/EcoRI site. The corresponding oligonucleotides for generating the SSB-1-RNAi-A insert are 5'-GTTAACTCTCTTAGAGTCTTTCAAGAGAAGACTCTAAGAGAGTTAACTTTTTT-3' (forward) and 5'-AATTAAAAAAGTTAACTCTCTTAGAGTCTTCTCTTGAAAGACTCTAAGAGAGTTAACGC C-3' (reverse). The corresponding oligonucleotides for generating the SSB-1-RNAi-B insert are 5'-ATGTACATTACCCCCTTATTTCAAGAGAATAAGGGGGTAATGTACATTTTTT-3' (forward) and 5'-AATTAAAAAAATGTACATTACCCCCTTATTCTCTTGAAATAAGGGGGTAATGTACATGGCC-3' (reverse). The corresponding oligonucleotides for generating the SSB-1-RNAi-NC-C are 5'-ATAGCCTCACGTGCAATCTTTCAAGAGAAGATTGCACGTGAGGCTATTTTTTT-3' (forward) and 5'-AATTAAAAAAATGCCTCACGTGCAATCTTCTCTTGAAAGATTGCACGTGAGGCTATGGCC-3' (reverse). The corresponding oligonucleotides for generating the SSB-1-RNAi-Sc-B (scramble-sequenced RNAi-B) are 5'-ATTTAGTAAACCCTTCCCCTCAAGAGAGGGAAAGGGTTTACTAAATTTTTTT-3' (forward) and 5'-AATTAAAAAAATTTAGTAAACCCTTTCCCTCTCTGAGGGGAAAGGGTTTACTAAATGGCC-3' (reverse). These constructs were transfected into in HeLa cells using FuGENE 6 (Roche Applied Science) transfection solution according to the manufacturer's protocol. Thirty-six h after transfection, the cells were collected by trypsinization and reseeded in the selective medium, growth medium plus 1 µg/ml puromycin (BD Biosciences). Twenty-four h after the treatment, all nontransfected cells floating in the medium were washed away. The transfected cells were allowed to proliferate for 2 days and collected for RNA isolation and real time PCR.
RNA Isolation and Real Time Reverse Transcription-PCRTotal RNAs were extracted using TRIzol reagent (Invitrogen) according to the manufacturer's protocol. One µg of RNA was subjected to reverse transcription using Superscript II (Invitrogen). The reactions were incubated at 42 °C for 50 min. The SSB-1 primers, 5'-ACGCTATCAGGGGCAAAGTCG-3' (sense) and 5'-GGCTACCAGGAAGGAGTCAGG-3' (antisense), and the
-actin primers (as a control), 5'-GATCATTGCTCCTCCTGAGC-3' (sense) and 5'-TGTGGACTTGGGAGAGGACT-3' (antisense), were used in our experiments. Real time PCR was performed with 5 µl of 10-fold diluted reverse transcription product, 25 µlof2x SYBR green PCR master mix (Bio-Rad), and 1 µl of each primer (10 µM) in a total volume of 50 µl. PCR was performed on an iCycler iQ multicolor real time PCR detection system (Bio-Rad), and cycling conditions were 95 °C for 10 min followed by 50 cycles of 95 °C for 20 s, 55 °C for 20 s, and 72 °C for 30 s. Each sample was run in triplicate. Data were analyzed by iCycler iQ software (Bio-Rad).
 |
RESULTS
|
|---|
SSB Proteins Contains a SPRY Domain Similar to the One in RanBP9 and RanBP10 SSB proteins contain a central SPRY domain and a C-terminal SOCS box. There are a total of four putative SSB proteins encoded in the human genome, namely SSB-1, SSB-2, SSB-3, and SSB-4. The SPRY domain is also present in a variety of other proteins including RanBP9 and RanBP10 (16, 17). Amino acid sequence alignment analysis using Vector NT I software revealed that the four SSB proteins share an overall 71.4% positive and 10.6% identity of their amino acid sequences. SSB-1 shares 50 and 75% amino acid sequence identity with SSB-2 and SSB-4, respectively. SSB-3 possesses a long N-terminal extension and shares the least amino acid sequence identity with the rest of the SSB proteins. SSB-3 only shares 16% identity with SSB-1. SSB-1 contains a tyrosine residue in the context of YXXP in its N-terminal region. However, this feature is not conserved among other SSB proteins (Fig. 1). The alignment also revealed that the SSB protein family has higher similarity in its SPRY domains and SOCS boxes (Fig. 1). Among the four SSB proteins, they share 96.2% positives and 19.1% identity in their SPRY domains and 89.4% positives and 19.1% identity in their SOCS boxes. Their SPRY domains share a high degree of similarity with the SPRY domains in RanBP9 and RanBP10 with the positive of 75.7% (Fig. 1). We have demonstrated in our previous studies that the SPRY domains in RanBP9 and RanBP10 are responsible for their interactions with the tyrosine kinase domain of MET (16, 17). As SSB proteins also contain a SPRY domain, which shares high sequence similarity with the ones in RanBP9 and RanBP10, we further tested whether these proteins could also interact with MET.

