HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 280, Issue 18, 17652-17656, May 6, 2005

This Article Abstract Full Text (PDF) All Versions of this Article: 280/18/17652    most recent C500061200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Smith, D. Articles by Hosler, J. P. Search for Related Content PubMed PubMed Citation Articles by Smith, D. Articles by Hosler, J. P. Social Bookmarking                      What's this?

Assembly of Cytochrome-c Oxidase in the Absence of Assembly Protein Surf1p Leads to Loss of the Active Site Heme^*

Daniel Smith, Jimmy Gray, Larkin Mitchell, William E. Antholine, and Jonathan P. Hosler¶

From the Department of Biochemistry, University of Mississippi Medical Center, Jackson, Mississippi 39216-4505 and the National Biomedical ESR Center, Department of Biophysics, Medical College of Wisconsin, Milwaukee, Wisconsin 53226-3548

Received for publication, February 14, 2005 , and in revised form, March 8, 2005.

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Surf1p is a protein of the inner membrane of mitochondria that functions in the assembly of cytochrome-c oxidase. The specifics of the role of Surf1p have remained unresolved. Numerous mutations in human Surf1p lead to severe mitochondrial disease. A homolog of human Surf1p is encoded by the genome of the -proteobacterium Rhodobacter sphaeroides, which synthesizes a mitochondrial-like aa₃-type cytochrome-c oxidase. The gene for Surf1p was deleted from the genome of R. sphaeroides. The resulting aa₃-type oxidase was purified and analyzed by biochemical methods plus optical and EPR spectroscopy. The oxidase that assembled in the absence of Surf1p was composed of three subpopulations with structurally distinct heme a₃-Cu active sites. 50% of the oxidase lacked heme a₃, 10–15% contained heme a₃ but lacked Cu_BB, and 35–40% had a normal heme a₃ -Cu_B active site with normal activity. Cu_A assembly was unaffected. All of the oxidase contained low-spin heme a, but the environment of the heme a center was slightly altered in the 50% of the enzyme that lacked heme a₃. Introduction of a normal copy of the gene for Surf1p on an exogenous plasmid resulted in a single population of normally assembled, highly active enzyme. The data indicate that Surf1p plays a role in facilitating the insertion of heme a₃ into the active site of cytochrome-c oxidase. The results suggest that maturation of the heme a₃-Cu_B center is a step that limits the association of subunits I and II in the assembly of mitochondrial cytochrome oxidase.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Cytochrome-c oxidase (CcO)¹ functions as the terminal member of the respiratory electron transfer chain in mitochondria. Electrons from soluble cytochrome c are first transferred to a dimeric copper center in subunit II, Cu_A, then on to six-coordinate heme a in subunit I, and finally to the buried heme a₃-Cu_B site, also located in subunit I, where O₂ is reduced to water (1). Some of the energy of electron transfer is used to pump protons through the protein, across its host membrane. Rhodobacter sphaeroides, a member of the -subgroup of the proteobacteria that gave rise to mitochondria, synthesizes an aa₃-type oxidase with high genetic and structural similarity to the subunits of the catalytic core (I, II, and III) of mammalian CcO (2–4). R. sphaeroides has proven to be highly useful for producing engineered forms of its mitochondrial-like oxidase, thus providing experimental models for elucidating structure/function relationships for the catalytic core of CcO.

Numerous proteins that are not members of the final complex are specifically required for the assembly of CcO in eukaryotic cells (5, 6). The genome of R. sphaeroides encodes homologs of five of these assembly proteins, which are also present in yeast and human cells. The presence of these proteins in R. sphaeroides and related bacteria suggests that they play a fundamental role in the assembly of the catalytic core. Including this report, the evidence for a role in CcO assembly for at least four of these five bacterial proteins is compelling. Cox10p and Cox15p of R. sphaeroides form a membrane complex that coverts heme B to heme A (7). Cox11p is a membrane-bound copper-binding protein (8); analysis of a R. sphaeroides strain lacking cox11 established that Cox11p is required for the assembly of Cu_B (9). PrrC is another copper-binding protein of R. sphaeroides with homology to eukaryotic Sco1 (10), the copper protein proposed to function in the assembly of Cu_A in mitochondria (6). However, PrrC is not required for the assembly of Cu_A in the aa₃-type oxidase of R. sphaeroides.²

