Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M412334200 on February 21, 2005

J. Biol. Chem., Vol. 280, Issue 17, 16651-16658, April 29, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/17/16651    most recent
M412334200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Phelps, M.
Right arrow Articles by Blaydes, J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Phelps, M.
Right arrow Articles by Blaydes, J. P.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

MEK-ERK Signaling Controls Hdm2 Oncoprotein Expression by Regulating hdm2 mRNA Export to the Cytoplasm*

Monika Phelps, Anna Phillips, Matthew Darley, and Jeremy P. Blaydes{ddagger}

From the Cancer Sciences Division, School of Medicine, University of Southampton, MP 824, Southampton General Hospital, Southampton SO16 6YD, United Kingdom

Received for publication, November 1, 2004 , and in revised form, February 16, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The physical and functional interaction between the transcription factor p53 and its negative regulatory partner protein Hdm2 (Mdm2 in mouse) is a key point of convergence of multiple signaling pathways that regulates cell proliferation and survival. hdm2 mRNA transcription is induced by p53, forming the basis of an auto-regulatory feedback loop. Growth and survival factor-activated Ras-Raf-MEK-ERK signaling can also regulate Hdm2 expression independently of p53, contributing to the pro-survival effect of these factors. In murine fibroblasts, this occurs through the regulation of mdm2 mRNA transcription. Here we show that, in human breast cancer epithelial cells, MEK-dependent regulation of Hdm2 expression also occurs at a post-transcriptional level. Pharmacological blockade of MEK activity in T47D cells inhibits Hdm2 protein synthesis by 80–90%. This occurs in the absence of changes in the expression of the major hdm2-P1 mRNA transcript and only an ~40% reduction in hdm2-P2 transcript levels. The amounts of both transcripts that are associated with polyribosomes and are, hence, being actively translated are reduced by >80% by the MEK inhibitor, U0126. We show here that this is due to the inhibition of hdm2 mRNA export from the nucleus when MEK activity is inhibited. In MCF-7 breast cancer cells that express wild-type p53, Hdm2 is required to suppress p53-dependent transcription when MEK kinase is active. Regulation of the nuclear export of hdm2 mRNA provides, therefore, a mechanism whereby mitogen-stimulated cells avoid p53-dependent cell cycle arrest or apoptosis by maintaining the dynamic equilibrium of the Hdm2-p53 feedback loop.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The tumor suppressor p53 and oncoprotein Hdm2 function within an auto-regulatory feedback loop that is a point of convergence of signaling pathways that regulate cellular proliferation and survival (1). p53 primarily functions as an activating transcription factor, and key p53 target genes include the cyclin-dependent kinase inhibitor WAF1 (2), PUMA, which encodes a BH3 domain-containing pro-apoptotic molecule (3, 4), and hdm2 (5). Cellular p53 activity is inhibited in proliferating cells and is activated under situations such as cellular stress as part of a growth arrest or apoptosis response. Hdm2 functions principally as the primary negative regulator of p53 function (6), and its correct expression and function can be essential for the prevention of spontaneous p53-dependent apoptosis or cell cycle arrest (7–11). Mechanisms whereby Hdm2 down-regulates p53 function include concealing its activation domain from the transcriptional machinery (12) and targeting it for ubiquitination, nuclear export, and proteasomal degradation (13).

Stress-induced activation of p53 almost invariably involves post-translational modifications to both p53 and Hdm2, which can inhibit Hdm2 function (14) or the Hdm2-p53 interaction (15–17). Proliferative and pro-survival signaling pathways can also impinge upon p53 through either the positive or negative regulation of Hdm2 function. v-akt murine thymoma viral oncogene homologue kinase, a key enzyme in pro-survival signaling pathways, phosphorylates Hdm2, which results in elevated Hdm2 levels in the nucleus (18–20). The growth factor-induced Ras-Raf-MEK1-ERK signaling pathway can have context dependent effects on proliferation and survival (21), and its regulation of the p53-Hdm2 axis appears to be similarly complex. Signaling via this cascade can induce the expression of p14ARF, an Hdm2 antagonist, resulting in p53 activation. This can be an important block to cancer progression, and p14ARF expression is lost in many tumors (22, 23). In contrast, induction of Hdm2 expression by the Ras-Raf-MEK-ERK can play an important role in the proliferative and pro-survival response to growth factors (24, 25). Indeed, this increased expression of Hdm2 may dampen the p53 response to activating signals such as genotoxic cancer therapies, particularly in tumor cells in which p14ARF expression is lost (24, 25). Conversely, transgenic mutations that result in as little as a 20% loss of Mdm2 expression in adult mice result in increased sensitivity to radiation (26).

Hdm2 is normally present at very low levels in cells, as the protein directs its own auto-ubiquitination and is rapidly degraded (27). Elevation of Hdm2 expression occurs at varying frequencies in diverse tumor types (28). In a proportion of cancers, this is a consequence of hdm2 gene amplification (29), although in many cases, alternative mechanisms must underlie the increase (28). hdm2 expression is regulated by transcription from two promoters, P1 and P2 (5). Transcription from P1 is considered to be constitutive in most cells (30), whereas P2-promoter activity is highly induced by p53 (5). The murine mdm2 P2-promoter is also induced by Ras-Raf-MEK-ERK signaling (25). Both hdm2 transcripts include the full-length coding sequence, but the P1 transcript contains a long 5'-untranslated region with two upstream open reading frames and is poorly translated (31). In addition to mRNA transcription, Hdm2 protein levels can also be controlled by mRNA translation (31, 32) as well as protein turnover (33). Hdm2 expression is elevated in as many as 50% of breast carcinomas (34–36), and we have provided evidence for a role for p53-independent transcription from the P2-promoter in this increased expression (37). In this present study we have investigated the role of Ras-Raf-MEK-ERK signaling in controlling the levels of Hdm2 protein in breast cancer cells and demonstrate a key role for this pathway in regulating the export of hdm2 mRNA to the cytoplasm.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Culture of Human Breast Cancer Cell Lines—MCF-7 and T47D breast cancer cell lines were cultured in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal calf serum (Autogen Bioclear) as described previously (37). The following reagents were dissolved in dimethyl sulfoxide (Me2SO) at the indicated concentrations before adding to the medium where stated; 10 mM U0126 (Promega), 20 mM PD98059 (Promega), 10 mM MG132 (Sigma). Cycloheximide (Sigma) and 5-fluorouracil (5-FU) (David Bull Laboratories) were in aqueous solutions. Nutlin-3 (Alexis Biochemicals) was dissolved in ethanol at 5 mM.

Protein Analysis—Cells were washed with phosphate-buffered saline, pelleted by centrifugation at 1000 x g, snap-frozen, and stored at –80 °C. For immunoblotting, pellets were lysed for 15 min at 4 °C in denaturing urea buffer (7 M urea, 0.1 M dithiothreitol, 0.05% Triton X-100, 25 mM NaCl, 20 mM HEPES pH 7.6) then clarified by centrifugation at 13,000 x g for 10 min. Protein concentration was determined by the method of Bradford (Bio-Rad). Immunoblotting was performed by standard procedures, as described previously (38), and membranes were probed for Hdm2 (monoclonal antibody 2A9 (39)), p53 (DO-1, Serotec), phospho-Thr-202/Tyr-204 ERK1 and ERK2 (E10), total ERK1 and ERK2 (both from Cell Signaling Technology), or p21WAF-1 (Clone SX118, Pharmingen). Equal protein loading was confirmed on all immunoblots using rabbit anti-{beta} actin antibody (Sigma). Bands were visualized by chemiluminescence (Supersignal, Pierce) using a Fluor-S MAX system (Bio-Rad) and quantified using Quantity One software (Bio-Rad).