View larger version (104K):
[in this window]
[in a new window]
|
FIG. 1. Amino acid sequence alignment of SSB proteins with the SPRY domain of RanBP9 and RanBP10. Amino acid sequences of SSB-1, SSB-2, SSB-3, and SSB-4 and the SPRY domains of RanBP9 and RanBP10 are aligned together. The position of the SPRY domain is underlined with a solid bar, and the position of the SOCS box of SSB proteins is underlined with a dashed bar. Down arrow indicates the tyrosine residue in the context of YXXP in SSB-1, and this tyrosine residue is not conserved in other SSB proteins. There is a similarity among the four SSB proteins and among the SPRY domains of RanBP9 and RanBP10 and the four SSB proteins. Increasing intensity of shading corresponds to increasing similarity.
|
|
SSB Proteins Interact with METHEK293 cells, a human embryonic kidney cell line, transfected with pcDNA4-SSB-1, -2, -3, -4 or the parental vector pcDNA4, respectively, were harvested and lysed. The lysates were then immunoprecipitated with anti-MET antibody. Immunoblotting with anti-His6 antibody and anti-MET antibody revealed that His6-tagged SSB-1, SSB-2, SSB-3, and SSB-4 were co-immunoprecipitated with MET but not with the control anti-GFP antibody (Fig. 2A), demonstrating that these SSB proteins could interact with MET. The interaction between MET and one of the SSB proteins, SSB-1, was further tested by a GST pull-down assay, in which the fusion protein of c-Myc and MET tyrosine kinase domain was able to bind to the GST·SSB-1 fusion protein but not by GST alone (Fig. 2B). This result demonstrated the direct interaction between SSB-1 and MET tyrosine kinase domain. A second set of GST pull-down assays mapped the MET-interacting region in SSB-1, not surprisingly, to its SPRY domain (Fig. 2C). These data further confirmed that the SPRY domain is involved in protein-protein interaction. As a receptor protein-tyrosine kinase, MET is phosphorylated and activated upon stimulation with its ligand, HGF. We therefore tested the interaction between SSB-1 and MET in the presence or absence of HGF stimulation by a co-immunoprecipitation assay. The experiments were conducted three times, and the data were quantified using ImageQuant software. All of the three experiments showed that in the presence of HGF more GFP·SSB-1 fusion proteins (
4-fold increase) were co-immunoprecipitated with the anti-MET antibody, indicating that HGF stimulation has a positive effect on the interaction between SSB-1 and MET (Fig. 2D). This is consistent with our previous finding that the interaction between MET and RanBP9 through its SPRY domain can be enhanced with HGF treatment (16, 17).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 2. SSB proteins interact with MET. A, co-immunoprecipitation (Co-IP) of transfected His6-tagged SSB proteins with MET. Lysates from HEK293 cells transfected with pcDNA4-SSB-1, -2, -3, -4 or the parental vector pcDNA4, respectively, were immunoprecipitated with anti-MET antibody or anti-GFP antibody (a negative control) followed by immunoblotting (IB) with anti-His6 antibody (upper panel). Equal amounts of MET contained in the lysates were also demonstrated with an anti-MET blot (lower panel). B, analysis of the interaction between SSB-1 and the MET tyrosine kinase domain by a GST pull-down assay. GST or GST·SSB-1 was incubated with in vitro expressed c-Myc-tagged MET tyrosine kinase domain in the glutathione-Sepharose 4B MicroSpin columns and washed. Bound proteins were resolved on a SDS polyacrylamide gel followed by immunoblotting with anti-c-Myc antibody. C, the SPRY domain of SSB-1 interacts with the MET tyrosine kinase domain. A similar approach as described in B was taken to demonstrate the interaction between the SPRY domain of SSB-1 and the MET tyrosine kinase domain. D, co-immunoprecipitation of transfected SSB-1 proteins with MET in the presence or absence of HGF stimulation. Lysates from HEK293 cells were transfected with pGFP-C3-SSB-1 or the parental vector pGFP-C3 and serum-starved. HGF treatment was then applied or withheld, and the lysates were immunoprecipitated with anti-MET antibody. The immunoprecipitated complexes were resolved on a 10% SDS polyacrylamide gel followed by immunoblotting with anti-GFP (upper panel of the gel image). Equal amounts of MET contained in the lysates were also demonstrated with an anti-MET blot (lower panel of the gel image). Quantitative results using ImageQuant software based on three independent experiments are shown beneath the gel image.