Here, we report the analysis of CcO synthesized in the absence of Surf1p of R. sphaeroides, the fifth of the conserved CcO assembly proteins present in this bacterium. It is well established that Surf1p is essential for the assembly of normal amounts of mitochondrial CcO (11–14). At least 40 different mutations in Surf1p of humans lead to CcO deficiency, resulting in severe mitochondrial disease (14). In fact, human Surf1p has been linked with a greater number of defects leading to human disease than any of the other CcO assembly proteins (14). Surf1p is anchored in the inner mitochondrial membrane (or the bacterial cytoplasmic membrane) by two predicted transmembrane helices, one each at the N and C termini of the protein (15). The intervening extramembrane domain faces the intermembrane space in mitochondria (15), which is analogous to the periplasmic space of R. sphaeroides. The predicted sizes of human (GenBank^TM accession number NP_003163 [GenBank] ) and R. sphaeroides Surf1p (AY918925 [GenBank] ) are similar (300 versus 262 residues). Using EMBOSS-Align (European Bioinformatics Institute), the DNA-predicted amino acid sequence of R. sphaeroides Surf1p is 31% identical and 45% similar to human Surf1p. Essentially all of this homology is found in the extramembrane domains of the two proteins; the sequences of the transmembrane helices are not conserved. Surf1p of R. sphaeroides is no less similar to human Surf1p than is Shy1p of Saccharomyces cerevisiae, the yeast homolog of Surf1p (15).

Studies in yeast and cultured human cells indicate roles for Surf1p in promoting the passage of subunit I through the assembly process, particularly the association of subunit II with a protein subassembly containing subunit I plus one or more of the nuclear encoded structural subunits present in the mitochondrial oxidase (11–14, 16, 17). Here, we present evidence that Surf1p assists in the assembly of heme a₃ into the active site of R. sphaeroides CcO. The results also provide the likely explanation for previous proposals of Surf1p function in the assembly of mitochondrial CcO.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Construction of the surf1 Deletion Strain DS003 and the Surf1p Expression Plasmid pDS306—A 1.8-kbp PCR product containing surf1 was obtained from genomic DNA isolated from R. sphaeroides 2.4.1 (18) using primers that included EcoRI restriction sites (Surf1EcoRIforward (5'-3') = GGGAATTCCGGCCTGGTTCTGGAGCTTCTTCAAGCACGCG; Surf1EcoRIreverse = GGGAATTCCCCGAGGTGGCGCCGACGATGGTGATCC). The gel-purified fragment was restricted with EcoRI and ligated into the EcoRI site of pUC18 to create pDS301. A 397-bp fragment internal to surf1 was removed by restricting pDS301 with EcoNI and NcoI, and blunt ends were created with T4 DNA polymerase. A 2.1-kbp SmaI/EcoRV fragment containing the Strep/Spec o cassette from pUI1638 (19) was ligated into blunt-ended pDS301 to create pDS304. A 3.5-kbp EcoRI fragment from pDS304 (the original 1.8-kbp PCR fragment, minus the 0.4-kbp deletion in surf1, plus the 2.1-kbp Strep/Spec resistance gene) was cloned into the suicide plasmid pSUP202 (20) to create pDS305. The pDS305 suicide plasmid was conjugated into R. sphaeroides 2.4.1 by established methods (21). The Strep/Spec-resistant exconjugate colonies were replica-plated onto media containing 1.0 µg/ml tetracycline to identify cells in which double crossover events had eliminated the plasmid from the genome leaving behind the modified surf1. Tetracycline-sensitive (double crossover) exconjugates were analyzed by PCR using primers just outside of the Surf1EcoRIforward and Surf1EcoRIreverse primers for the presence of an 3.6-kbp fragment containing modified surf1 plus the Strep/Spec resistance gene. Three such isolates were identified, and one was carried forward for use as the surf1 deletion strain, DS003. The 1.8-kbp EcoRI fragment containing surf1 from pDS301 was cloned into the broad host range vector pBBR1MCS-2 (22) to create the Surf1p expression plasmid pDS306.