For labeling of newly synthesized proteins, cells were washed twice with labeling medium (RPMI medium without methionine, cysteine, or L-glutamine (Sigma) supplemented with dialyzed and heat-inactivated fetal calf serum) then incubated with labeling medium for 30 min before the addition of fresh labeling medium containing 0.25 mCi/ml Pro-mix L-[35S] (Amersham Biosciences) and incubation at 37 °C for 90 min. Cells were then processed as for protein analysis. After the gel was stained using Coomassie Blue, it was dried and exposed to a phosphor image plate for 5 h. Bands were visualized using a Personal Molecular Imager FX (Bio-Rad).

RNA Analysis—RNA extraction from cell pellets and cell fractions was performed using either RNABee (Biogenesis Inc.) or RNAeasy (Qiagen). Ribonuclease protection assay (RPA) for hdm2 was performed as previously described (37). For Taqman quantitative polymerase chain reaction (qPCR) analysis of hdm2 transcripts, 0.5–1 µg of RNA was used to generate cDNA using Superscript II RNase H– reverse transcriptase (Invitrogen) and oligo(dT) primers in a 20-µl volume. Oligonucleotide primer pairs and probes were designed using Primer Express, Version 2.0 (PerkinElmer Life Sciences) and were synthesized by MWG Biotech. Each primer sequence lies within a different exon, and the fluorogenic probe spans the junction between the two exons. hdm2 coding sequence primers amplify a region around the exon 9–10 boundary. Primers and probe for gapdh, which was used as an endogenous control gene, were purchased as a Pre-Developed TaqMan® reagent assay (PerkinElmer Life Sciences). Analysis was performed using the ABI PRISM 7900HT sequence detection system instrument and software (PerkinElmer Life Sciences). qPCR was performed in 20-µl reaction volumes containing 1x qPCRTM; Mastermix (Eurogentec), cDNA (from 5 ng of RNA), and one of the following sets of primers and probes: hdm2-coding sequence F (TCTACAGGGACGCCATCGA) and hdm2-coding sequence R (CTGATCCAACCAATCACCTGAA) (300 nM each) and hdm2-coding sequence probe (FAM-TTCACTTACACCAGCATCAAGATCCGGA-TAMRA) (FAM and TAMRA are trademarks of Applera Corp., Norwalk, CT) (100 nM); hdm2-P1-F (GACTCCAAGCGCGAAAACC) and hdm2-P1-R (CCATCAGTAGGTACAGACATGTTGGT) primers (900 nM each) and hdm2-P1 probe (FAM-TGCACATTTGCCTGCTCCTCACCAT-TAMRA) (200 nM); hdm2-P2-F (CGGACGCACGCCACTT) and hdm2-P2-R (CAGTAGGTACAGACATGTTGGTATTGC) primers (900 nM each) and hdm2-P2 probe (FAM-TTCTCTGCTGATCCAGGCAAATG-TAMRA) (200 nM). Threshold cycle values were converted to relative transcript levels using a standard curve. Semiquantitative reverse transcription-PCR was performed as described previously (37); primers used were gapdh reverse transcription oligo(dT) forward, GAAGGTGAAGGTCGGAGT, and reverse, GAAGATGGTGATGGGATTTC; scRNA hY4 reverse transcription AAAAAGCCAGTCAAATTTAGCA, forward, GGTCCGATGGTAGTGGGTTA, and reverse, AAAGCCAGTCAAATTTAGCAGT.

Cellular fractionation before RNA extraction or polyribosome analysis was performed using hypotonic lysis (40). Cells were washed twice with serum-free medium, then scraped in serum-free medium and pelleted by centrifugation at 365 x g. Pellets were resuspended in hypotonic lysis buffer B (10 mM Tris-HCl, pH 7.6, 1 mM CH3COOK, 1.5 mM CH3COOMg, 2 mM dithiothreitol, 1 unit/µl RNase inhibitor), and cells were lysed on ice using a Dounce homogenizer. Lysates were centrifuged at 12,000 x g to separate the cytoplasmic extract from the nuclear pellet. For some extractions, the lysis buffer was modified where indicated (B1, B2, B3).

For analysis of polyribosome associated mRNA (40), cycloheximide (10 µg/ml) was added to the serum-free medium used to wash the dishes. Cytoplasmic lysates were then layered over a cushion of 30% (w/v) sucrose in buffer B and centrifuged at 130,000 x g for 2.5 h at 4 °C. After removing the supernatant, the remaining polyribosome-bound RNA pellet was rinsed twice in buffer B before RNA extraction. For fractionation over a sucrose gradient, 1200 µl of cytoplasmic lysate containing 700 µg of protein was layered over a 3.6-ml sucrose gradient (15–55% in buffer B containing 150 µg/ml cycloheximide). This was centrifuged at 130,000 x g for 2.5 h at 4 °C, and 12 x 400-µl fractions were removed for analysis.

For in situ hybridization a 202-base pair region of the hdm2 coding sequence (within exons 7–9) was generated using GGTGGGAGTGATCAAAAGGA and CCAGGCTTTCATCAAAGGAA primers and cloned into pGEMTeasy plasmid (Promega). Sense and antisense digoxigenin-labeled RNA probes were generated using a digoxigenin RNA-labeling kit (Roche Diagnostics). Cells growing on glass coverslips were fixed for 20 min at room temperature with 4% paraformaldehyde in phosphate-buffered saline and dehydrated in ethanol before storage at –70 °C, desiccated. After rehydration, in situ hybridization was performed essentially as described previously (41). Bound probe was detected using anti-digoxigenin-rhodamine, Fab fragments (Roche Diagnostics), and cell nuclei were stained with 4',6-diamidine-2'phenylindole dihydrochloride (Roche Diagnostics).

Plasmids, Transfections, and Reporter Gene Assays—The hdm2luc03 reporter vector (37) contains 165 bp of the hdm2-P2 promoter region, including two p53-responsive elements, in pGL3Basic (Promega). SuperTIP, which encodes an inhibitor of the p53-Hdm2 interaction, and the inactive control MutantTIP have been described previously (11). pC53SCX3, which encodes Ala-143 mutant p53, was a gift of Professor Bert Vogelstein. T47D and MCF-7 cells were transfected using Lipofectamine 2000 reagent (Invitrogen), and reporter assays were performed using a Dual-GloTM luciferase assay (Promega) on cells transfected in 96-well plates, with normalization to Renilla luciferase expressed from pRLSV40 (Promega). The normalized data is presented as relative luciferase units. For transfection of siRNA, reagents were obtained from Qiagen. Cells in 60-mm dishes were transfected with 5.5 µg of either control (non-silencing) siRNA or validated siRNA for Hs-mdm2 (hdm2). Transfection was for 24 h, and the cells were lysed a further 24 h later.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Pharmacological Inhibition of MEK Activity Suppresses Hdm2 Protein Synthesis in T47D Breast Cancer Cells—Compared with a panel of breast cancer cell lines, estrogen receptor-{alpha} positive (ER{alpha}+ve) lines such as T47D and MCF-7 express relatively high levels of Hdm2 protein (37). T47D cells express only a transcriptionally inactive mutant p53 protein, and therefore, this cell line provides a useful model for the study of p53-independent mechanisms that regulate the expression of Hdm2. Findings made in this simple model can then be extrapolated into the more complex situation present in cell lines such as MCF-7, which are more representative of the majority of ER{alpha}+ve breast cancers, in which changes in Hdm2 expression and p53 activity are dampened by a negative feedback loop (42). We determined the effect of pharmacological inhibition of MEK activity on the levels of Hdm2 protein in proliferating T47D cells. Consistent with studies in other cell types (24, 25), 24 h exposure to 25 µM U0126 or 50 µM PD98059, two specific and structurally unrelated inhibitors of MEK activity (43), reduced Hdm2 levels by up to 95% (Fig. 1A). Loss of the phosphorylated form of ERK1 and ERK2 confirmed that MEK was effectively inhibited by 25 µM U0126 in these cells (Fig. 1B). Removal of U0126 and the addition of fresh medium led to the recovery of Hdm2 to greater than pretreatment levels within 2–3 h (Fig. 1C). This recovery did not occur if U0126 was included in the medium (data not shown).



