HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 280, Issue 18, 18291-18301, May 6, 2005

This Article Abstract Full Text (PDF) All Versions of this Article: 280/18/18291    most recent M500080200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Füzesi, M. Articles by Karlish, S. J. D. Search for Related Content PubMed PubMed Citation Articles by Füzesi, M. Articles by Karlish, S. J. D. Social Bookmarking                      What's this?

Covalent Cross-links between the Subunit (FXYD2) and and Subunits of Na,K-ATPase

MODELING THE - INTERACTION^*

Maria Füzesi, Kay-Eberhard Gottschalk, Moshit Lindzen, Alla Shainskaya, Bernhard Küster¶||, Haim Garty**, and Steven J. D. Karlish

From the Department of Biological Chemistry and Biological Mass Spectrometry Facility, Weizmann Institute of Science, Rehovoth, 76100, Israel, and the ^¶Protein Interaction Laboratory, University of Southern Denmark, Campusvej 55, 5230 Odense M, Denmark

Received for publication, January 4, 2005 , and in revised form, February 25, 2005.

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
This study describes specific intramolecular covalent cross-linking of the to and to subunits of pig kidney Na,K-ATPase and rat to co-expressed in HeLa cells. For this purpose pig a and b sequences were determined by cloning and mass spectrometry. Three bifunctional reagents were used: N-hydroxysuccinimidyl-4-azidosalicylic acid (NHS-ASA), disuccinimidyl tartrate (DST), and 1-ethyl-3-[3dimethylaminopropyl]carbodiimide (EDC). NHS-ASA induced -, DST induced - and -, and EDC induced primarily - cross-links. Specific proteolytic and Fe²⁺-catalyzed cleavages located NHS-ASA- and DST-induced - cross-links on the cytoplasmic surface of the subunit, downstream of His²⁸³ and upstream of Val⁴⁴⁰. Additional considerations indicated that the DST-induced and NHS-ASA-induced cross-links involve either Lys³⁴⁷ or Lys³⁵² in the S4 stalk segment. Mutational analysis of the rat subunit expressed in HeLa cells showed that the DST-induced cross-link involves Lys⁵⁵ and Lys⁵⁶ in the cytoplasmic segment. DST and EDC induced two - cross-links, a major one at the extracellular surface within the segment Gly¹⁴³-Ser³⁰² of the subunit and another within Ala¹-Arg¹⁴². Based on the cross-linking and other data on - proximities, we modeled interactions of the transmembrane -helix and an unstructured cytoplasmic segment SKRLRCGGKKHR of with a homology model of the pig 1 subunit. According to the model, the transmembrane segment fits in a groove between M2, M6, and M9, and the cytoplasmic segment interacts with loops L6/7 and L8/9 and stalk S5.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The Na,K-ATPase actively pumps Na⁺ ions out of cells and K⁺ ions into cells and maintains the characteristic transmembrane electrochemical gradients of Na⁺ and K⁺ ions. As could be expected for a protein with such a central physiological role, Na,K-ATPase is closely regulated at several levels.

Recently a unique mode of regulation of the Na,K-ATPase has been described (for reviews, see Refs. 1-3). It involves interactions between the / complex and members of a family of seven short single span transmembrane proteins termed the FXYD proteins (4). Four members of the family, FXYD1 (PLM),¹ FXYD2 (), FXYD4 (CHIF), and FXYD7, are now known to interact specifically with the Na,K-ATPase and alter the pump kinetics in characteristic and different ways. The FXYD proteins show a highly tissue-specific expression pattern: is expressed in kidney, CHIF is expressed in kidney and colon, PLM is expressed in heart and skeletal muscle, and FXYD7 is expressed in brain. In kidney is expressed as two splice variants, a and b (4, 5). Splicing in other FXYD proteins has not been detected at the protein level. The working hypothesis is that FXYD proteins function as tissue-specific modulators of Na,K-ATPase that adjust or fine-tune its kinetic behavior to the specific needs of the given tissue, cell type, or physiological state (1-3).

Functional interactions between the subunit and the Na,K-ATPase have now been studied extensively after coexpression with the / subunits in mammalian cells and Xenopus oocytes or by neutralizing interactions with a specific anti- antibody (6-10). In cultured mammalian cells raises apparent affinity for ATP by shifting the E₁-E₂ conformational equilibrium toward E₁, reduces apparent affinity for cytoplasmic Na⁺ by making cytoplasmic K⁺ a better competitor (8-10), and slightly reduces extracellular K⁺ affinity (11). Anti-C (directed against the sequence KHRQVNEDEL at the C terminus of rat ) abrogates the effect of on the apparent ATP affinity in renal Na,K-ATPase or HeLa cells transfected with but not that on the K⁺ to Na⁺ antagonism (7, 8, 10). In oocytes, reduces affinity for cell Na⁺ and evokes a small increase in the extracellular K⁺ affinity, which varies with voltage (6). In HeLa and HEK293 cells and Xenopus oocytes small or insignificant differences in functional effects are found between b and a (Refs. 10 and 12, but see Ref. 13). In Xenopus oocytes (12) and mammalian cells (14) CHIF raises the apparent affinity for cell Na⁺ by 2-3-fold, the reverse effect to that of . In HeLa cells, CHIF has no effect on the affinity for external K⁺ or ATP (14), whereas in Xenopus oocytes an increased K_0.5 to external K⁺ was observed at high voltages and in the presence of external Na⁺ (12). The opposite functional effects of CHIF and on the apparent Na⁺ affinity are consistent with their different patterns of expression along the nephron and physiological roles (for reviews, see Refs. 1-3).