Other—Bacterial growth and oxidase purification (23, 24) and activity measurements (25) were as described previously. Analyses of heme A content were as described previously (26), using the -band of the reduced absolute spectra of the oxidase forms to determine oxidase concentrations. An extinction coefficient of 40 mM^–1 cm^–1 (27) was used for the wild-type oxidase and the oxidase isolated from DS020 (see below). The contribution to -band absorbance by heme a₃ is 20% (27). Once it became apparent that the oxidase that assembles in the absence of Surf1p lacked 50% of its heme a₃ (see below), an extinction coefficient of 36 mM^–1 cm^–1 was then used for this oxidase form in order to more closely estimate the concentration of the protein. The binding of CO and CN^– were performed as described (25). EPR spectra were obtained as noted in the legend to Fig. 2.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Biochemical and Spectroscopic Characteristics of the aa₃-type Cytochrome-c Oxidase That Assembles in the Absence of Surf1p—In the R. sphaeroides genome, surf1 is located immediately adjacent to the gene for subunit III of the aa₃-type oxidase, as the first gene in what appears to be a four-gene operon. Three downstream genes encode a putative threonine synthase, a peptidase of the M16 family, and a putative alanine acetyltransferase. In the surf1 deletion strain, DS003, a 0.4-kbp fragment encoding residues Trp-64 through Pro-195 of Surf1p (i.e. most of the conserved extramembrane domain) was deleted and replaced by a gene encoding resistance to streptomycin and spectinomycin. DS003 grew as well as wild-type strain 2.4.1 under aerobic conditions, indicating that the presence of the antibiotic resistance gene at this position was not cytotoxic. The growth rate of DS003 was the same whether or not the minimal growth media was supplemented with L-threonine. Thus, the expression of the downstream threonine synthase was sufficient for cell needs despite possible polar effects from the insertion of the antibiotic resistance gene.

A strain (DS009) for over-expression of the aa₃-type CcO in the absence of Surf1p was created by introducing the expression plasmid pRKpAH1H32 (9), which contains the genes for subunits I, II, and III as well as those for the assembly proteins Cox10p and Cox11p, into DS003. DS009 also grew at a normal rate. This indicates that expressing the aa₃-type oxidase in the absence of Surf1p is not harmful to the cell but, other than that, it yields no information about the assembly of the oxidase. Even the complete absence of the aa₃-type oxidase from R. sphaeroides does not affect the aerobic growth rate, because a cbb₃-type CcO is also synthesized to high levels during aerobic growth (28).

The aa₃-type oxidase was isolated from purified DS009 membranes via its histidine tag on the C terminus of subunit I (23, 29) and termed Surf1p CcO. Extensive use of this tag to isolate the wild-type oxidase and many mutant oxidase forms has shown that the tag itself does not alter the structural or functional properties of the oxidase. The cytochrome c-driven O₂ reduction activity of purified Surf1p CcO (V_max = 706 ± 29 s^–1) was 35% that of the wild-type enzyme (V_max = 2074 ± 45 s^–1). This indicated an overall decrease in activity or the presence of at least two oxidase forms, one active and one inactive. Densitometry of protein gels (not shown) showed that the subunit composition of the CcO complex that assembled in the absence of Surf1p was entirely normal.

Inspection of the absolute spectrum of dithionite-reduced Surf1p CcO showed a significant decrease in the ratio of the amplitudes of the Soret peak at 444 nm and the peak at 605 nm (Fig. 1A; Table I). Because the peak absorbance is primarily due to heme a (80%) and the Soret absorbance is more equally contributed by both hemes a and a₃ (27), this decrease in the Soret/ amplitude ratio suggested a loss of heme a₃. The Soret/ value of Surf1p CcO is approximately half way between that of the wild-type oxidase and the theoretical value for an oxidase lacking all heme a₃, calculated from the extinction values of Vanneste (27).