View larger version (39K):
[in this window]
[in a new window]
  		FIG. 1.
MEK kinase activity is required for Hdm2 protein expression in T47D breast cancer cells. A, T47D cells were cultured in the presence of Me2SO control (D, 7 h) or MEK inhibitors PD98059 (50 µM) or U0126 (25 µM) for the indicated time before Hdm2 proteins levels were determined by Western blotting using 2A9 antibody (a second Hdm2 antibody, 2A10, gave similar results (data not shown)). For quantification, Hdm2 levels were normalized to the {beta} actin loading control (open bars, Me2SO; gray bars, PD98059; black bars, U0126). B, T47D cells were incubated with Me2SO or 25 µM U0126 for 18 h before expression of the indicated proteins was determined. p-, phosphorylated. C, cells were incubated as in Fig. 1B, then refed with drug-free medium and incubated for a further 0–5 h before lysis and Western blotting analysis.

 
Hdm2 protein is rapidly turned over in most cells. The reduction in Hdm2 protein levels in U0126-treated T47D cells is not due to a further increase in the rate of Hdm2 protein turnover, as assayed by the rates at which Hdm2 protein levels decrease after the inhibition of protein synthesis by cycloheximide (Fig. 2A). 12 h of exposure to 25 µM U0126 reduced Hdm2 protein levels by 70%; however, the half-life of Hdm2 was ~15 min in both control- and U0126-treated cells. We then investigated whether U0126 affects Hdm2 protein synthesis by determining the rate at which Hdm2 protein accumulates when its primary degradation pathway is blocked by a proteasome inhibitor MG132 (this method was used in preference to conventional metabolic labeling studies due to the extremely short half-life of Hdm2 and our concern that radiolabeling, like other inducers of DNA damage (44), would induce post-translational modifications of Hdm2 that could affect its activity and hence turnover). The results shown in Fig. 2B clearly demonstrate that the rate of Hdm2 synthesis is reduced by ~85% when MEK activity is inhibited by U0126. Global synthesis of new proteins was not inhibited by U0126 in these cells (Fig. 2C).



View larger version (57K):
[in this window]
[in a new window]
  		FIG. 2.
MEK inhibitors block Hdm2 protein synthesis. A, T47D cells were cultured with Me2SO carrier or 25 µM U0126 for 12 h before 100 µg/ml cycloheximide (CHX) was added to the medium to block new protein synthesis. Normalized Hdm2 protein levels are shown in the bar graph. The line graph shows the percentage of Hdm2 levels in either Me2SO (DMSO)- or U0126-treated cells relative to levels before the addition of cycloheximide. Black graphics, Me2SO-treated; gray graphics, U0126-treated. Representative of three independent experiments are shown. B, T47D cells were cultured with Me2SO or 25 µM U0126 for 18 h before 50 µM MG132 was added to the medium to block proteasome-mediated degradation of Hdm2. Cells were cultured for a further 0–90 min, then lysed and analyzed by quantitative Western blotting. Normalized Hdm2 protein levels are shown in the bar graph as in A. Lines show linear regression of these data over the first 60 min after MG132 addition. The rate of Hdm2 protein accumulation over this period in U0126-treated cells was 13.6% of controls. Representative of two independent experiments is shown. C, T47D cells were exposed to 25 µM U0126 (U) or Me2SO (D) for 24 h before being labeled with [35S]methionine/cysteine for 90 min in the presence of the same treatment. Equal protein amounts were run on SDS-PAGE gels that were then analyzed by Coomassie blue staining for total protein and autoradiography for newly synthesized protein. Similar results were obtained with a 30-min labeling period (not shown). Cells treated identically in parallel were analyzed by Western blotting for Hdm2.

 
The Effects of Inhibiting MEK Activity on hdm2 mRNA Expression Levels—In the murine mdm2 gene the activity of the P2-promoter is inducible by Ras-Raf-MEK-ERK signaling (25). We, therefore, determined the effects of U0126 on the levels of endogenous hdm2 P1- and P2-transcript mRNA using two independent techniques, RPA (Fig. 3A) and qPCR on cDNA generated from polyadenylated mRNA (Fig. 3B). Both RPA and qPCR clearly show that the levels of the predominant P1 transcript is not affected by U0126 treatment, and consistent with this, no U0126-induced changes were detected when qPCR analysis was directed toward a region within the hdm2 coding sequence. RPA did not detect any large changes in hdm2-P2 mRNA levels after U0126 treatment (Fig 3Ai). However, quantitative analysis of multiple independent experiments (Fig. 3Aii) identified a small, but significant difference in P2 transcript levels between Me2SO- and U0126-treated cells (100 ± 24.2% compared with 70.6 ± 15.8%, p < 0.05). This effect could be more reliably detected by the more sensitive qPCR assay, which showed a decrease in the levels of the P2 transcript by 41.1 ± 7.0% (n = 5) after U0126 treatment (Fig. 3B). We had previously been unable to detect this relatively small change using semiquantitative assays (37). The decrease is unlikely to be sufficient to account for the 95% reduction in Hdm2 protein levels that are observed in U0126-treated cells, as siRNA-mediated knock-down of the hdm2-P2 transcript by approximately the same amount as occurs with U0126 treatment results in only a 45% reduction in Hdm2 protein levels (Fig. 3C).



View larger version (47K):
[in this window]
[in a new window]
  		FIG. 3.
Effects of inhibiting MEK activity on hdm2 mRNA levels. A, total cellular RNA was analyzed by RPA using an hdm2 exon 2-exon 3 probe, with a gapdh probe as a loading control. Ai shows a representative experiment. Lanes are: 1, non-digested probe; 2, digested probe; m, size markers; 5 and 6, mRNA from T47D cells that had been treated for 24 h with Me2SO (DMSO) or 25 µM U0126 respectively. Aii shows quantitation of RPA analysis of four independently treated sets of cells. Open bars, Me2SO controls; black bars, U0126-treated. Data are normalized to gapdh mRNA levels and are expressed as mean ± S.E. B, total cellular RNA from T47D cells was analyzed by qPCR. hdm2 mRNA levels were normalized to gapdh housekeeping gene expression, and normalized hdm2 mRNA levels in U0126-treated (25 µM, 24 h) cells are expressed as a percentage of levels in Me2SO-treated cells. Data are the mean ± S.E. for five independently treated sets of samples. Western blots confirmed that Hdm2 protein levels decreased in cells treated in parallel to the experiments shown in A and B (not shown). C, T47D cells were transfected with control, non-silencing siRNA (lanes C), or hdm2 specific siRNA (lanes h). 48 h after transfection cells were analyzed for levels of Hdm2 protein (open bars and Western blot) and hdm2 mRNA (solid bars). The hdm-P2 transcript levels are shown; however, the hdm2-specific siRNA targets both P1 and P2 transcripts.