When expressed in Xenopus oocytes PLM interacts with both the 11 and 21 isoforms and decreases the internal Na⁺ affinity of the pump by about 2-fold and external K⁺ affinity by a small amount (15), whereas use of an anti-PLM antibody on choroid plexus membranes suggested that PLM might increase Na,K-ATPase activity (16). FXYD7 is the fourth family member whose functional interaction with the Na,K-ATPase has been demonstrated. In Xenopus oocytes FXYD7 decreases the apparent K⁺ affinity of the pump when expressed with 11 or 21 but not with 31 (2).

By comparison with functional studies there is little information on structural interactions of FXYD proteins with / subunits. It is, however, becoming clear that there are multiple sites of interaction, involving both transmembrane segments and the extramembrane domains. The fact that the anti-C abrogates the effect of on the apparent ATP affinity but not that on the K⁺ to Na⁺ antagonism (8, 10) provided an initial indication. In addition, in HeLa cells expression of with either C- or N-terminal truncated sequences removes the effect on ATP affinity but does not affect the K⁺ to Na⁺ antagonism (17). In a recent systematic study of roles of the different segments, a series of /CHIF chimeric molecules was prepared in which extracellular, transmembrane, and cytoplasmic sequences were interchanged (18). It was found that both the stability of the FXYD-/ complex in detergent and the effects on the apparent Na⁺ affinity were determined by the origin of the transmembrane segment. Interestingly, however, different residues appear to be involved in the stability and functional effects of the transmembrane segments. The functional role of the transmembrane segments has been confirmed in a study showing that peptides corresponding to the transmembrane segment of reduce apparent Na⁺ affinity of the / complex in HeLa cell membranes as found previously for full-length transfected (19). In short, extramembrane segments mediate the effect of on apparent ATP affinity, whereas transmembrane segments mediate the effect on cation affinities.

Where do FXYD proteins interact with the / complex? On the basis of cryoelectron microscopy of renal Na,K-ATPase electron densities were assigned as transmembrane helices of , , and subunits. The subunit helix was proposed to lie in a groove bounded by M2, M6, and M9 of the subunit (20). A denaturation study suggested that might interact in the M8-M10 region (21). Recently a role for M9 of the subunit has been inferred from effects of mutants in M9 on stability of /-, /-CHIF, or /-FXYD7 complexes and their functional consequences studied in Xenopus oocytes (22). Leu⁹⁶⁴ and Phe⁹⁶⁷ were important for stability of the complexes, whereas Phe⁹⁵⁶ and Glu⁹⁶⁰ were required for mediation of effects of the FXYD protein on K⁺ affinity. Thus, stabilizing and functional interactions were separable as found also in mutational studies in CHIF/ chimera (23). Interestingly the Phe⁹⁵⁶ and Glu⁹⁶⁰ mutations did not alter effects of and CHIF on Na⁺ affinity, implying that still other interactions in the transmembrane segment mediate these effects. Modeling of the FXYD helix was consistent with docking in the groove between M2, M6, and M9.

The present work has utilized a different approach, namely covalent cross-linking, to obtain direct evidence for proximities between the subunit and and subunits of pig kidney Na,K-ATPase and in HeLa cells expressing rat and subunits. We have used a variety of bifunctional reagents with different chemical specificities and arm lengths, optimized cross-linking efficiency, and determined the approximate positions of observed - and - cross-links. Based on the inferred position of - cross-links in the cytoplasmic domains of the and subunits, we have modeled the - interactions.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Pig Kidney Na,K-ATPase: Preparations and Detergent Solubilization
Partially purified Na,K-ATPase from pig kidney outer medulla was prepared as described previously (24). Extensively trypsinized 19-kDa membranes were prepared as described previously (25). Membranes were solubilized by the non-ionic detergent C₁₂E₁₀ (polyoxyethylene 10-lauryl ether) in the presence of Rb⁺ plus ouabain or Na⁺ plus oligomycin as described previously (14).

HeLa Cell Expression of a or b
HeLa cells overexpressing the rat 1 subunit of Na,K-ATPase were kindly provided by Dr. J. B Lingrel, University of Cincinnati College of Medicine, Cincinnati, OH. Cells were transfected with wild type and mutated rat constructs subcloned into pIREShyg. Transfection was done using Polyfect (Qiagen) according to the manufacturer's instructions. Colonies stably expressing proteins were selected in 400 µg/ml hygromycin B and tested for maximal expression of by Western blotting.