A sensitive optical assay for the presence of a normally assembled heme a₃-Cu_B active site is the ability of CN^– to bind to the reduced enzyme (25, 30, 31). Cyanide moves to the active site as neutral HCN, where it dissociates to allow CN^– to bind to heme a₃. In the reduced active site, the presence of Cu_B is required to bind the resulting H⁺, presumably on a hydroxyl anion bound to the copper (31, 32). The CN^– difference spectrum (a²⁺ a₃²⁺–CN^– minus a²⁺ a₃²⁺) of the reduced, normal oxidase shows a characteristic peak at 590 nm (resulting from the low-spin heme a₃–CN^– adduct) and a trough at 613 nm (Fig. 1C) (30, 31). The 590–613 nm absorption of Surf1p CcO was measured to be 37% that of wild-type CcO (Table I), indicating that slightly more than one-third of the Surf1p CcO contained a normal active site. This agreed well with the amount of normal oxidase (35%) indicated by activity measurements of Surf1p CcO. As a negative control, the oxidase isolated from our bacterial strain lacking the copper chaperone Cox11p, an enzyme that contains heme a₃ but lacks Cu_B (9), failed to bind any CN^– in its reduced form (data not shown).

View larger version (14K): [in this window] [in a new window]   FIG. 1. Optical spectra of the aa3-type cytochrome-c oxidase isolated from wild-type cells (WT CcO) and from strain DS009 (Surf1p CcO). A, absolute spectra of equimolar amounts of sodium dithionite-reduced CcO. The spectra are normalized for -band absorbance at 605 nm to emphasize the difference in Soret band absorption 444 nm. B, CO difference spectra (a2+ a32+–CO minus a2+ a32+) of equimolar amounts of wild-type and Surf1p CcO. The absorbance of the trough defined by A472-447 nm is proportional to the amount of CO bound to heme a3. C, CN– difference spectra (a2+ a32+–CN– minus a2+ a32+) of equimolar amounts of wild-type and Surf1p CcO. The absorbance defined by A590-613 nm is proportional to the amount of CN– bound to heme a3.

EPR Spectroscopy—EPR spectroscopy provides direct information about the environment and quantity of Cu_A and heme a in CcO (26, 33, 34). The structure and the quantity of the Cu_A center in subunit II of Surf1p CcO appeared completely normal (Fig. 2). The g_z component of the heme a signal of wild-type CcO appears as a sharp peak at g = 2.81 (Fig. 2) (26). This signal was also present in Surf1p CcO, but its amplitude was 50% that of the g_z signal for heme a of wild-type CcO. An additional, broadened signal was observed immediately downfield of the g_z signal in the spectrum of Surf1p CcO. In a separate experiment, the g 3 region of wild-type and Surf1p CcO was more highly resolved (Fig. 2, inset). Both spectra show a broad peak centered at g = 2.89 in addition to the g = 2.81 signal. However, although the g = 2.89 signal is a minor component in the spectrum of wild-type CcO, integration showed that the broad g = 2.89 signal and the more narrow g = 2.81 signals each contributed 50% of the total g_z signal of heme a of Surf1p CcO.

In the normal heme a₃-Cu_B center of oxidized CcO, the unpaired electrons of heme a₃ and Cu_B are spin-coupled such that both centers are EPR-silent (35). In the absence of Cu_B, however, high-spin heme a₃ yields a signal at g 6 (9, 36). An elevated g 6 signal in the spectrum of Surf1p CcO (Fig. 2) indicates the presence of some high-spin heme a₃. Using our previously published spectra of the Cu_B oxidase as a standard for 100% high-spin heme a₃ (9), the slightly elevated g 6 signal in the spectrum of Surf1p CcO indicates the presence of 15% high-spin heme a₃. This strongly suggests that about 15% of Surf1p CcO contains heme a₃ but lacks Cu_B. The relationship of this finding to the spectroscopic results in Table I is discussed immediately below.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The CcO population that assembles in the absence of Surf1p contains three distinct configurations of the heme a₃-Cu_B active site. First, 50% of Surf1p CcO lacks heme a₃, as evidenced by the Soret/ value, measurements of heme A content and the amount of CO binding. Second, 35–40% of the CcO population is active and contains a normal heme a₃-Cu_B active site, as shown by activity measurements and the extent of CN^– binding to the reduced enzyme. Third, optical and EPR spectroscopy reveal a smaller population, corresponding to the remaining 10–15%, in which the active site contains heme a₃ in the normal high-spin configuration but lacks Cu_B. The evidence for this is as follows. Carbon monoxide binding, which requires reduced heme a₃ but not Cu_B (31), shows the presence of 50% heme a₃ in Surf1p CcO. However, CN^– binding to the reduced enzyme, which requires both heme a₃ and Cu_B (31, 32), is only 35–40% that of normal CcO. Together this indicates that 10–15% of the Surf1p CcO contains heme a₃, but not Cu_B. This conclusion can be derived independently from the EPR spectra. The presence of 15% high-spin heme in Surf1p CcO (Fig. 2) is best explained by the presence of a subpopulation that contains high-spin heme a₃ but lacks Cu_B (9). In addition, preliminary metal analysis data are consistent with the absence of Cu_B in the 50% of Surf1p CcO that lacks heme a₃. It should be noted, however, that metal content measurements are complicated by the fact that a 50–60% loss of Cu_B in the presence of a normal Cu_A center leads to only a 17–20% loss of the total amount of copper in each CcO monomer.