 
MEK Inhibitors Reduce Hdm2 Levels by Regulating the Export of hdm2 mRNA to the Cytoplasm—The data described above suggest that inhibition of MEK activity can affect Hdm2 protein synthesis at a post-transcriptional level. We, therefore, set out to establish whether this might occur at the level of mRNA trafficking or translation. T47D cells were incubated with either U0126 or Me2SO control and then subjected to a gentle hypotonic lysis to generate cytoplasmic extracts suitable for the subsequent analysis of polyribosomes. Initially, qPCR was performed on these extracts to determine levels of hdm2 mRNA transcripts (Fig. 4A). This analysis showed that, after U0126 treatment, both hdm2 mRNA transcripts are significantly under-represented in these cytoplasmic extracts compared with their levels in total mRNA. Specifically, although total cellular levels of the hdm2 P1 transcript were unaffected by U0126, levels in the cytoplasmic fraction were decreased by 64.2%. Likewise, although U0126 decreased overall hdm2-P2 expression by ~40% as before, the levels of this transcript were further under-represented in the cytoplasmic lysates, being reduced by 71.3% compared with mock-treated controls. These results suggest that U0126 treatment regulates the export of hdm2 mRNA from the nucleus to the cytoplasm. We undertook two further experiments to substantiate these findings.



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 4.
Inhibition of MEK reduces levels of hdm2 mRNA transcripts in the cytoplasm. T47D cells were cultured for 24 h with either Me2SO (DMSO) carrier or 25 µM U0126. A, RNA was extracted from either whole cell pellets, or cytoplasmic lysates were prepared using hypotonic buffer B, and levels of hdm2-P1 and -P2 transcripts were determined by qPCR. Data are normalized to gapdh. Open bars, Me2SO-treated; solid bars, U0126-treated. Error bars are S.D. of duplicate qPCR assays. B, cells were extracted using either buffer B or buffer B with the following modifications: B1 (B + 100 mM NaCl), B2 (B + 0.5% IGEPAL CA-630), B3 (B + 100 mM NaCl + 0.5% IGEPAL CA-630). Hdm2 transcript levels in the soluble cytoplasmic extract (S) or the insoluble nuclear pellet (P) as well as in total cell extracts (T) were determined by qPCR. Data are presented as in A. Cellular fractionation was validated using semiquantitative PCR for scRNA hY4, and gapdh. Two PCRs for each extraction method are shown, with a 2-fold difference in the amount of input cDNA to confirm the PCRs have not plateaued. C, hdm2 mRNA was detected by in situ hybridization using antisense hdm2 probe. The control, sense probe is also shown. Dotted white lines outline the position of the cell nuclei.

 
First, a more extensive fractionation analysis was performed (Fig. 4B). Cell lysis was performed with the same hypotonic lysis buffer B as used in the experiment shown in Fig. 4A, and U0126 again resulted in a marked under-representation of both hdm2 transcripts in the soluble cytoplasmic extract (S) compared with total cell lysates (T). A corresponding increase in hdm2 transcript levels was seen in the nuclear pellets (P) after U0126 exposure. Semiquantitative PCR detection of the small cytoplasmic RNA scRNA hY4 (45) confirmed that the cell lysis technique efficiently separated cytoplasmic RNA from the nuclear pellet, whereas gapdh mRNA was present in both fractions. After U0126 treatment, hdm2 mRNA clearly becomes associated with the insoluble pellet. The hypotonic lysis buffer was, therefore, modified to gain insight into the nature of this association. Solubilization of lipid membranes with 0.5% IGEPAL CA-630 (B2) was unable to reverse the U0126-dependent association of hdm2 mRNA with the pellet. However, the addition of 100 mM NaCl to the buffer (B1 and B3) was sufficient to release this hdm2 from the nuclear pellet, this being most apparent in the presence of detergent (compare buffers B2 with B3).

In situ hybridization experiments were then performed to detect hdm2 mRNA (Fig. 4C). In mock-treated control cells, hdm2 mRNA is detectable in the cytoplasm of the cell using antisense hdm2 RNA probe, but not the control, sense probe. However, in U0126-treated cells, cytoplasmic hdm2 message can no longer be detected. We were unable to detect nuclear hdm2 mRNA in these assays, possibly due to poor access of the probe to the target message in the nuclei.

The Effects of MEK Inhibition on Translation of hdm2 mRNA—We next wished to establish whether this reduction in the levels of cytoplasmic hdm2 mRNA was reflected in an equivalent reduction in rates of hdm2 translation, as assessed by the association of hdm2 mRNA with high molecular weight polyribosome complexes. Cytoplasmic cell extracts were separated through 30% sucrose buffer to isolate polyribosome-bound from free cytoplasmic mRNA (40), and mRNA from total cell extracts and the polyribosome-associated pellet was then assayed by qPCR (Fig. 5A). After U0126 treatment, levels of hdm2-P1 transcript in the polyribosome-associated fraction were reduced by 75.6%, and the hdm2-P2 transcript by 83.7% compared with mock-treated cells. This degree of reduction in actively translated hdm2 mRNA transcripts is in good agreement with the 85% reduction in the rate of Hdm2 protein synthesis shown in Fig. 2B. The effect of U0126 on the amount of polyribosome-associated hdm2 mRNA is largely accounted for by the decrease in levels of cytoplasmic message (Fig. 4A), although the effect on polyribosome association is slightly greater than that on subcellular localization, suggesting that a small degree of regulation at the level of translation might also occur.



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 5.
Effect of MEK inhibitors on the levels of polyribosome-associated hdm2 mRNA. T47D cells were incubated with either 25 µM U0126, or Me2SO (DMSO) carrier for 24 h. A, polyribosome-associated RNA was then isolated by lysis in buffer B followed by centrifugation of the cytoplasmic lysate through 30% sucrose buffer. qPCR analysis of hdm2 transcript levels was performed on total cell (solid bars) and polyribosome-associated (open bars) RNA. Data are presented as a percentage of levels in Me2SO-treated cells and are the mean ± S.D. for two independent experiments. Hdm2 protein levels were analyzed in parallel and were reduced by ~90% in U0126-treated cells (data not shown). B, cytoplasmic extracts (from the experiment shown in Fig. 4A) containing equal amounts of protein were separated on a 15–55% sucrose gradient. 12 consecutive fractions were taken from the gradient. 12.5% of the RNA from each fraction was used to synthesize cDNA, which was then analyzed by qPCR. Upper panel, relative protein concentration (Bradford assay); second panel, agarose gel electrophoresis to detect the major ribosomal RNAs; lower panels, levels of the indicated mRNA transcripts in each fraction. The y axis is the same for both Me2SO- and U0126-treated cells.

 
A more detailed analysis of polyribosome association was then performed using sucrose density gradient ultracentrifugation (Fig. 5B). This analysis did not detect any obvious shift in the hdm2 message from high to low molecular weight fractions after U0126 exposure, indicating that U0126 does not inhibit the association of cytoplasmic hdm2 mRNA with ribosomes in these cells. Rather, there is a reduced level of hdm2 transcripts in all fractions in the gradient due primarily to the effect of U0126 on cytoplasmic localization of the message (Fig. 4A). MEK kinase signaling is known to regulate protein translation (46), possibly accounting for the apparent shift in the gapdh transcript on the profile after U0126 treatment.