Covalent Cross-linking
NHS-ASA—Purified pig kidney Na,K-ATPase or 19-kDa membranes were suspended in 10 mM sodium borate, pH 9.5, 130 mM NaCl or 10 mM HEPES, pH 8, 130 mM NaCl to 0.5 mg/ml protein concentration. NHS-ASA (26) dissolved in Me₂SO was added to 0.25-1 mM in three aliquots and incubated at room temperature in the dark for 30 min. The reaction was quenched by 50 mM unbuffered Tris. The pH of the suspension was restored to near neutral with 100 mM HEPES, pH 7.4, and the suspension was illuminated for 2 min with a xenon lamp (150 watts, fitted with a filter cutting off light below 300 nm). Where indicated, the membranes were pelleted and resuspended in the detergent solubilization buffer: 25 mM imidazole, pH 7.5, 1 mM EDTA and either 10 mM RbCl plus 5 mM ouabain (pig kidney enzyme) or 20 mM NaCl plus oligomycin 0.1 mg/ml (pig kidney enzyme, HeLa cells). C₁₂E₁₀ was added at 1 mg/ml. The soluble fraction was separated by centrifugation at 100,000 x g and was illuminated with the UV lamp for 2 min. The sample was denatured with 2% SDS, and protein was precipitated by 4 volumes of methanol:diethyl ether (2:1, v/v). Pellets were dried in N₂ and suspended in gel sample buffer.

DST—Purified kidney enzyme was suspended in 10 mM HEPES, pH 8, 250 mM NaCl or 30 mM Rb⁺ plus 220 mM choline at 0.5-1 mg/ml protein, or the Na,K-ATPase was solubilized with C₁₂E₁₀ in 10 mM HEPES, pH 8, in the presence of 10 mM RbCl plus 5 mM ouabain or 20 mM NaCl plus oligomycin. HeLa cell membranes were solubilized with C₁₂E₁₀ in the presence of Na⁺/oligomycin. 19-kDa membranes were suspended in 10 mM RbCl, 10 mM Na-HEPES, pH 7.4. DST (27) in Me₂SO was added to a final concentration of 2 mM followed by incubation for 30 min at room temperature. The reaction was quenched with 50 mM unbuffered Tris.

EDC—Purified kidney enzyme was suspended in 100 mM MES, pH 6, 250 mM NaCl or 30 mM Rb⁺ plus 220 mM choline to 0.5-1 mg/ml protein. Alternatively the Na,K-ATPase was solubilized with 1 mg/ml C₁₂E₁₀ in media containing 100 mM MES, pH 6, 10 mM RbCl plus 5 mM ouabain or 20 mM NaCl plus oligomycin. 19-kDa membranes were suspended in 100 mM MES, pH 6, 10 mM RbCl, and 140 mM choline chloride. 1 mM EDC (28) and 5 mM N-hydroxysuccinimide (NHS) dissolved in water were added, and the mixture was incubated for 2 h at room temperature. The cross-linking was stopped by addition of 10 mM hydroxylamine.

Deglycosylation
Cross-linked native enzyme or 19-kDa membranes (30-40 µg) were treated with PNGase F (125 units, New England Biolabs) for 24 h at 37 °C in a medium containing 20 mM Tris·HCl, pH 8.0, 10 mM RbCl after denaturation in the buffers supplied with the PNGase. The digestion was arrested by addition of concentrated gel sample buffer.

Chymotryptic Cleavages
Purified kidney enzyme or NHS-ASA-cross-linked membranes were suspended in 10 mM HEPES, pH 7.4, containing either 20 mM RbCl or 20 mM NaCl (0.1 mg/ml protein) and incubated with 1:20 chymotrypsin (mg/mg of protein) for 15 min (see Refs. 29 and 30). The enzymatic digestion was stopped by 10 volumes of ice-cold HEPES buffer containing 1 mM phenylmethylsulfonyl fluoride and 150 mM RbCl.

Fe²⁺-catalyzed Oxidative Cleavage
Purified kidney enzyme or NHS-ASA-cross-linked membranes were suspended in 10 mM HEPES, pH 7.4, in the presence of either 130 mM Na⁺ E₁Na or 130 mM NaCl, and 40 µM AMPPNP. The enzyme in E₁Na conformation was incubated with 5 mM ascorbic acid, 5 mM H₂O₂, 5 µM Fe²⁺ for 15-20 min, and the cleavage was stopped by addition of sample buffer containing 5 mM Desferal (see Refs. 31-33).

SDS-PAGE and Western Blots
Proteins were separated on 10% SDS-Tricine gels (34) and blotted to polyvinylidene difluoride membranes. Western blots utilized the following antibodies as indicated: affinity-purified anti-C, polyclonal antibody raised against the peptide KHRQVNEDEL at the C terminus of the rat subunit (dilution, 1:250); affinity-purified anti-KETYY, polyclonal antibody raised against KETYY at the C terminus of the subunit (dilution, 1:4000); a monoclonal antibody (6H) recognizing a sequence within the first 23 residues at the N terminus of the subunit (dilution, 1:5000); anti-50, polyclonal antibody raised against a 50-kDa tryptic fragment of the subunit, Gly¹⁴³-Ser³⁰² (dilution, 1:4000); and anti-16, polyclonal antibody raised against a 16-kDa tryptic fragment of subunit, Ala¹-Arg¹⁴² (dilution, 1:1000).

Mass Spectrometry
Pig a and b were extracted from gels with organic solvents, or gel pieces were subjected to tryptic digestion as described previously (5). The sequences were determined by a combination of mass measurements of intact subunits and tryptic peptides and direct sequencing by tandem mass spectrometry as described previously (5). Mass spectra were acquired on an Q-STAR Pulsarⁱ electrospray-quadrupole time-of-flight tandem mass spectrometer containing a quadrupole collision cell (MDS-Sciex) and equipped with a nanoelectrospray source (Proxeon Biosystems).

Peptide Fingerprinting
Peptide fingerprinting was performed on a Bruker Reflex III^TM matrix-assisted laser desorption ionization time-of-flight mass spectrometer (Bruker, Bremen, Germany) equipped with a delayed extraction ion source, a reflector, and a 337 nm nitrogen laser.

Cloning of Pig a
The EST data base contains only one expressed sequence tag entry corresponding to pig a (BX674298 [GenBank] ). To verify the amino acid sequence of this protein, pig a was cloned by reverse transcription-PCR. Pig kidney RNA was reverse transcribed from the poly(A) tail and then amplified using the primers GCAGGAAGAGGGCAGTGG (5') and TGCGATGGGGGCACAGCCGA (3'). The 270-bp product was sequenced from both ends and found to correspond to a. To exclude PCR errors, sequencing was repeated for two independent reactions of reverse transcription and amplification. The nucleotide sequence of pig a has been deposited in GenBank^TM under accession number AY941203 [GenBank] .

Modeling the - Interaction
Homology Modeling of Pig 1 Subunit—The alignment used by Li and co-workers (22) for Ca-ATPase and Bufo Na,K subunits was modified to the appropriate Ca-ATPase and pig Na,K 1 subunit alignments. The sequence alignment was converted to a structure using the homology-modeling program package Modeler6 v. 2 with default settings (35, 36) and the crystal structure of Ca-ATPase in the ATP-bound form (37, 38) as template. 50 structures were generated using different initial random velocities for all atoms. The best model was chosen based on the in-built objective function, which uses stereochemical parameters as well as similarity to the template to rank the models.

Positioning the Transmembrane Helix of the Subunit—Following the approach by Li and co-workers (22), the TM helix of was designated to include residues Arg²⁶-Ser⁴⁶ and was manually positioned between helices M2, M6, and M9. Starting from this initial conformation, 50,000 different random conformations were generated by randomly rotating the helix 0-360° around the long axis; translating it -3 to +5 Å toward or away from the center of the bundle, respectively; translating the helix ±10 Å along its long axis; and tilting the helix relative to the fixed angles of the TM helices of the subunit by ±20°. The coordinate transformations were done using the program package CNS (39) with the OPLS (40) parameter set. Each such generated conformation was subjected to 50 steps of Powell minimization, and the Van der Waals interaction energy of the -helix with the subunit was calculated. All degrees of freedom were sampled in 20 bins per parameter. The average energy of each bin was evaluated independently by using Boltzmann averaging of all conformations within this bin. After Boltzmann averaging the minimal average energy of the parameter in question was taken as that at the center of the bin of lowest energy. A related procedure has been shown to successfully reproduce structures of four-helix bundles (41, 42).

View larger version (16K): [in this window] [in a new window]   FIG. 1. Structures of NHS-ASA, DST, and EDC.

In a first step the / angles of the backbone were adjusted so that the segment came into contact with the subunit without backbone clashes and so that side chains of acidic residues of the subunit came into proximity with the side chains of Lys⁵⁴, Lys⁵⁵, His⁵⁶, and Arg⁵⁷. In a second step, a rotameric search of each individual contact side chain for both and subunits was performed to optimize the side-chain packing. The two steps were iterated until no clashes occurred.

Refinement—The initial model was refined with a short molecular dynamics protocol in vacuo using the molecular dynamics package Gromacs (45, 46) and the Gromos96 vacuum force field (47). To relieve steric strain, 5000 steps of steepest descent minimization were performed followed by 100 ps of molecular dynamics at 300 K with a restrained backbone followed by another 100 ps of free molecular dynamics without any restraints. In a final step, 5000 steps of conjugate gradient minimization were performed. Although the complex membrane-water interface is not well reproduced by a simulation in vacuo, the emphasis of our calculation was less on observing the dynamics of the system and more on relieving local stress induced by the interactive modeling. After the short run, the root mean square deviation between the initial and final conformation was less than 2 Å.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Fig. 1 shows structures of the three cross-linkers used in this study. NHS-ASA is a heterobifunctional, 8-Å spacer, photoactivated reagent. The NHS ester reacts with lysine residues, whereas the arylnitrene can react with double bonds, insert into C-H and N-H bonds, or undergo subsequent ring expansion to react with a nucleophile (e.g. primary amines and thiols). DST is a homobifunctional, lysine-specific reagent with a spacer arm of 6.4 Å. EDC activates carboxyls that couple with primary amines to generate peptide bonds, producing a zero length cross-link. The EDC cross-linking is done in the presence of NHS, which increases the yield (28).

View larger version (17K): [in this window] [in a new window]   FIG. 2. Alignment of pig a and b sequences with human and rat a. The pig a amino acid sequence was deduced by sequencing a reverse transcription-PCR product. Underlined segments were determined by full sequencing of tryptic peptides using mass spectrometry (see Ref. 5). Mass spectrometry also provided the unique b N-terminal sequence.

NHS-ASA-induced - Cross-link on Pig Kidney Na, K-ATPase—Fig. 3 shows representative experiments demonstrating a specific intramolecular cross-link between and subunits and controls to exclude possible artifacts. The pig kidney Na,K-ATPase was first incubated with NHS-ASA in the dark at alkaline pH, and then the pH was restored to 7.4 prior to illumination with UV light. Optimization experiments showed the most efficient cross-linking with 1 mM NHS-ASA, pH 9.5, in the dark reaction and an illumination time of 2 min. In the lane marked NHS-ASA in Fig. 3A, the - cross-link was visualized in an immunoblot using an anti-C antibody. In the lane marked C, the enzyme was first dissolved in SDS prior to the reaction with NHS-ASA. The lack of cross-linking in this condition indicates that a native structure of the protein is required and excludes the possibility of unselective - cross-linking induced by the NHS-ASA during solubilization with SDS prior to application to gels. Another possible artifact, particularly for membrane proteins at a high concentration such as the Na,K-ATPase, is that molecules that have reacted with the bifunctional reagent can collide randomly with other molecules in the membrane and produce intermolecular cross-links. The experiment in Fig. 3B excluded this possibility. The renal enzyme was first incubated with NHS-ASA, the pH was restored to 7.4, and the membranes were then dissolved in a non-ionic detergent, C₁₂E₁₀, in the dark prior to illumination of the C₁₂E₁₀-soluble protein. Solubilization was done in the presence either of Rb⁺ plus ouabain or Na⁺ plus oligomycin, conditions known to preserve Rb⁺ or Na⁺ occlusion, respectively, and a native structure of the protein (14). When dissolved in the detergent, the protein concentration was diluted by at least 4 orders of magnitude by comparison with that in the membrane-bound state, thus greatly reducing the chance of random collision. The observation of the cross-link even after solubilization in C₁₂E₁₀ provides a strong indication for a specific intramolecular cross-link. Cross-linking was more efficient in the presence of Na⁺/oligomycin compared with Rb⁺/ouabain, suggesting a possible conformation dependence. The latter possibility was tested more systematically in Fig. 3C, which looked at the effect of the presence of either Rb⁺ or Na⁺ ions in either the dark or light stages, and as seen, Na⁺ ions in only the dark stage amplified the cross-linking efficiency. In these optimal conditions, which were used for all subsequent cross-linking experiments, up to 50% of the subunit could be cross-linked.

Fig. 3D shows the use of 19-kDa membranes to assign the sidedness of the cross-link. 19-kDa membranes are produced by extensive tryptic digestion of renal Na,K-ATPase. The cytoplasmic domains of the subunit are removed, leaving membrane-bound fragments (25, 48). The subunit is partially cleaved to 16-kDa and 50-kDa fragments, and a and b subunits are intact (49) (see the schematic model in Fig. 5A). Fig. 3D shows that treatment of 19-kDa membranes with NHS-ASA produced no cross-linked bands of the subunits. Thus in native Na,K-ATPase the cross-link must be located on a cytoplasmic residue of the subunit, which has been removed in 19-kDa membranes.

A similar conclusion on sidedness comes from an observation that the anti-C antibody blocked cross-linking with NHS-ASA (Fig. 4). The - cross-link was largely suppressed, and a faster running band recognizing the anti-C appeared. This new immunoreactive band was shown to be the heavy chain of the antibody itself because it was adsorbed to protein A beads after denaturation with SDS. The small amount of the remaining - cross-linked protein was not adsorbed and remained in the supernatant. The results of this experiment suggest strongly that the cross-link lies near the epitope of the subunit on the cytoplasmic surface.

Figs. 6 and 7 show how selective chymotryptic and Fe²⁺-catalyzed oxidative cleavages of the control and cross-linked enzyme were used to locate the position of the NHS-ASA cross-link to a limited segment of the subunit (see the cleavage sites in Fig. 5B). The strategy was to demonstrate which known fragments of the subunit do or do not also recognize the anti-C antibody.³ As seen in Fig. 6A, in an E₂Rb conformation, two well characterized chymotryptic fragments, Val⁴⁴⁰-Tyr¹⁰¹⁶ and Ala⁵⁸⁹-Try¹⁰¹⁶, were detected with anti-KETYY, which recognizes the C terminus of the subunit. Neither of these fragments was recognized by the anti-C. The fragments that were recognized by the anti-C are identifiable as (a) the complementary fragment Gly¹-Val⁴⁴⁰ and (b) probably a secondary cleavage fragment of the complement to Gly¹-Ala⁵⁸⁹ (Fig. 6, asterisk). The experiment shows that the cross-link must be located upstream of Val⁴⁴⁰. In an E₁Na conformation a major fragment Ile²⁶³-Tyr¹⁰¹⁶ was detected by anti-KETYY (Fig. 6B). Closer inspection showed that it consists of two fragments, which correspond to the chymotryptic fragments of the uncross-linked and cross-linked subunit, respectively. The upper of the two fragments was also recognized by anti-C. Thus the experiment shows that the cross-link lies within this fragment and is located downstream of Ile²⁶³. The Fe²⁺ cleavage experiments of Fig. 7, A and B, confirmed and extended these conclusions. In an E₁Na conformation, Fe²⁺/ascorbate/H₂O₂ treatment produced two fragments of the subunit recognized by anti-KETYY, Glu⁸⁰-Tyr¹⁰¹⁶ and His²⁸³-Tyr¹⁰¹⁶ (32, 50). Cleavage of the cross-linked product produced the same fragments, including a broader band, presumably a doublet corresponding to the His²⁸³-Tyr¹⁰¹⁶ fragment of uncross-linked and cross-linked subunit, respectively. The upper His²⁸³-Tyr¹⁰¹⁶ fragment was also recognized by anti-C. The complementary fragment Gly¹-His²⁸³ was recognized by antibody 6H, which has an epitope near the N terminus of the subunit, but was not recognized by anti-C. The experiment indicates the presence of the cross-link in the His²⁸³-Tyr¹⁰¹⁶ fragment and locates it downstream of His²⁸³. Fig. 7B shows results of incubation with AMPPNP-Fe/ascorbate/H₂O₂, which produced two well characterized fragments recognized by anti-KETYY, Val⁴⁴⁰-Tyr¹⁰¹⁶ and Val⁷¹²-Tyr¹⁰¹⁶ (33, 50), in both the control and cross-linked preparations. Neither of these fragments was recognized by anti-C. A fragment that was not recognized by anti-C, but was recognized by the anti-N-terminal antibody, was identified as Gly¹-Val⁷¹². This experiment confirms that the cross-link lies upstream of Val⁴⁴⁰. In summary, the inferences from Figs. 6 and 7 are that the cross-link is located upstream of His²⁸³ and downstream of Val⁴⁴⁰ on the cytoplasmic side.

View larger version (35K): [in this window] [in a new window]   FIG. 3. NHS-ASA-induced cross-linking of and subunits. Shown are immunoblots probed with anti-C antibody. A, membrane-bound renal Na,K-ATPase was treated with NHS-ASA at pH 9.5 in the dark, the pH was restored to 7.4, and the suspension was then illuminated as described under "Materials and Methods." In the lane marked C the enzyme was dissolved in 2% SDS prior to the reaction with NHS-ASA. B, cross-linking of C12E10-soluble protein. The dark reaction at pH 9.5 preceded solubilization in media containing Rb+/ouabain or Na+/oligomycin and then illumination as indicated under "Materials and Methods." C, the dark reaction was carried out in media containing either 30 mM RbCl, 100 mM choline chloride, or 130 mM NaCl; the membranes were then pelleted and resuspended in media containing either Rb+/ouabain or Na+/oligomycin prior to illumination. D, 19-kDa membranes were incubated with NHS-ASA as described under "Materials and Methods."

View larger version (25K): [in this window] [in a new window]   FIG. 4. Inhibition of NHS-ASA-induced - cross-linking by anti-C. The renal Na,K-ATPase was treated with NHS-ASA at pH 9.5 in the dark, the pH was restored to 7.4, the protein was dissolved in C12E10, anti-C was added at 1:10 dilution where indicated, and then the suspension was illuminated. After illumination an aliquot was treated with 1% SDS to disrupt non-covalent complexes; then 10 volumes of 50 mM Tris·HCl, pH 7.4, 5 mM EDTA, 150 mM NaCl, and 1% Triton X-100 (TENT solution) was added followed by 30 µl of protein A beads; and the slurry was incubated overnight at 4 °C. The supernatant was removed by centrifugation, and protein was precipitated with methanol:ether. Protein bound to the beads was released by gel sample buffer. C, control; Ab, antibody; Sup, supernatant.

View larger version (53K): [in this window] [in a new window]   FIG. 5. Schematic models of "19-kDa membranes" (A) and positions of specific chymotryptic or Fe2+-catalyzed cleavages (B). Chy, chymotrypsin.

We tried but were not able to locate the cross-link more exactly by direct methods such as mass spectrometry of the digested cross-linked polypeptide. However, as argued in the "Discussion," there is good reason to think the cross-link is located in the cytoplasmic stalk S4, emerging from transmembrane segment M4.

View larger version (36K): [in this window] [in a new window]   FIG. 6. Specific chymotryptic cleavage of the NHS-ASA-induced - cross-link. Membrane-bound Na,K-ATPase was treated with NHS-ASA as described under "Materials and Methods." Aliquots of the untreated (C) and NHS-ASA-treated enzyme were digested with -chymotrypsin (CHY) in Rb+-containing media (A) or Na+-containing media (B). Samples were applied to gels, and immunoblots were developed either with anti-KETYY or anti-C. *, unknown chymotryptic fragment.

View larger version (37K): [in this window] [in a new window]   FIG. 7. Specific Fe2+-catalyzed oxidative cleavage of the NHS-ASA-induced - cross-link. Membrane-bound Na,K-ATPase was treated with NHS-ASA as described under "Materials and Methods." Aliquots of the untreated (C) and NHS-ASA-treated enzyme were cleaved with Fe2+/ascorbate/H2O2 in Na+-containing media (E1Na conformation) (A) or Na+- and AMPPNP-containing media (E1AMPPNP-Fe conformation) (B) as described under "Materials and Methods." Samples were applied to gels, and immunoblots were developed either with anti-KETYY, anti-N terminus (6H), or anti-C.

View larger version (23K): [in this window] [in a new window]   FIG. 8. DST-induced - and - cross-links. Membrane-bound Na,K-ATPase was treated with 2 mM DST in Na+-containing medium at pH 8 or 9 (right) or in a Rb+- or Na+-containing medium at pH 9 (left), or the protein was first solubilized with C12E10 in the presence of Rb+/ouabain (ou.) or Na+/oligomycin (oli.) (middle) as described under "Materials and Methods." Controls (C) refer to enzyme treated with 2% SDS and then with DST.

View larger version (51K): [in this window] [in a new window]   FIG. 9. Specific chymotryptic and Fe2+-catalyzed cleavage of DST-induced - cross-link. Membrane-bound Na,K-ATPase was treated with DST as described under "Materials and Methods." Aliquots of the untreated (C) and DST-treated enzyme were digested with -chymotrypsin (Chy) in Rb+-containing or Na+-containing media (A) or cleaved with Fe2+/ascorbate/H2O2 in a Na+-containing medium (B). A sample of the enzyme digested with chymotrypsin was also treated with PNGase. Samples were applied to gels, and immunoblots were developed either with anti-KETYY or anti-C. Degly., deglycosylated. *, unknown chymotryptic fragment.

View larger version (62K): [in this window] [in a new window]   FIG. 10. DST-induced - cross-links in 19-kDa membranes. 19-kDa membranes suspended in a Rb+-containing medium at pH 7.4 were treated with 2 mM DST for 30 min at room temperature. Controls (C) refer to 19-kDa membranes pretreated with 2% SDS and then with DST. The blots were probed with anti-C, anti-50, or anti-16 antibodies. An aliquot was also treated overnight with PNGase prior to application to the gel. Degly., deglycosylated.

View larger version (58K): [in this window] [in a new window]   FIG. 11. Mutational analysis of DST-induced cross-link on expressed in HeLa cells. Membranes were solubilized and treated with DST or NHS-ASA as described under "Materials and Methods." The amounts of membranes applied to each lane were corrected for the level of expression of the subunit in each condition to allow comparisons of the effects of the different mutations. Blots were developed with anti-C. sol., solubilized; C, control.

View larger version (63K): [in this window] [in a new window]   FIG. 12. EDC-induced - cross-links in intact renal Na,K-ATPase and 19-kDa membranes. A, membrane-bound or C12E10-solubilized Na,K-ATPase was treated with 1 mM EDC plus 5 mM NHS at pH 6 for 2 h at room temperature (see "Materials and Methods"). Controls (C) refer to enzyme pretreated with 2% SDS and then with EDC. The immunoblot was developed with anti-C. B, 19-kDa membranes suspended in a Rb+-containing medium at pH 6 were treated with 1 mM EDC plus 5 mM NHS for 2 h at room temperature. Controls (C) refer to enzyme pretreated with 2% SDS and then with EDC. Aliquots were treated overnight with PNGase prior to application to the gel. The blots were probed with anti-C, anti-50, or anti-16 antibodies. ou., ouabain; oli., oligomycin.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The first point to make is that NHS-ASA and DST cross-link the same regions of the and subunits at the cytoplasmic side, whereas DST and EDC cross-link the same regions of and subunits at the extracellular side. The fact that bifunctional reagents with different chemical specificities cross-link the subunit with or subunits in both pig and rat and the same regions of cross-linking are involved in the different - and - cross-links provides a strong indication that they are specific intramolecular cross-links and that they occur in regions of subunit interactions. Although NHS-ASA is an efficient cross-linker and was very useful for establishing criteria for specific cross-links and the initial analysis of the site of the cross-link, a detailed analysis was complicated by the lack of knowledge of which chain, or , contains the reacted lysine. Use of DST, which creates specific lysine-lysine cross-links, avoids this ambiguity and eventually provided more detailed information.

Locating the - Cross-link—The mutation work with HeLa cells showed that the DST-induced cross-link involved Lys⁵⁵ and Lys⁵⁶ in the cytoplasmic segment. Conversely the analysis showed that NHS-ASA cross-link does not involve lysines on the subunit, and thus the lysine modified in the dark reaction must be located on the subunit. Because both DST and NHS-ASA are N-hydroxysuccinimide esters, the same lysine on the subunit could be involved in the DST-induced cross-link and the dark reaction of NHS-ASA. We have not attempted to identify the residue of involved in the NHS-ASA light reaction by mutational analysis because the nitrene is not specific and could react with more than one proximal residue.

Both DST- and NHS-ASA-induced - cross-links were amplified in Na⁺-containing media, which stabilizes the E₁Na conformation. Presumably the - interaction is responsible for the functional effect of on the apparent ATP affinity for Na,K-ATPase, which has been shown to be an indirect result of stabilization of the E₁ conformation (10). Amplification of the cross-link in E₁ is consistent with this interpretation for if interacts with to stabilize E₁, the principle of linked equilibria requires that stabilization of E₁ by a different ligand (Na⁺ ions) should strengthen the - interaction. The functional effect of on the apparent ATP affinity, like the NHS-ASA-mediated cross-link, was abrogated by the anti-C. Inhibition of the NHS-ASA-induced cross-link by the anti-C is suggestive of a position nearer the C terminus than Lys⁵⁴ or Lys⁵⁵ within the epitope His⁵⁶-Lys⁶⁴.

The combination of extensive and controlled cleavages of the DST-induced and NHS-ASA-induced cross-linked products showed that in both cases the cross-link on the subunit lies at the cytoplasmic side, downstream of His²⁸³ and upstream of Val⁴⁴⁰. In reality, however, there are more stringent constraints than revealed directly by the experiments. First, His²⁸³ is itself located at the cytoplasmic entrance of M3 (see Fig. 5), and because neither NHS-ASA-nor DST-mediated cross-links can be in M3, the extracellular L3-4, or M4, one can infer that they are, in fact, located after the cytoplasmic exit of M4 and before Val⁴⁴⁰. Second, because the DST-mediated cross-link on the subunit is located on Lys⁵⁴ or Lys⁵⁵, 10 or 11 residues from the cytoplasmic exit of the transmembrane segment (L4-5) (pig numbering, see Fig. 2), the cross-linked residues in the subunit are unlikely to be much further away from the cytoplasmic exit of M4, i.e. they are likely to be located within the S4 cytoplasmic stalk segment (Thr³³⁸-Glu³⁵⁸). Third, there are only three candidate lysines within 15 residues of the exit of M4, Lys³⁴², Lys³⁴⁷, and Lys³⁵², and the only other lysines upstream of Val⁴⁴⁰, Lys³⁷⁰, Lys⁴⁰⁶, and Lys⁴³⁸, are 33, 69, and 101 residues distant from the end of M4, respectively. Fourth, of the three most likely candidates, Lys³⁴², Lys³⁴⁷, and Lys³⁵², Lys³⁴² can be excluded. This arises from the fact that Lys³⁴² is the first tryptic cleavage site after M4. The C-terminal residue of the M3-M4 fragment of 19-kDa membranes is not exactly known, although Arg³⁴⁶ or Arg³⁴³ are likely possibilities; but in any case, the M3-M4 fragment must include Lys³⁴². Since no DST- or NHS-ASA-induced - cross-link was detected in 19-kDa membranes, Lys³⁴² cannot be involved in the cross-link of the native enzyme. Thus, we are left with the conclusion that the most likely lysine residue for DST-mediated cross-linking on the subunit is Lys³⁴⁷ or Lys³⁵². Similarly the lysine residue modified by NHS-ASA cross-link is predicted to be Lys³⁴⁷ or Lys³⁵².

Modeling - Interactions—We attempted to model the interaction of the subunit and a homology model of pig 1 subunit using information on - proximities and interactions. Fig. 13A (ribbons) and Fig. 13B (surface) shows the proposed general disposition of the and subunits. Fig. 14 shows details of proposed proximities and interactions of transmembrane (A) and cytoplasmic segment (B), respectively. An important consideration is that secondary structure predictions (Jrpred, protein predict, nnpredict, and psipred at the Swiss-Prot web site at www.expasy.org/tools/) all indicate that, whereas the transmembrane segment of the subunit is -helix, the cytoplasmic sequence is unstructured or random coil. The inference from the current work that either Lys⁵⁴ or Lys⁵⁵ (pig numbering) of is cross-linked at 6-8 Å distance from Lys³⁴⁷ or Lys³⁵² in S4 of the subunit strongly supports a location of the transmembrane of in the groove between M2, M9, and M6, overlooked by M4, as proposed previously (20, 22) and also seen in Fig. 13A. Therefore the first step was to optimize docking of the transmembrane segment. The next step was the manual interactive modeling of the unstructured tail SKRLRCGGKKHR. In addition to the cross-linking requirements, the modeling utilized two further constraints, namely that 1) the KKHR residues are known to be necessary for the - interaction (12) and 2) the subunit in 19-kDa membranes is intact (49) indicating that the KKHR residues are well protected from tryptic digestion, presumably by interacting with the subunit. The final model, encompassing both the TM segment as well as the tail (Figs. 13 (overview) and 14 (detailed)), was obtained after a short equilibration molecular dynamics calculation in vacuo as described under "Materials and Methods."

View larger version (82K): [in this window] [in a new window]   FIG. 13. Overview of the model of and interactions. Ribbons (A) and surface view (B) of subunit with docked (red) are shown. Lys347 and Lys352 on the subunit that are candidates for cross-linking to are shown in blue. N