View larger version (30K): [in this window] [in a new window]   FIG. 2. EPR spectra of wild-type (WT) and Surf1p CcO. The spectrum of each CcO was recorded at X-band using a Bruker E500 ELEXYS spectrometer. The wild-type CcO spectrum is an average of two scans at 13 K using 63 µM enzyme, while the Surf1p CcO spectrum is an average of nine scans taken at 10 K using 32 µM enzyme. The spectra are normalized for the CcO concentration differences. The spectra were obtained using 0.6-milliwatt microwave power at 9.6335 GHz. The modulation was 10 G (peak-to-peak), the sweep time was a minimum of 84 s, and the time constant was 82 ms. The labeled heme a3 signal is that for high-spin heme a3 at g 6.0 (9, 34), the labeled heme a3 signal is the low-spin gz signal at g = 2.81 (26), and the CuA signals are those at g = 2.19 and 2.03 (26). The heme a gy signal at g = 2.31 is shown but not labeled. The inset shows the expanded heme a gz region, with a single scan of 70 µM wild-type CcO obtained at 7.4 K and an average of 25 scans at 7.8 K of 17 µM Surf1p CcO. The spectra have been normalized for the difference in CcO concentrations.

This is the first demonstration that Surf1p plays a role in the assembly of the metal centers of CcO. The assembly role of Surf1p is clearly limited to the heme a₃-Cu_B active site. Formally, Surf1p could be involved in heme a₃ insertion, or it could be involved in the insertion of Cu_B if the assembly of Cu_B is a prerequisite for the assembly of heme a₃. However, we have previously demonstrated that heme a₃ insertion does not require the prior assembly of Cu_B (9). Thus, the sum of our previous and present results argues for a role for Surf1p in the assembly of the heme a₃ center. The putative absence of Cu_B when heme a₃ is also absent suggests that stable binding of this copper requires the presence of the active site heme. As yet, it cannot be discerned whether Surf1p plays a direct (e.g. as a heme chaperone) or an indirect role in the insertion of heme a₃. Surf1p may interact with the proposed Cox10p-Cox15p complex that synthesizes and possibly inserts heme A (7). Alternatively, Surf1p could interact with subunits I or II to facilitate the assembly of the heme a₃-Cu_B center. In this light, an apparent association of Surf1p and subunit II has been reported for cultured human cells (12).

The finding that some normally assembled CcO accumulates in the absence of Surf1p in R. sphaeroides is consistent with reports of the assembly of mitochondrial CcO in the absence of Surf1p. A constitutive knock-out of both surf1 alleles in mice is highly detrimental but not 100% lethal, indicating the production of some active CcO (40). Mutations that lead to the absence of Surf1p in humans, causing Leigh syndrome, severely decrease the amount of CcO, but some CcO is correctly assembled and active (14).