Regulation of the p53-Hdm2 Auto-regulatory Feedback Loop by MEK Signaling in Wild-type p53-expressing MCF-7 Breast Cancer Cells—Inhibiting signaling through the Ras-Raf-MEK-ERK signaling cascade has previously been shown to have diverse effects in the p53 stress response pathway, (25, 47–49) and we, therefore, sought to establish the role that control of Hdm2 levels by this pathway has in regulating the p53 response in breast cancer cell lines. First, we determined that 24-h exposure to 25 µM U0126 also reduces Hdm2 protein levels by >75% in the wild-type p53-expressing cell line, MCF-7 (Fig. 6A). U0126 also prevented the induction of Hdm2 protein expression by the p53-activating chemotherapeutic agent, 5-FU (Fig. 6B). Interestingly, however, this inhibition did not result in increased levels of p53 protein (Fig. 6B) nor was there any clear synergistic effect on long term clonogenic survival of co-treatment with 5-FU and U0126 (Fig. 6C), which might have indicated that inhibition of Hdm2 expression by U0126 led to a hyper-activation of the p53 response to genotoxic stress. In fact, we found that U0126 actually attenuated the activation of p53-dependent transcription by 5-FU in MCF-7 cells (Fig. 6D). This inhibition of p53 activity was completely independent of functional Hdm2 protein, as demonstrated by two experiments; first, transcription from a p53-dependent reporter vector (Fig. 7A) and an endogenous p53-induced transcript, hdm2-P2 mRNA (Fig. 7B), was inhibited by U0126 in cells in which p53 had been activated by a rationally designed inhibitor of the Hdm2-p53 interaction, SuperTIP (11); second, the up-regulation of the p53-induced protein, p21WAF-1, by a chemical inhibitor of the Hdm2-p53 interaction, Nutlin-3 (50), was inhibited by U0126, the Nutlin-3 induced increase in Hdm2 protein levels also being partially attenuated. The stabilization of p53 protein by Nutlin-3 was not inhibited by U0126, suggesting that the effects of U1026 on p53 function occur at the post-translational level. Consequently, signaling through MEK kinase impinges on the p53-Hdm2 axis via at least three independent pathways in these cells (Fig. 8).



View larger version (88K):
[in this window]
[in a new window]
  		FIG. 6.
Effect of inhibiting MEK activity on the p53-Hdm2 feedback loop in wild-type p53-expressing breast cancer cells. A, Hdm2 expression in MCF-7 cells after incubation with 25 µM U0126 or Me2SO (DMSO) for the indicated times. B and C, 1.5 x 106 MCF-7 cells were plated per 90-mm dish and 48 h later were re-fed with medium containing 25 µM U0126 or Me2SO. After a further 24 h 200 µM 5-FU was added where indicated, all dishes were incubated for a further 4 h (B) before cell pellets were made for Western blotting analysis or 6 h (C) before plates were trypsinized, and 2 x 104 cells were plated in a new dish and cultured for a further 14 days before cells were fixed and stained with Giemsa. D, MCF-7 cells were transfected with a minimal p53-responsive reporter construct (hdm2luc03) and refed with medium containing 25 µM U0126 (solid bars) or Me2SO carrier (open bars) plus the indicated concentration of 5-FU. Reporter gene activity was assayed 40 h later. Results are the mean ± S.D. of duplicate dishes and are representative of two independent experiments.

 



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 7.
Inhibition of MEK kinase in MCF-7 cells inhibits p53-dependent transcription independently of Hdm2 protein function. A, MCF-7 cells were transfected with hdm2luc03 or pGL3basic reporter plasmids plus plasmids encoding either SuperTIP (S-TIP, an inhibitor of the Hdm2/p53 interaction), the inactive control vector, MutantTIP (M-TIP), or dominant negative (Ala-143) mutant p53. After transfection cells were incubated for 48 h in the presence of 25 µM U0126 (solid bars) or Me2SO control (open bars) before reporter activity was assayed. Data are the mean ± S.D. for duplicate dishes. Results are representative of greater than three separate experiments. RLU, relative luciferase units B, MCF-7 cells were transfected with either SuperTIP or MutantTIP plasmids and then cultured for 24 h in the presence of 25 µM U0126 (solid bars) or Me2SO (open bars) for 24 h. qPCR was performed for the p53-responsive hdm2-P2 transcript, levels of which are normalized to gapdh control. Data are the mean of duplicate assays. C, MCF-7 cells were cultured in the presence of vehicle control (Me2SO) or U0126 (25 µM) for 24 h before Nutlin-3 (5 µM) or vehicle control (ethanol) was added to the media, and the cells were harvested after the indicated times. Hdm2, p53, and p21 protein levels were determined by Western blotting.

 



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 8.
MEK signaling maintains the p53-Hdm2 feedback loop in a state of dynamic equilibrium in cancer cells. The three distinct points of regulation described in this manuscript are as follows. 1) MEK activity promotes the Hdm2-independent activation of p53 as a sequence-specific transcriptional activator of genes that promote cell cycle arrest and apoptosis. This activation is counteracted by a MEK-dependent increase in both the 2) transcription and 3) nuclear export of hdm2 mRNA, which together prevent spontaneous p53-dependent growth arrest or apoptosis occurring in cancer cells following activation of the growth factor-Ras-Raf-MEK signaling cascade. Note that this diagram does not include the MEK-dependent activation of the Hdm2 antagonist, p14ARF, which is not expressed in MCF-7 breast cancer cells (67).

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Regulation of Hdm2 expression and function is a key component of several growth factor-activated pro-survival and proliferative signaling pathways. Increased stability and nuclear localization of Hdm2 protein after its phosphorylation by v-akt murine thymoma viral oncogene homologue kinase is an important component of the anti-apoptotic response to survival factors (18–20). Growth factor stimulation also induces Hdm2/Mdm2 expression (24, 51) in a MEK kinase-dependent manner (25, 52). Mosner and Deppert (51) demonstrated that Mdm2 protein expression is induced in serumre-stimulated fibroblasts without a detectable increase in total mdm2 mRNA by Northern blotting (51), suggesting that mdm2 may be regulated at the post-transcriptional level under these circumstances. However, mdm2 was identified as an early response gene induced by platelet-derived growth factor receptor-{beta} signaling in murine fibroblasts (53), and AP1 and ETS factor binding sites were identified in the murine mdm2-P2 promoter that regulate its activity in response to Ras signaling (25). Therefore, the findings of Mosner and Deppert (51) could be explained by induction of the efficiently translated mdm2-P2 transcript, which would have been masked on Northern blots by the more highly expressed constitutive P1-derived message.

Inhibiting Ras signaling or MEK activity has also been shown to down-regulate Hdm2 protein expression in human cells (25, 47). However, although the activity of murine hdm2-P2 reporter vector in human colon carcinoma cells is inhibited by MEK inhibitors, the effects of these interventions on the endogenous human hdm2 transcripts or the human P2-promoter have not been demonstrated previously. In proliferating MCF-7 and T47D breast cancer cell lines, a conserved AP1-ETS element in the hdm2-P2 promoter is required for the p53-independent expression of the P2-transcript that occurs in these cells (37). As we show in this current paper, however, the activity of the hdm2-P2 promoter in T47D cells is only partially dependent on MEK kinase activity. This is in marked contrast to the Hdm2 protein synthesis in these cells, which is reduced by up to 95% after exposure to MEK inhibitors. Further biochemical and histochemical analysis demonstrated that MEK inhibition results in greatly reduced export of both hdm2-P1 and -P2 transcripts from the nucleus to the cytoplasm.

Regulation of the nuclear export of mRNA is a key point of control for the expression of a number of cellular proteins and is one of the most elaborate nuclear transport pathways (54). All nuclear mRNAs exist in relatively large complexes with proteins, and it is these complexes which interact with components of the nuclear export pathways that are responsible for transporting the mRNA from the site of transcription to the cytoplasm. Assembly of these mRNA-protein complexes begins during mRNA processing, and the complexes include cap-binding proteins, splicing factors, and other proteins involved in pre-mRNA processing. During mRNA processing, the mRNA-protein complexes remain tightly attached to the nuclear matrix, but at some point after processing, this interaction is weakened, and the mRNA can be released from the nucleus by salt extraction (55). As far as we are aware, the molecular basis of this observation has not been elucidated, and the question of how mRNAs are transported from the site of transcription to the nuclear pore complex remains only partly characterized (54). Inhibition of MEK activity results in the export of hdm2 mRNA being blocked in this nuclear, salt-extractable compartment. At present we can only speculate that this represents the regulation by MEK of proteins involved in a nuclear export pathway that is required for the transport of a subset of mRNAs. Experimental manipulation of specific nuclear export processes can be shown to inhibit the expression of early response genes such as c-fos (56), and there is an increasing body of evidence suggesting that cellular mRNAs can be organized and exported from the nucleus as functionally related groups by RNA-binding proteins (57). Whether such pathways might be dependent on MEK signaling has not been described. It will be of interest to determine what other mRNAs are similarly affected by MEK inhibitors, which are known to inhibit the synthesis of a number of key regulators of cell cycle progression and apoptosis at a post-transcriptional level (58, 59).