|
|
SSB-1 Enhances HGF-induced SRE-LUC Reporter Gene Expression and Erk PhosphorylationAlthough the four SSB proteins are quite similar in terms of their amino acid sequences and their abilities to interact with MET tyrosine kinase domain, our luciferase assay showed that they differed in their effects on HGF-induced SRE-LUC expression (Fig. 3A). Our results indicated that overexpression of SSB-1 but not other SSB proteins can enhance the HGF-induced SRE-LUC expression (Fig. 3A) without affecting the basal SRE-LUC expression or the EGF-induced SRE-LUC expression (Fig. 3B). Furthermore, our Western blot analysis showed that the HGF-induced Erk phosphorylation in HEK293 cells was also enhanced
5-fold upon SSB-1 overexpression (Fig. 3C). The quantification was based on three independent experiments. These data demonstrated that, when overexpressed, only SSB-1 could enhance the HGF-induced Erk-SRE signaling.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3. SSB-1 enhances the HGF-induced SRE-LUC reporter gene expression and Erk phosphorylation. A, SSB-1 but not SSB-2, SSB-3, or SSB-4 enhances the HGF-induced SRE-LUC reporter gene expression. HeLa cells transfected with pcDNA4 or pcDNA4-SSB-1, pcDNA4-SSB-2, pcDNA4-SSB-3, or pcDNA4-SSB-4, together with a SRE-LUC reporter plasmid, were lysed after being treated with or without HGF as indicated. LUC activities were measured, and the mean values of LUC activity relative to HGF-untreated and pcDNA4 control (column 6) were calculated from triplicate experiments. Mean values of LUC activity relative to the HGF-untreated and pcDNA4-transfected control were calculated from triplicate wells. B, SSB-1 enhances HGF-induced but not EGF-induced SRE-LUC expression. HeLa cells transfected with pcDNA4 or pcDNA4-SSB-1 together with the SRE-LUC reporter plasmid were lysed after being treated with or without HGF (30 ng/ml) or EGF (200 ng/ml) as indicated. LUC activities were measured, and the mean values of LUC activity relative to untreated and pcDNA4-transfected control (column 1) were calculated from triplicate experiments. Mean values of LUC activity relative to the HGF-untreated and pcDNA4-transfected control were calculated from triplicate wells. C, SSB-1 enhances HGF-induced Erk phosphorylation in HEK293 cells. HEK293 cells transfected with pcDNA4 or pcDNA4-SSB-1 were serum-starved for 18 h; they were lysed after being treated with or without HGF (30 ng/ml) as indicated. The lysates were resolved on a SDS polyacrylamide gel followed by immunoblotting with anti-Erk2 or anti-pErk antibody. Quantification of relative abundance of phosphorylated Erk (p-Erk) using ImageQuant software based on three independent experiments were shown on the right.
|
|
Suppression of SSB-1 by siRNA Represses HGF-induced SRE-LUC and pG5-LUC ExpressionTo further investigate the role of SSB-1 on the HGF-induced Erk-SRE signaling, we suppressed SSB-1 expression using a RNAi technique. Potential inhibitory sequences were constructed into the pMSCV/U6 vector and transfected into HeLa cells. RNAs were then extracted from these cells and used as templates in real time reverse transcription-PCR to analyze the mRNA expression of SSB-1. pMSCV/U6-RNAi-B and pMSCV/U6-RNAi-A were found to be able to inhibit SSB-1 mRNA expression by 60 and 25%, respectively. pMSCV/U6-RNAi-NC-C did not show an inhibitory effect and served as a negative control (NC). A scramble RNAi-B (pMSCV/U6-RNAi-Sc-B) was also constructed and served as another negative control (Fig. 4A). Consistent with the mRNA level, we found that SSB-1 protein expression was also suppressed by pMSCV/U6-RNAi-B and pMSCV/U6-RNAi-A. Each of these siRNA constructs was transfected into HeLa cells at a 1:1 transfection ratio with pKH3-SSB-1. pEGFP-C3 in an amount equal to 5% of the total DNA was also included in the transfection. Fifty µg of whole cell lysate proteins from each sample was used for the Western blot analysis of HA-SSB-1, GFP (transfection control), and
-actin (equal loading control). When normalized with the amount of GFP, HA-SSB-1 protein expression was suppressed 83 and 28% by pMSCV/U6-RNAi-B and pMSCV/U6-RNAi-A, respectively, whereas pMSCV/U6, pMSCV/U6-RNAi-NC-C, and pMSCV/U6-RNAi-Sc-B did not show obvious effects on SSB-1 protein level. The expression of the two controls was not affected by these siRNA constructs. In a SRE-LUC experimental group, HGF-induced SRE-LUC expression was suppressed when SSB-1 expression was inhibited 30 and 50% by pMSCV/U6-RNAi-B and pMSCV/U6-RNAi-A, respectively, whereas negative RNAi controls did not affect the induction (Fig. 4C). In another luciferase assay, pGAL4-Elk plasmid and a control plasmid pRL-SV40 were co-transfected into HeLa cells with the reporter pG5-LUC containing a Gal4-DNA-binding site. pGal4-Elk-1 encodes a fusion protein of Elk-1 and the Gal4-DNA-binding domain, which directs Elk-1 to pG5-LUC. Therefore, the expression level of pG5-LUC in this system reflects the activated Elk-1 level. Our results showed that when SSB-1 was suppressed by RNAi, Elk-1 activation reflected by luciferase expression was also suppressed (Fig. 4D). This further suggests that SSB-1 may play an important role in the HGF-induced Erk-Elk-1-SRE signaling.