Work with the R. sphaeroides system has previously demonstrated that assembly of the heme a₃-Cu_B active site requires the association of subunit II with subunit I (38). The various proposals for Surf1p function in mitochondria center on the maturation of subunit I and the subsequent association of subunit I with subunit II (11–14, 16, 17). Our finding that Surf1p is involved in the assembly of heme a₃ suggests that the assembly of the heme a₃-Cu_B active site is the maturation step that makes it possible for subunits I and II to associate in mitochondria. The association of these subunits in R. sphaeroides does not absolutely require the assembly of the heme a₃-Cu_B active site, as evidenced by this and two previous studies (9, 41). However, the level of expression of the R. sphaeroides oxidase is lower in the absence of full assembly of the heme a₃-Cu_B active site, suggesting that subunit association is less stable. The prerequisites for subunit association are likely to be more stringent in mitochondria than in R. sphaeroides because the core subunits do not associate independently but as members of subassemblies that include nuclear encoded accessory subunits (11, 42).

	FOOTNOTES

 
^* This work was supported by National Institutes of Health Grants GM56824 (to J. P. H.) and EB001980 (to W. E. A.) and by Grant DE-FG02-01ER63232 from the U. S. Department of Energy (to J. P. H.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to GenBank^TM/EBI Data Bank with the accession number(s) AY918925 [GenBank] .

^¶ To whom correspondence should be addressed: Dept. of Biochemistry, University of Mississippi Medical Center, 2500 N. State St., Jackson, MS 39216-4505. Tel.: 601-984-1861; Fax: 601-984-1501; E-mail: jhosler{at}biochem.umsmed.edu.

¹ The abbreviations used are: CcO, cytochrome-c oxidase; Strep/Spec, streptomycin and spectinomycin.

² J. P. Hosler, unpublished observation.