Another issue raised by our findings is what the effect of this control mechanism might be on the ability of Ras-Raf-MEK-ERK signaling to modulate chemo- and radio-sensitivity in cancer cells. MEK-dependent expression of proteins such as Hdm2, Bcl-XL, and inhibitors of apoptosis proteins at the level of gene transcription and translation is required for growth and survival factors such as fibroblast growth factor-2 to protect cells from genotoxic agents (24, 25, 58, 59). In the case of Hdm2, this is most likely to be through the suppression of the p53 response, and in cancer cells in which expression of the Hdm2 antagonist p14ARF is lost, MEK inhibitors can enhance the cytotoxicity obtained with {gamma}-irradiation (25). We, therefore, examined whether, in the MCF-7 cell line model, there would be a synergistic effect between U0126 and the p53-activating anti-metabolite 5-FU, a chemotherapeutic agent that can be dependent on p53 activity to kill cancer cells (60) and also shows a strong induction of Hdm2 expression at cytotoxic doses. No synergism was observed in the colony-forming assays, and instead, we found that U0126 treatment resulted in inactivation of p53 function. This is consistent with other previous data showing that MEK activity can be required for both the expression of p53 at the transcriptional level (61) and the activation of p53 by genotoxic agents (48, 49). We also showed that this inhibition of p53 activity did not require functional Hdm2 in the cell, because it occurred in the presence of the Hdm2 inhibitors SuperTIP and Nutlin-3. This is again consistent with the reports that MEK inhibitors inhibit stress-induced phosphorylation of p53 at serine 15, which is required for the interaction of p53 with its co-activator, p300 (62), although the inhibition of other post-translational modifications, or co-operating transcriptional activators, should also be considered. Although MEK inhibitors can also inhibit transcription of p53 mRNA (61), this is unlikely to be the mechanism of p53 inactivation in our experiments, because U0126 does not prevent the accumulation of p53 protein in response to Nutlin-3. From a broader perspective, inhibitors of the Ras-Raf-MEK-ERK pathway, and particularly MEK inhibitors, have good potential as anti-cancer agents (63). However, their ability to potentiate the effects of genotoxic chemotherapeutic agents appears to be highly dependent on the target cell type and agent being studied (64, 65).

Together, our data suggest a model by which the p53-Hdm2 feedback loop is regulated in response to mitogenic or anti-apoptotic signaling through the Ras-Ras-MEK-ERK signaling pathway, at least in the breast cancer cell lines we have studied here. In the absence of MEK activity, cells reduce their proliferation rate and enter a G1 arrest phase (data not shown); this is associated with a loss of p53 activity, possibly due to reduced serine 15 phosphorylation and p300 binding. Hdm2 expression is, therefore, not necessary to inhibit p53 function, and Hdm2 protein synthesis is decreased due to both reduced transcription from the P2 promoter and through reduced nuclear export of hdm2 mRNA. After activation of Ras-Raf-MEK-ERK signaling by growth factors, the block to hdm2 nuclear export is released, allowing expression of the Hdm2 protein, which is now required as p53 activity increases. This helps establish a dynamic equilibrium between the p53 and Hdm2 proteins in proliferating cells that is exquisitely sensitive to regulation by other signaling pathways, such as those induced by cellular stress.

Hdm2 shows promise as a target for anti-cancer therapies (66), and small molecule inhibitors of the p53-Hdm2 interaction that have good efficacy against wild-type p53-expressing tumor cells in pre-clinical modes have recently been described (50). Presumably, such compounds will only be effective in cells in which the target molecule is expressed and in which its activity is required for cellular survival or proliferation. In the specific case of breast cancer, which may well be a suitable target for such interventions, we have previously demonstrated that elevated levels of Hdm2 protein in proliferating cultures of breast cancer cell lines with ER{alpha}+ve, compared with ER{alpha}–ve, phenotypes, correlates with transcription from the P2 promoter of the hdm2 gene in the ER{alpha}+ve cells (37). In breast tumor samples, Hdm2 protein is overexpressed compared with normal cells in as many as 50% of cases (34–36); however, in most cases in which Hdm2 expression is observed in breast cancer, it is limited to small patches of cells in the tumor (34). Additionally, one study determined that, of the tumors in which hdm2 mRNA was up-regulated, only 69% showed Hdm2 protein overexpression (35). Our data support a model in which differences in Hdm2 expression between cancers with different phenotypes and differentiation status is defined at the transcriptional level. However, either specific mutations or the local tumor environment, which affects signaling through the Ras-Raf-MEK-ERK cascade, superimposes upon the transcriptional phenotype by regulating Hdm2 protein expression at the level of nuclear export of its mRNA. Although our study has focused specifically on breast cancer cell lines, it is likely that this pattern of Hdm2 regulation will be prevalent among many cancer types in which Hdm2 protein is highly expressed.


   FOOTNOTES
 
* This work was supported by Association for International Cancer Research Grants 01-070 and 04-422 (to J. P. B.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed. Tel.: 44-23-8079-4582; Fax: 44-23-8079-5152; E-mail: j.p.blaydes{at}soton.ac.uk.

1 The abbreviations used are: MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase; ERK, extracellular signal-regulated kinase; 5-FU, 5-fluorouracil; RPA, ribonuclease protection assay; qPCR, Taqman quantitative polymerase chain reaction; ER{alpha}, estrogen receptor-{alpha}; siRNA, small interfering RNA; gapdh, glyceraldehyde-3-phosphate dehydrogenase gene. Back