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 4. Suppression of SSB-1 by siRNA represses HGF-induced SRE-LUC and pG5-LUC expression. A, quantitative analysis of different siRNAs of SSB-1 (RNAi-A, RNAi-B, RNAi-Sc-B, and RNAi-NC-C) on the expression of SSB-1 by real time reverse transcription-PCR. RNAi-Sc-B indicates for the sequence-scrambled RNAi-B, which serves as another negative control. pMSCV/U6-RNAi-B significantly down-regulates SSB-1 mRNA expression. B, Western blot analysis of different siRNAs of SSB-1 (RNAi-A, RNAi-B, RNAi-Sc-B, and RNAi-NC-C) on the protein expression of SSB-1. Each of these siRNA constructs was transfected into HeLa cells at a 1:1 transfection ratio with pKH3-SSB-1. pEGFP-C3 in an amount equal to 5% of the total DNA was also transfected as the transfection control; 50 µg of total cell lysate proteins from each sample was used for the Western blot analysis of SSB-1 (HA-tagged), GFP, and -actin. C, suppression of SSB-1 by siRNA represses HGF-induced SRE-LUC expression. HeLa cells transfected with different RNAi constructs and the SRE-LUC reporter plasmid and an internal control plasmid pRL-SV40 were serum-starved and treated with or without HGF. The cells were then lysed, and LUC activities were measured. Mean values of LUC activity relative to the HGF-untreated and pMCV-U6-transfected control were calculated from triplicate wells. D, inhibition of SSB-1 by siRNA suppresses HGF-induced pG5-LUC expression. HeLa cells transfected with different RNAi constructs and pGal4-Elk-1 plasmid and pG5-LUC reporter plasmid plus internal control plasmid pRL-SV40 were serum-starved and treated with or without HGF. The cells were then lysed, and LUC activities were measured. Mean values of LUC activity relative to the HGF-untreated and pMCV-U6-transfected control were calculated from triplicate wells.
|
|
SSB-1 Is Phosphorylated at Tyrosine Residue 31 (Y2) upon HGF StimulationMET is a receptor protein-tyrosine kinase in which the tyrosine kinase activity is activated by binding with its ligand, HGF. A variety of adaptor proteins such as phosphatidylinositol 3-kinase and Shc have been shown to be tyrosine-phosphorylated following association with MET upon HGF stimulation. We asked whether SSB-1 is a MET substrate or whether SSB-1 becomes phosphorylated upon HGF stimulation. Amino acid analysis revealed that the SSB-1 protein contains 14 tyrosine residues (Tyr1Tyr14). Indeed, the tyrosine phosphorylation of SSB-1 upon HGF stimulation was demonstrated in two independent experiments. In the first experiment, pcDNA4-SSB-1 or the parental vector pcDNA4 was transfected into HEK293 cells, which then underwent serum starvation followed with or without HGF stimulation (30 ng/ml) for 30 min. The cells lysates purified with nickel-nitrilotriacetic acid beads, which specifically bind to His6-tagged proteins (in this case, His6-tagged SSB-1 proteins), were resolved on a SDS polyacrylamide gel and immunoblotted with anti-pTyr antibody. Our results showed that in the presence of HGF stimulation, the SSB-1 protein was tyrosine-phosphorylated (Fig. 5A). As a control experiment, crude cell lysates from these samples were immunoblotted with anti-His6 antibody and showed an equal expression of His6-SSB-1 in the presence or absence of HGF stimulation (Fig. 5A). The second experiment utilized a slightly different approach; SSB-1 was expressed as a HA fusion protein (pKH3-SSB-1) and purified by immunoprecipitation with anti-HA antibody. The immunoprecipitated complex was resolved on a SDS polyacrylamide gel and immunoblotted with anti-pTyr antibody. This experiment confirmed that in the presence of HGF, SSB-1 was tyrosine-phosphorylated. Crude cell lysates immunoblotted with anti-HA antibody showed that equal amounts of HA-SSB-1 were immunoprecipitated with the anti-HA antibody in the presence and absence of HGF stimulation (Fig. 5B). SSB-1 contains an N-terminal YXXP motif that is similar to the one in SOCS-3 (18). This N-terminal YXXP motif in SSB-1 is conserved between human and mouse but not present in other SSB family members (Figs. 1 and 5C). It has been shown that SOCS-3, a SOCS box-containing protein, is tyrosine-phosphorylated at a tyrosine residue in its YXXP motif and that modification of SOCS-3 through this YXXP motif phosphorylation is critical for its association with p120RasGAP (18). To further test whether SSB-1 was phosphorylated at the YXXP region, we constructed a mutation into the SSB-1 construct by changing Y2 (tyrosine residue 31) into a phenylalanine residue. Indeed, SSB-1 with this single mutation failed to be phosphorylated upon HGF stimulation (Fig. 5B). These results demonstrate that tyrosine residue 31 of SSB-1 is the key amino acid phosphorylated in response to HGF stimulation.