	ACKNOWLEDGMENTS

 
We thank Drs. Victor Davidson and Dennis Winge for valuable discussions and Dr. Paul Cobine for metal analysis assays.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Saraste, M. (1999) Science 283, 1488–1493[Abstract/Free Full Text]
2. Shapleigh, J. P., and Gennis, R. B. (1992) Mol. Microbiol. 6, 635–642[CrossRef][Medline] [Order article via Infotrieve]
3. Cao, J., Hosler, J., Shapleigh, J., Revzin, A., and Ferguson-Miller, S. (1992) J. Biol. Chem. 267, 24273–24278[Abstract/Free Full Text]
4. Svensson-Ek, M., Abramson, J., Larsson, G., Törnroth, S., Brzezinski, P., and Iwata, S. (2002) J. Mol. Biol. 321, 329–339[CrossRef][Medline] [Order article via Infotrieve]
5. Tzagoloff, A., and Dieckmann, C. L. (1990) Microbiol. Rev. 54, 211–225[Abstract/Free Full Text]
6. Carr, H. S., and Winge, D. R. (2003) Acc. Chem. Res. 36, 309–316[CrossRef][Medline] [Order article via Infotrieve]
7. Brown, B. M., Wang, Z., Brown, K. R., Cricco, J. A., and Hegg, E. L. (2004) Biochemistry 43, 13541–13548[Medline] [Order article via Infotrieve]
8. Carr, H. S., George, G. N., and Winge, D. R. (2002) J. Biol. Chem. 277, 31237–31242[Abstract/Free Full Text]
9. Hiser, L., Di Valentin, M., Hamer, A. G., and Hosler, J. P. (2000) J. Biol. Chem. 275, 619–623[Abstract/Free Full Text]
10. McEwan, A. G., Lewin, A., Davy, S. L., Boetzel, R., Leech, A., Walker, D., Wood, T., and Moore, G. R. (2002) FEBS Lett. 518, 10–16[CrossRef][Medline] [Order article via Infotrieve]
11. Williams, S. L., Valnot, I., Rustin, P., and Taanman, J. W. (2004) J. Biol. Chem. 279, 7462–7469[Abstract/Free Full Text]
12. Nijtmans, L. G., Artal Sanz, M., Bucko, M., Farhoud, M. H., Feenstra, M., Hakkaart, G. A., Zeviani, M., and Grivell, L. A. (2001) FEBS Lett. 498, 46–51[CrossRef][Medline] [Order article via Infotrieve]
13. Barrientos, A., Korr, D., and Tzagoloff, A. (2002) EMBO J. 21, 43–52[CrossRef][Medline] [Order article via Infotrieve]
14. Pecina, P., Houstkova, H., Hansikova, H., Zeman, J., and Houstek, J. (2004) Physiol. Res. 53, Suppl. 1, S213–S223[Medline] [Order article via Infotrieve]
15. Mashkevich, G., Repetto, B., Glerum, D. M., Jin, C., and Tzagoloff, A. (1997) J. Biol. Chem. 272, 14356–14364[Abstract/Free Full Text]
16. Perez-Martinez, X., Broadley, S. A., and Fox, T. D. (2003) EMBO J. 22, 5951–5961[CrossRef][Medline] [Order article via Infotrieve]
17. Barrientos, A., Zambrano, A., and Tzagoloff, A. (2004) EMBO J. 23, 3472–3482[CrossRef][Medline] [Order article via Infotrieve]
18. Choudhary, M., Fu, Y. X., Mackenzie, C., and Kaplan, S. (2004) J. Bacteriol. 186, 2019–2027[Abstract/Free Full Text]
19. Eraso, J. M., and Kaplan, S. (1994) J. Bacteriol. 176, 32–43[Abstract/Free Full Text]
20. Simon, R., Priefer, U., and Puhler, A. (1983) Bio/Technology 1, 784–791[CrossRef]
21. Donohue, T. J., and Kaplan, S. (1991) Methods Enzymol. 204, 459–485[Medline] [Order article via Infotrieve]
22. Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson, G. T., Farris, M. A., Roop, R. M., II, and Peterson, K. M. (1995) Gene 166, 175–176[CrossRef][Medline] [Order article via Infotrieve]
23. Zhen, Y., Qian, J., Follmann, K., Hayward, T., Nilsson, T., Dahn, M., Hilmi, Y., Hamer, A. G., Hosler, J. P., and Ferguson-Miller, S. (1998) Protein Expression Purif. 13, 326–336[CrossRef][Medline] [Order article via Infotrieve]
24. Mills, D. A., Tan, Z., Ferguson-Miller, S., and Hosler, J. (2003) Biochemistry 42, 7410–7417[CrossRef][Medline] [Order article via Infotrieve]
25. Bratton, M. R., Pressler, M. A., and Hosler, J. P. (1999) Biochemistry 38, 16236–16245[CrossRef][Medline] [Order article via Infotrieve]
26. Hosler, J. P., Fetter, J., Tecklenburg, M. M., Espe, M., Lerma, C., and Ferguson-Miller, S. (1992) J. Biol. Chem. 267, 24264–24272[Abstract/Free Full Text]
27. Vanneste, W. H. (1966) Biochemistry 5, 838–848[CrossRef][Medline] [Order article via Infotrieve]
28. García-Horsman, J. A., Berry, E., Shapleigh, J. P., Alben, J. O., and Gennis, R. B. (1994) Biochemistry 33, 3113–3119[CrossRef][Medline] [Order article via Infotrieve]
29. Mitchell, D. M., and Gennis, R. B. (1995) FEBS Lett. 368, 148–150[CrossRef][Medline] [Order article via Infotrieve]
30. Rich, P. R., and Moody, A. J. (1997) in Bioenergetics (Graber, P., and Milazzo, G., eds) pp. 418–456, Birkhauser Verlag Basel, Basel, Switzerland
31. Mitchell, R., Moody, A. J., and Rich, P. R. (1995) Biochemistry 34, 7576–7585[CrossRef][Medline] [Order article via Infotrieve]
32. Mitchell, R., and Rich, P. R. (1994) Biochim. Biophys. Acta 1186, 19–26[Medline] [Order article via Infotrieve]
33. Stevens, T. H., Martin, C. T., Wang, H., Brudvig, G. W., Scholes, C. P., and Chan, S. I. (1982) J. Biol. Chem. 257, 12106–12113[Abstract/Free Full Text]
34. Aasa, R., Albracht, P. J., Falk, K. E., Lanne, B., and Vanngard, T. (1976) Biochim. Biophys. Acta 422, 260–272[Medline] [Order article via Infotrieve]
35. Tweedle, M. F., Wilson, L. J., Garcia-Iniguez, L., Babcock, G. T., and Palmer, G. (1978) J. Biol. Chem. 253, 8065–8071[Abstract/Free Full Text]
36. Hunter, D. J., Moody, A. J., Rich, P. R., and Ingledew, W. J. (1997) FEBS Lett. 412, 43–47[CrossRef][Medline] [Order article via Infotrieve]
37. Mitchell, D. M., Aasa, R., delroth, P., Brzezinski, P., Gennis, R. B., and Malmström, B. G. (1995) FEBS Lett. 374, 371–374[Medline] [Order article via Infotrieve]
38. Bratton, M. R., Hiser, L., Antholine, W. E., Hoganson, C., and Hosler, J. P. (2000) Biochemistry 39, 12989–12995[CrossRef][Medline] [Order article via Infotrieve]
39. Hosler, J. P., Ferguson-Miller, S., Calhoun, M. W., Thomas, J. W., Hill, J., Lemieux, L., Ma, J., Georgiou, C., Fetter, J., Shapleigh, J., Tecklenburg, M., Babcock, G. T., and Gennis, R. B. (1993) J. Bioenerg. Biomembr. 25, 121–136[CrossRef][Medline] [Order article via Infotrieve]
40. Agostino, A., Invernizzi, F., Tiveron, C., Fagiolari, G., Prelle, A., Lamantea, E., Giavazzi, A., Battaglia, G., Tatangelo, L., Tiranti, V., and Zeviani, M. (2003) Hum. Mol. Genet. 12, 399–413[Abstract/Free Full Text]
41. Hiser, L., and Hosler, J. P. (2001) J. Biol. Chem. 276, 45403–45407[Abstract/Free Full Text]
42. Nijtmans, L. G., Taanman, J. W., Muijsers, A. O., Speijer, D., and Van den Bogert, C. (1998) Eur. J. Biochem. 254, 389–394[Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				Z. Wang, Y. Wang, and E. L. Hegg Regulation of the Heme A Biosynthetic Pathway: DIFFERENTIAL REGULATION OF HEME A SYNTHASE AND HEME O SYNTHASE IN SACCHAROMYCES CEREVISIAE J. Biol. Chem., January 9, 2009; 284(2): 839 - 847. [Abstract] [Full Text] [PDF]

				F. Pierrel, O. Khalimonchuk, P. A. Cobine, M. Bestwick, and D. R. Winge Coa2 Is an Assembly Factor for Yeast Cytochrome c Oxidase Biogenesis That Facilitates the Maturation of Cox1 Mol. Cell. Biol., August 15, 2008; 28(16): 4927 - 4939. [Abstract] [Full Text] [PDF]

				F. Fontanesi, C. Jin, A. Tzagoloff, and A. Barrientos Transcriptional activators HAP/NF-Y rescue a cytochrome c oxidase defect in yeast and human cells Hum. Mol. Genet., March 15, 2008; 17(6): 775 - 788. [Abstract] [Full Text] [PDF]

				O. Khalimonchuk, A. Bird, and D. R. Winge Evidence for a Pro-oxidant Intermediate in the Assembly of Cytochrome Oxidase J. Biol. Chem., June 15, 2007; 282(24): 17442 - 17449. [Abstract] [Full Text] [PDF]

				A. Zambrano, F. Fontanesi, A. Solans, R. L. de Oliveira, T. D. Fox, A. Tzagoloff, and A. Barrientos Aberrant Translation of Cytochrome c Oxidase Subunit 1 mRNA Species in the Absence of Mss51p in the Yeast Saccharomyces cerevisiae Mol. Biol. Cell, February 1, 2007; 18(2): 523 - 535. [Abstract] [Full Text] [PDF]

				F. Fontanesi, I. C. Soto, D. Horn, and A. Barrientos Assembly of mitochondrial cytochrome c-oxidase, a complicated and highly regulated cellular process Am J Physiol Cell Physiol, December 1, 2006; 291(6): C1129 - C1147. [Abstract] [Full Text] [PDF]

				H. S. Carr, A. B. Maxfield, Y.-C. Horng, and D. R. Winge Functional Analysis of the Domains in Cox11 J. Biol. Chem., June 17, 2005; 280(24): 22664 - 22669. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 280/18/17652    most recent C500061200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Smith, D. Articles by Hosler, J. P. Search for Related Content PubMed PubMed Citation Articles by Smith, D. Articles by Hosler, J. P. Social Bookmarking                      What's this?