   ACKNOWLEDGMENTS
 
We are grateful to Professors A. J. Levine, D. P. Lane, and B. Vogelstein for making available antibody and plasmid reagents. The manuscript was critically read by Dr. Sandra Campbell.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Vogelstein, B., Lane, D., and Levine, A. J. (2000) Nature 408, 307–310[CrossRef][Medline] [Order article via Infotrieve]
  2. El-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M., Lin, D., Mercer, W. E., Kinzler, K. W., and Vogelstein, B. (1993) Cell 75, 817–825[CrossRef][Medline] [Order article via Infotrieve]
  3. Yu, J., Zhang, L., Hwang, P. M., Kinzler, K. W., and Vogelstein, B. (2001) Mol. Cell 7, 673–682[CrossRef][Medline] [Order article via Infotrieve]
  4. Nakano, K., and Vousden, K. H. (2001) Mol. Cell 7, 683–694[CrossRef][Medline] [Order article via Infotrieve]
  5. Zauberman, A., Flusberg, D., Barak, Y., and Oren, M. (1995) Nucleic Acids Res. 23, 2584–2592[Abstract/Free Full Text]
  6. Momand, J., Wu, H. H., and Dasgupta, G. (2000) Gene (Amst.) 242, 15–29[CrossRef][Medline] [Order article via Infotrieve]
  7. Jones, S. N., Roe, A. E., Donehower, L. A., and Bradley, A. (1995) Nature 378, 206–208[CrossRef][Medline] [Order article via Infotrieve]
  8. Montes de Oca Luna, R., Wagner, D. S., and Lozano, G. (1995) Nature 378, 203–206[CrossRef][Medline] [Order article via Infotrieve]
  9. Blaydes, J. P., and Wynford-Thomas, D. (1998) Oncogene 16, 3317–3322[CrossRef][Medline] [Order article via Infotrieve]
  10. Blaydes, J. P., Gire, V., Rowson, J., and Wynford-Thomas, D. (1997) Oncogene 14, 1859–1868[CrossRef][Medline] [Order article via Infotrieve]
  11. Bottger, A., Bottger, V., Sparks, A., Liu, W. L., Howard, S. F., and Lane, D. P. (1997) Curr. Biol. 7, 860–869[CrossRef][Medline] [Order article via Infotrieve]
  12. Oliner, J. D., Pietenpol, J. A., Thiagalingam, S., Gyuris, J., Kinzler, K. W., and Vogelstein, B. (1993) Nature 362, 857–860[CrossRef][Medline] [Order article via Infotrieve]
  13. Michael, D., and Oren, M. (2003) Semin. Cancer Biol. 13, 49–58[CrossRef][Medline] [Order article via Infotrieve]
  14. Maya, R., Balass, M., Kim, S. T., Shkedy, D., Leal, J. F., Shifman, O., Moas, M., Buschmann, T., Ronai, Z., Shiloh, Y., Kastan, M. B., Katzir, E., and Oren, M. (2001) Genes Dev. 15, 1067–1077[Abstract/Free Full Text]
  15. Shieh, S. Y., Ikeda, M., Taya, Y., and Prives, C. (1997) Cell 91, 325–334[CrossRef][Medline] [Order article via Infotrieve]
  16. Wahl, G. M., and Carr, A. M. (2001) Nat. Cell Biol. 3, 277–286
  17. Vousden, K. H. (2002) Biochim. Biophys. Acta 1602, 47–59[Medline] [Order article via Infotrieve]
  18. Mayo, L. D., and Donner, D. B. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 11598–11603[Abstract/Free Full Text]
  19. Ashcroft, M., Ludwig, R. L., Woods, D. B., Copeland, T. D., Weber, H. O., MacRae, E. J., and Vousden, K. H. (2002) Oncogene 21, 1955–1962[CrossRef][Medline] [Order article via Infotrieve]
  20. Feng, J., Tamaskovic, R., Yang, Z., Brazil, D. P., Merlo, A., Hess, D., and Hemmings, B. A. (2004) J. Biol. Chem. 279, 35510–35517[Abstract/Free Full Text]
  21. Cox, A. D., and Der, C. J. (2003) Oncogene 22, 8999–9006[CrossRef][Medline] [Order article via Infotrieve]
  22. Sharpless, N. E., and DePinho, R. A. (1999) Curr. Opin. Genet. Dev. 9, 22–30[CrossRef][Medline] [Order article via Infotrieve]
  23. Lowe, S. W., and Sherr, C. J. (2003) Curr. Opin. Genet. Dev. 13, 77–83[CrossRef][Medline] [Order article via Infotrieve]
  24. Shaulian, E., Resnitzky, D., Shifman, O., Blandino, G., Amsterdam, A., Yayon, A., and Oren, M. (1997) Oncogene 15, 2717–2725[CrossRef][Medline] [Order article via Infotrieve]
  25. Ries, S., Biederer, C., Woods, D., Shifman, O., Shirasawa, S., Sasazuki, T., McMahon, M., Oren, M., and McCormick, F. (2000) Cell 103, 321–330[CrossRef][Medline] [Order article via Infotrieve]
  26. Mendrysa, S. M., McElwee, M. K., Michalowski, J., O'Leary, K. A., Young, K. M., and Perry, M. E. (2003) Mol. Cell. Biol. 23, 462–472[Abstract/Free Full Text]
  27. Fang, S., Jensen, J. P., Ludwig, R. L., Vousden, K. H., and Weissman, A. M. (2000) J. Biol. Chem. 275, 8945–8951[Abstract/Free Full Text]
  28. Onel, K., and Cordon-Cardo, C. (2004) Mol. Cancer Res. 2, 1–8[Abstract/Free Full Text]
  29. Oliner, J. D., Kinzler, K. W., Meltzer, P. S., George, D. L., and Vogelstein, B. (1992) Nature 358, 80–83[CrossRef][Medline] [Order article via Infotrieve]
  30. Mendrysa, S. M., and Perry, M. E. (2000) Mol. Cell. Biol. 20, 2023–2030[Abstract/Free Full Text]
  31. Brown, C. Y., Mize, G. J., Pineda, M., George, D. L., and Morris, D. R. (1999) Oncogene 18, 5631–5637[CrossRef][Medline] [Order article via Infotrieve]
  32. Trotta, R., Vignudelli, T., Candini, O., Intine, R. V., Pecorari, L., Guerzoni, C., Santilli, G., Byrom, M. W., Goldoni, S., Ford, L. P., Caligiuri, M. A., Maraia, R. J., Perrotti, D., and Calabretta, B. (2003) Cancer Cell 3, 145–160[CrossRef][Medline] [Order article via Infotrieve]
  33. Stommel, J. M., and Wahl, G. M. (2004) EMBO J. 23, 1547–1556[CrossRef][Medline] [Order article via Infotrieve]
  34. Marchetti, A., Buttitta, F., Girlando, S., Palma, P. D., Pellegrini, S., Fina, P., Doglioni, C., Bevilacqua, G., and Barbareschi, M. (1995) J. Pathol. 175, 31–38[CrossRef][Medline] [Order article via Infotrieve]
  35. Bueso-Ramos, C. E., Manshouri, T., Haidar, M. A., Yang, Y., McCown, P., Ordonez, N., Glassman, A., Sneige, N., and Albitar, M. (1996) Breast Cancer Res. Treat. 37, 179–188[CrossRef][Medline] [Order article via Infotrieve]
  36. Hori, M., Shimazaki, J., Inagawa, S., and Itabashi, M. (2002) Breast Cancer Res. Treat. 71, 77–83[CrossRef][Medline] [Order article via Infotrieve]
  37. Phelps, M., Darley, M., Primrose, J. N., and Blaydes, J. P. (2003) Cancer Res. 63, 2616–2623[Abstract/Free Full Text]
  38. Blaydes, J. P., and Hupp, T. R. (1998) Oncogene 17, 1045–1052[CrossRef][Medline] [Order article via Infotrieve]
  39. Chen, J., Marechal, V., and Levine, A. J. (1993) Mol. Cell. Biol. 13, 4107–4114[Abstract/Free Full Text]
  40. Brewer, G., and Ross, J. (1990) Methods Enzymol. 181, 202–209[Medline] [Order article via Infotrieve]
  41. Komminoth, P. (2002) in Radioactive in Situ Hybridization Manual, pp. 149–164, Roche Applied Science, Basel, Switzerland
  42. Lev Bar-Or, R., Maya, R., Segel, L. A., Alon, U., Levine, A. J., and Oren, M. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 11250–11255[Abstract/Free Full Text]
  43. Davies, S. P., Reddy, H., Caivano, M., and Cohen, P. (2000) Biochem. J. 351, 95–105[CrossRef][Medline] [Order article via Infotrieve]
  44. de Toledo, S. M., Azzam, E. I., Dahlberg, W. K., Gooding, T. B., and Little, J. B. (2000) Oncogene 19, 6185–6193[CrossRef][Medline] [Order article via Infotrieve]
  45. Maraia, R. J., Sasaki-Tozawa, N., Driscoll, C. T., Green, E. D., and Darlington, G. J. (1994) Nucleic Acids Res. 22, 3045–3052[Abstract/Free Full Text]
  46. Rajasekhar, V. K., Viale, A., Socci, N. D., Wiedmann, M., Hu, X., and Holland, E. C. (2003) Mol. Cell 12, 889–901[CrossRef][Medline] [Order article via Infotrieve]
  47. Halaschek-Wiener, J., Wacheck, V., Kloog, Y., and Jansen, B. (2004) Cell Signal 16, 1319–1327[CrossRef][Medline] [Order article via Infotrieve]
  48. Persons, D. L., Yazlovitskaya, E. M., and Pelling, J. C. (2000) J. Biol. Chem. 275, 35778–35785[Abstract/Free Full Text]
  49. She, Q. B., Chen, N., and Dong, Z. (2000) J. Biol. Chem. 275, 20444–20449[Abstract/Free Full Text]
  50. Vassilev, L. T., Vu, B. T., Graves, B., Carvajal, D., Podlaski, F., Filipovic, Z., Kong, N., Kammlott, U., Lukacs, C., Klein, C., Fotouhi, N., and Liu, E. A. (2004) Science 303, 844–848[Abstract/Free Full Text]
  51. Mosner, J., and Deppert, W. (1994) Oncogene 9, 3321–3328[Medline] [Order article via Infotrieve]
  52. Hui, L., Abbas, T., Pielak, R. M., Joseph, T., Bargonetti, J., and Foster, D. A. (2004) Mol. Cell. Biol. 24, 5677–5686[Abstract/Free Full Text]
  53. Fambrough, D., McClure, K., Kazlauskas, A., and Lander, E. S. (1999) Cell 97, 727–741[CrossRef][Medline] [Order article via Infotrieve]
  54. Erkmann, J. A., and Kutay, U. (2004) Exp. Cell Res. 296, 12–20[CrossRef][Medline] [Order article via Infotrieve]
  55. Denome, R. M., Werner, E. A., and Patterson, R. J. (1989) Nucleic Acids Res. 17, 2081–2098[Abstract/Free Full Text]
  56. Gallouzi, I. E., and Steitz, J. A. (2001) Science 294, 1895–1901[Abstract/Free Full Text]
  57. Keene, J. D. (2003) Nat. Genet. 33, 111–112[CrossRef][Medline] [Order article via Infotrieve]
  58. Pardo, O. E., Arcaro, A., Salerno, G., Raguz, S., Downward, J., and Seckl, M. J. (2002) J. Biol. Chem. 277, 12040–12046[Abstract/Free Full Text]
  59. Pardo, O. E., Lesay, A., Arcaro, A., Lopes, R., Ng, B. L., Warne, P. H., McNeish, I. A., Tetley, T. D., Lemoine, N. R., Mehmet, H., Seckl, M. J., and Downward, J. (2003) Mol. Cell. Biol. 23, 7600–7610[Abstract/Free Full Text]
  60. Bunz, F., Hwang, P. M., Torrance, C., Waldman, T., Zhang, Y., Dillehay, L., Williams, J., Lengauer, C., Kinzler, K. W., and Vogelstein, B. (1999) J. Clin. Investig. 104, 263–269[Medline] [Order article via Infotrieve]
  61. Agarwal, M. L., Ramana, C. V., Hamilton, M., Taylor, W. R., DePrimo, S. E., Bean, L. J., Agarwal, A., Agarwal, M. K., Wolfman, A., and Stark, G. R. (2001) Oncogene 20, 2527–2536[CrossRef][Medline] [Order article via Infotrieve]
  62. Dumaz, N., and Meek, D. W. (1999) EMBO J. 18, 7002–7010[CrossRef][Medline] [Order article via Infotrieve]
  63. Herrera, R., and Sebolt-Leopold, J. S. (2002) Trends Mol. Med. 8, Suppl. 4, 27–31
  64. Gupta, A. K., Bakanauskas, V. J., Cerniglia, G. J., Cheng, Y., Bernhard, E. J., Muschel, R. J., and McKenna, W. G. (2001) Cancer Res. 61, 4278–4282[Abstract/Free Full Text]
  65. Boldt, S., Weidle, U. H., and Kolch, W. (2002) Carcinogenesis 23, 1831–1838[Abstract/Free Full Text]
  66. Lane, D. P., and Lain, S. (2002) Trends Mol. Med. 8, Suppl. 4, 38–42[CrossRef][Medline] [Order article via Infotrieve]
  67. Stott, F. J., Bates, S., James, M. C., McConnell, B. B., Starborg, M., Brookes, S., Palmero, I., Ryan, K., Hara, E., Vousden, K. H., and Peters, G. (1998) EMBO J. 17, 5001–5014[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol Cancer ResHome page
H. Taubert, F. Bartel, T. Greither, M. Bache, M. Kappler, T. Kohler, A. Bohnke, C. Lautenschlager, H. Schmidt, H.-J. Holzhausen, et al.
Association of HDM2 Transcript Levels with Age of Onset and Prognosis in Soft Tissue Sarcomas
Mol. Cancer Res., October 1, 2008; 6(10): 1575 - 1581.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. M. Monick, L. S. Powers, C. W. Barrett, S. Hinde, A. Ashare, D. J. Groskreutz, T. Nyunoya, M. Coleman, D. R. Spitz, and G. W. Hunninghake
Constitutive ERK MAPK Activity Regulates Macrophage ATP Production and Mitochondrial Integrity
J. Immunol., June 1, 2008; 180(11): 7485 - 7496.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
V. A. Carroll and M. Ashcroft
Regulation of Angiogenic Factors by HDM2 in Renal Cell Carcinoma
Cancer Res., January 15, 2008; 68(2): 545 - 552.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Kobayashi, K. Mao, H. Zheng, X. Wang, C. Patterson, T. D. O'Connell, and Q. Liang
Diminished GATA4 Protein Levels Contribute to Hyperglycemia-induced Cardiomyocyte Injury
J. Biol. Chem., July 27, 2007; 282(30): 21945 - 21952.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
K. Kojima, M. Konopleva, I. J. Samudio, V. Ruvolo, and M. Andreeff
Mitogen-Activated Protein Kinase Kinase Inhibition Enhances Nuclear Proapoptotic Function of p53 in Acute Myelogenous Leukemia Cells
Cancer Res., April 1, 2007; 67(7): 3210 - 3219.
[Abstract] [Full Text] [PDF]