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 5. SSB-1 is phosphorylated at tyrosine residue 31 (Y2) upon HGF stimulation. A, His6-SSB-1 is tyrosine-phosphorylated in response to HGF stimulation. pcDNA4-SSB-1 or the parental vector pcDNA4 was transfected into HEK293 cells, which then underwent serum starvation followed with or without HGF stimulation. Nickelnitrilotriacetic acid (Ni-NTA) agarose-purified cell lysates were resolved on a SDS polyacrylamide gel and immunoblotted (IB) with anti-pTyr antibody (upper panel). Crude cell lysates were immunoblotted with anti-His6 antibody to determine equal His6-SSB-1 expression in the presence and absence of HGF stimulation for 30 min (lower panel). NS indicates nonspecific bands. B, HA-SSB-1 is tyrosine-phosphorylated in response to HGF stimulation, and a tyrosine to phenylalanine (Y31F) mutation of tyrosine residue 31 (Y2) abolishes the phosphorylation. pKH3-SSB-1, pKH3-SSB-1 Y2M, or the parental vector pKH3 was transfected into HEK293 cells, which then underwent serum starvation followed with or without HGF stimulation. Anti-HA-immunoprecipitated complexes were resolved on a SDS polyacrylamide gel and immunoblotted with anti-pTyr antibody. Crude cell lysates were immunoblotted with anti-HA antibody to demonstrate that equal amounts of HA-SSB-1 were present in different lysates. C, the N-terminal YXXP motif in SSB-1 is conserved but not present in other SSB proteins. Human and mouse amino acid sequences of SSB-1 surrounding the YXXP motif are aligned together with other SSB members in the similar region. The YXXP motif is in bold face, and the tyrosine in the motif is indicated by an arrowhead. Conserved sequences between human and mouse are shaded.
|
|
Phosphorylated SSB-1 Associates with p120RasGAP upon HGF StimulationTyrosine residues 31 (Y2) in SSB-1 that is phosphorylated in response to HGF stimulation are located in a context of YXXP (YCKP). This is consistent with a known consensus SH2-binding sequence, a phosphorylated YXXP motif (1820). This sequence is responsible for proteins binding to the SH2 domain of p120RasGAP (18). To further explore whether the phosphorylated SSB-1 could bind to p120RasGAP, we performed co-immunoprecipitation experiments. We found that the endogenous p120RasGAP protein could be co-immunoprecipitated with the transfected GFP·SSB-1 fusion protein with anti-GFP antibody. The interaction between SSB-1 and p120RasGAP was only detectable in cells treated with HGF. The SSB-1-interacting region in p120RasGAP was located in its N terminus because a transfected p120RasGAP N terminus could also be co-immunoprecipitated with SSB-1 (Fig. 6A). Furthermore, immunoblotting with anti-pTyr antibody indicated that SSB-1 was in its phosphorylated state (Fig. 6A). These results suggest that only phosphorylated SSB-1 binds to p120RasGAP. These results also suggest that similar to SOCS-3 (18), tyrosine-phosphorylated SSB-1 may bind to p120RasGAP in an SH2-dependent manner. Because SOCS box containing proteins may be involved in protein ubiquitination and proteasomal degradation, we further tested whether the stability of p120RasGAP was affected by SSB-1 overexpression. HA-tagged SSB-1 was overexpressed in HEK293 cells by transfection of the pKH3-SSB-1 plasmid and the corresponding parental vector, pKH3, respectively. Cells were serum-starved for 16 h and treated with cycloheximide (100 µg/ml) for 6 h before they were treated with HGF (50 ng/ml) for predetermined time periods. Our experiments showed that SSB-1 overexpression did not affect p120RasGAP stability (Fig. 6B), indicating that increased HGF-induced Erk-Elk-1-SRE activity by SSB-1 is not due to increased p120RasGAP degradation.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 6. Phosphorylated SSB-1 interacts with p120RasGAP upon HGF stimulation. A, phosphorylated SSB-1 interacts with p120RasGAP. Different combinations of plasmids (pEGFP-C3-SSB-1, pcDNA4C-RasGAP-N, and the parental vectors) were transfected into HEK293 cells. Cells were then treated with or without HGF (30 ng/ml) for 30 min after serum starvation. Cell lysates were immunoprecipitated with anti-GFP antibody followed by immunoblotting with anti-RasGAP antibody to determine whether RasGAP binds to GFP·SSB-1 (top panel) and with anti-pTyr antibody to determine the phosphorylation status of SSB-1 in the immunoprecipitated complex (middle panel). Equal amounts of GFP·SSB-1 contained in the lysates were also demonstrated with an anti-GFP blot (bottom panel). B, overexpression of HA-SSB-1 does not decrease p120RasGAP levels upon HGF treatment. HEK293 cells transfected with pKH3-SSB-1 or the parental vector pKH3 were serum starved for 16 h. The cells were pretreated with cycloheximide (100 µg/ml) for 6 h before they were treated with HGF (50 ng/ml) for predetermined time periods as indicated. The cell lysates were resolved on a SDS polyacrylamide gel and immunoblotted with anti-p120RasGAP antibody (top panels), anti- -actin (middle panels), and anti-HA antibody (bottom panels), respectively. p120RasGAP levels were not affected by the overexpression of SSB-1.
|
|
 |
DISCUSSION
|
|---|
The SOCS box-containing protein family consists of a signature C-terminal SOCS box and a central or an N-terminal domain structure that differs in different subfamilies of these proteins (14). Although members of the SOCS subfamily are well known for their negative regulatory roles in cytokine signal transduction (2123), the biochemical and cellular functions of the SSB subfamily have not been investigated. In this report, we provide experimental evidence that the SSB proteins interact with MET and that one member of the SSB subfamily, SSB-1, participates in regulation of the MET signaling pathway. SSB proteins contain a central SPRY domain and a C-terminal SOCS box. The SPRY domain is also present in a variety of other proteins including RanBP9 and RanBP10, which, as shown in our previous studies, can interact with MET via their SPRY domains (16, 17). In this study, we have demonstrated that the SPRY domain in SSB-1 protein can also mediate the interaction between the tyrosine kinase domain of MET and SSB-1. The four SSB proteins share high sequence similarity especially in the region containing the SPRY domain and the SOCS box. Increasing evidence suggests that the SPRY domain is an interface for protein-protein interaction (16, 17, 2426).
All of these four SSB genes are widely expressed in different human tissues based on the expression data compiled in the UniGene data base (NCBI) implicating their indispensable physiological roles. Although the differences in their temporal and spatial expressions are currently unknown, their molecular and physiological functions may be very different because of the difference in their amino acid sequences. The similarity and dissimilarity in their amino acid structures likely dictate their common and unique binding partners. As demonstrated by our experiments, although all four SSB proteins can interact with the MET, only SSB-1, and not other SSB proteins, enhances HGF-MET signaling. SSB-1 contains a tyrosine residue in the context of a YXXP sequence, and phosphorylation of this tyrosine is required for SSB-1 to bind to p120RasGAP, indicating that the interaction between SSB-1 and p120RasGAP is tightly controlled through SSB-1 Tyr31 phosphorylation. This YXXP structural motif is not conserved in other SSB proteins. It is possible that this structural difference among the members of SSB proteins contributes to their functional difference in HGF-MET signaling. A growing body of evidence suggests that the SOCS box proteins mediate specific substrate binding to E3 ligases (14, 15). However, SSB-1 does not affect the stability of p120RasGAP, suggesting that SSB-1-enhanced MET signaling does not rely on the degradation of p120RasGAP. It is conceivable that the phosphorylated SSB-1 might suppress the catalytic activity of p120RasGAP or simply bind to p120RasGAP to prevent p120RasGAP interaction with Ras. In the presence of SSB-1, activation of the Ras pathway by HGF-MET signaling might be sustained, which therefore promotes downstream gene expressions. Whether this is the underlying mechanism for SSB-1 enhancing MET signaling remains to be further defined.
Finally, our results provide further evidence that the SOCS box-containing protein family possesses diverse biochemical and cellular functions. It has been speculated that all SOCS box-containing proteins function as substrate recognition components of E3 complexes (14). This hypothesis is based on the observation that members of many different SOCS box-containing protein subfamilies, including SOCS-1, SOCS-3, ASB-1, SSB-1, WSB-2, Rar-1, elongin A, and VHL, can form a complex with elongin B and elongin C (15). For example, VHL-elongin C-elongin B along with Cul-2 and Rbx-1 form a well characterized E3 that targets HIF-1
and HIF-2
for ubiquitination and proteasomal degradation (27, 28). Similarly, SOCS-1 has also been demonstrated to promote VAV and TEL-JAK2 degradation (22). Upon cytokine stimulation, SOCS-3 becomes tyrosine-phosphorylated and inhibits the activation of STAT5. However, tyrosine-phosphorylated SOCS-3 can also block p120RasGAP and therefore sustain Ras activation (18). This indicates that SOCS box-containing proteins even from the same subfamily may, through different molecular mechanisms, regulate different signaling pathways. Moreover, these activities may not necessarily involve E3 pathways. It is possible that even within a subfamily these proteins may function as opponents or competitors in certain signaling pathways despite the possession of very similar amino acid sequences. Although SSB-1 does not promote p120RasGAP degradation as demonstrated in our experiments, this does not rule out the possibility that SSB-1 and other SSB proteins may still mediate ubiquitination and proteasomal degradation of other proteins.
 |
FOOTNOTES
|
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 
|| To whom correspondence should be addressed: Dept. of Urology, University of Rochester Medical Center, 601 Elmwood Ave., Box 656, Rochester, NY 14642. Fax: 585-273-1968; E-mail: Guan_Wu{at}urmc.rochester.edu.
1 The abbreviations used are: HGF, hepatocyte growth factor; SPRY, repeats in splA and RyR; SRE, serum response element; LUC, luciferase; SOCS, suppressor of cytokine signaling; SSB, SPRY domain-containing SOCS box protein; GAP, GTPase-activating protein; E3, ubiquitin-protein isopeptide ligase; EGF, epidermal growth factor; RNAi, RNA interference; GST, glutathione S-transferase; GFP, green fluorescent protein; NC, negative control; Sc, scramble-sequenced; pTyr, phosphotyrosine; SH2, Src homology 2; siRNA, small interfering RNA. 
 |
ACKNOWLEDGMENTS
|
|---|
We thank Matthew DiMaggio for help with preparation of the manuscript.
 |
REFERENCES
|
|---|
- Bottaro, D. P., Rubin, J. S., Faletto, D. L., Chan, A. M., Kmiecik, T. E., Vande Woude, G. F., and Aaronson, S. A. (1991) Science 251, 802-804[Abstract/Free Full Text]
- Stella, M. C., and Comoglio, P. M. (1999) Int. J. Biochem. Cell Biol. 31, 1357-1362[CrossRef][Medline]
[Order article via Infotrieve]
- van der Voort, R., Taher, T. E., Derksen, P. W., Spaargaren, M., van der Neut, R., and Pals, S. T. (2000) Adv. Cancer Res. 79, 39-90[Medline]
[Order article via Infotrieve]
- Herrmann, C., and Nassar, N. (1996) Prog. Biophys. Mol. Biol. 66, 1-41[CrossRef][Medline]
[Order article via Infotrieve]
- Olson, M. F., and Marais, R. (2000) Semin. Immunol. 12, 63-73[CrossRef][Medline]
[Order article via Infotrieve]
- Midgley, R. S., and Kerr, D. J. (2002) Crit. Rev. Oncol. Hematol. 44, 109-120[Medline]
[Order article via Infotrieve]
- Cherfils, J., and Chardin, P. (1999) Trends Biochem. Sci. 24, 306-311[CrossRef][Medline]
[Order article via Infotrieve]
- Katz, M. E., and McCormick, F. (1997) Curr. Opin. Genet. Dev. 7, 75-79[CrossRef][Medline]
[Order article via Infotrieve]
- Wasylyk, B., Hagman, J., and Gutierrez-Hartmann, A. (1998) Trends Biochem. Sci. 23, 213-216[CrossRef][Medline]
[Order article via Infotrieve]
- Vogel, U. S., Dixon, R. A., Schaber, M. D., Diehl, R. E., Marshall, M. S., Scolnick, E. M., Sigal, I. S., and Gibbs, J. B. (1988) Nature 335, 90-93[CrossRef][Medline]
[Order article via Infotrieve]
- Tocque, B., Delumeau, I., Parker, F., Maurier, F., Multon, M. C., and Schweighoffer, F. (1997) Cell. Signal. 9, 153-158[CrossRef][Medline]
[Order article via Infotrieve]
- Trahey, M., Wong, G., Halenbeck, R., Rubinfeld, B., Martin, G. A., Ladner, M., Long, C. M., Crosier, W. J., Watt, K., Koths, K., and McCormick, F. (1998) Science 242, 1697-1700
- Zhang, J. G., Farley, A., Nicholson, S. E., Willson, T. A., Zugaro, L. M., Simpson, R. J., Moritz, R. L., Cary, D., Richardson, R., Hausmann, G., Kile, B. J., Kent, S. B., Alexander, W. S., Metcalf, D., Hilton, D. J., Nicola, N. A., and Baca, M. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 2071-2076[Abstract/Free Full Text]
- Kile, B. T., Schulman, B. A., Alexander, W. S., Nicola, N. A., Martin, H. M. E., and Hilton, D. J. (2002) Trends Biochem. Sci. 27, 235-241[CrossRef][Medline]
[Order article via Infotrieve]
- Kamura, T., Sato, S., Haque, D., Liu, L., Kaelin, W. G., Jr., Conaway, R. C., and Conaway, J. W. (1998) Genes Dev. 12, 3872-3881[Abstract/Free Full Text]
- Wang, D., Li, Z., Messing, E. M., and Wu, G. (2002) J. Biol. Chem. 277, 36216-36222[Abstract/Free Full Text]
- Wang, D., Li, Z., Schoen, S. R., Messing, E. M., and Wu, G. (2004) Biochem. Biophys. Res. Commun. 313, 320-326[Medline]
[Order article via Infotrieve]
- Cacalano, N. A., Sanden, D., and Johnston, J. A. (2001) Nat. Cell Biol. 3, 460-465[CrossRef][Medline]
[Order article via Infotrieve]
- Kashige, N., Carpino, N., and Kobayashi, R. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 2093-2098[Abstract/Free Full Text]
- Nelms, K., Snow, A. L., Hu-Li, J., and Paul, W. E. (1998) Immunity 9, 13-24[CrossRef][Medline]
[Order article via Infotrieve]
- Cohney, S. J., Sanden, D., Cacalano, N. A., Yoshimura, A., Mui, A., Migone, T. S., and Johnston, J. A. (1999) Mol. Cell. Biol. 19, 4980-4988[Abstract/Free Full Text]
- De Sepulveda, P., Ilangumaran, S., and Rottapel, R. (2000) J. Biol. Chem. 275, 14005-14008[Abstract/Free Full Text]
- Frantsve, J., Schwaller, J., Sternberg, D. W., Kutok, J., and Gilliland, D. G. (2001) Mol. Cell. Biol. 21, 3547-3557[Abstract/Free Full Text]
- Ideguchi, H., Ueda, A., Tanaka, M., Yang, J., Tsuji, T., Ohno, S., Hagiwara, E., Aoki, A., and Ishigatsubo, Y. (2002) Biochem. J. 367, 87-95[CrossRef][Medline]
[Order article via Infotrieve]
- Rao, M. A., Cheng, H., Quayle, A. N., Nishitani, H., Nelson, C. C., and Rennie, P. S. (2002) J. Biol. Chem. 277, 48020-48027[Abstract/Free Full Text]
- Mikolajczyk, M, Shi, J., Vaillancourt, R. R., Sachs, N. A., and Nelson, M. (2003) Biochem. Biophys. Res. Commun. 301, 14-18
- Ivan, M., Kondo, K., Yang, H., Kim, W., Valiando, J., Ohh, M., Salic, A., Asara, J. M., Lane, W. S., and Kaelin, W. G., Jr. (2001) Science 292, 464-468[Abstract/Free Full Text]
- Jaakkola, P., Mole, D. R., Tian, Y. M., Wilson, M. I., Gielbert, J., Gaskell, K. J., von Kriegsheim, A., Hebestreit, H. F., Mukherji, M., Schofield, C. J., Maxwell, P. H., Pugh, C. W., and Ratcliffe, P. J. (2001) Science 292, 468-472[Abstract/Free Full Text]

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
C. von Montfort, J. I. Beier, L. Guo, J. P. Kaiser, and G. E. Arteel
Contribution of the sympathetic hormone epinephrine to the sensitizing effect of ethanol on LPS-induced liver damage in mice
Am J Physiol Gastrointest Liver Physiol,
May 1, 2008;
294(5):
G1227 - G1234.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Zhou, R. Miki, M. Eeva, F. M. Fike, D. Seligson, L. Yang, A. Yoshimura, M. A. Teitell, C. A.M. Jamieson, and N. A. Cacalano
Reciprocal Regulation of SOCS 1 and SOCS3 Enhances Resistance to Ionizing Radiation in Glioblastoma Multiforme
Clin. Cancer Res.,
April 15, 2007;
13(8):
2344 - 2353.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Yao, M. S. Liu, S. L. Masters, J.-G. Zhang, J. J. Babon, N. A. Nicola, S. E. Nicholson, and R. S. Norton
Dynamics of the SPRY domain-containing SOCS box protein 2: Flexibility of key functional loops
Protein Sci.,
December 1, 2006;
15(12):
2761 - 2772.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Leibowitz-Amit, G. Tsarfaty, Y. Abargil, G. M. Yerushalmi, J. Horev, and I. Tsarfaty
Mimp, a Mitochondrial Carrier Homologue, Inhibits Met-HGF/SF-Induced Scattering and Tumorigenicity by Altering Met-HGF/SF Signaling Pathways.
Cancer Res.,
September 1, 2006;
66(17):
8687 - 8697.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Xing, R. Gosden, P. Lasko, and H. Clarke
Murine homologues of the Drosophila gustavus gene are expressed in ovarian granulosa cells.
Reproduction,
May 1, 2006;
131(5):
905 - 915.
[Abstract]
[Full Text]
[PDF]
|
 |
|