Home page
 DevelopmentHome page
A. Moumen, S. Patane, A. Porras, R. Dono, and F. Maina
Met acts on Mdm2 via mTOR to signal cell survival during development
Development, April 1, 2007; 134(7): 1443 - 1451.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Malmlof, E. Roudier, J. Hogberg, and U. Stenius
MEK-ERK-mediated Phosphorylation of Mdm2 at Ser-166 in Hepatocytes: Mdm2 IS ACTIVATED IN RESPONSE TO INHIBITED Akt SIGNALING
J. Biol. Chem., January 26, 2007; 282(4): 2288 - 2296.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
Y. Nakamura, S. Suzuki, T. Suzuki, K. Ono, I. Miura, F. Satoh, T. Moriya, H. Saito, S. Yamada, S. Ito, et al.
MDM2: A Novel Mineralocorticoid-Responsive Gene Involved in Aldosterone-Induced Human Vascular Structural Remodeling
Am. J. Pathol., August 1, 2006; 169(2): 362 - 371.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. M. Monick, L. S. Powers, T. J. Gross, D. M. Flaherty, C. W. Barrett, and G. W. Hunninghake
Active ERK Contributes to Protein Translation by Preventing JNK-Dependent Inhibition of Protein Phosphatase 1
J. Immunol., August 1, 2006; 177(3): 1636 - 1645.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. W. Jackson, L. E. Patt, G. A. LaRusch, D. B. Donner, G. R. Stark, and L. D. Mayo
Hdm2 Nuclear Export, Regulated by Insulin-like Growth Factor-I/MAPK/p90Rsk Signaling, Mediates the Transformation of Human Cells
J. Biol. Chem., June 16, 2006; 281(24): 16814 - 16820.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/17/16651    most recent
M412334200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Phelps, M.
Right arrow Articles by Blaydes, J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Phelps, M.
Right arrow Articles by Blaydes, J. P.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement