Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M500697200 on March 8, 2005

J. Biol. Chem., Vol. 280, Issue 19, 19003-19011, May 13, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/19/19003    most recent
M500697200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jones, D. H.
Right arrow Articles by Kidder, G. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jones, D. H.
Right arrow Articles by Kidder, G. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Na,K-ATPase from Mice Lacking the {gamma} Subunit (FXYD2) Exhibits Altered Na+ Affinity and Decreased Thermal Stability*

D. Holstead Jones,abc Tony Y. Li,ab Elena Arystarkhova,bd Kevin J. Barr,a Randall K. Wetzel,de Jun Peng,fg Kathryn Markham,ah Kathleen J. Sweadner,d Guo-Hua Fong,fi and Gerald M. Kidder aj

From the aDepartments of Physiology and Pharmacology, Obstetrics and Gynaecology, and Paediatrics, the University of Western Ontario, London, Ontario N6A 5C1, Canada and Children's Health Research Institute, London, Ontario N6C 2V5, Canada, the dLaboratory of Membrane Biology, Massachusetts General Hospital, Boston, Massachusetts 02114 and Harvard Medical School, Boston, Massachusetts 02115, and fThe Lawson Research Institute, St. Joseph's Health Centre, London, Ontario N6A 1Y5, Canada

Received for publication, January 19, 2005 , and in revised form, March 7, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The {gamma} subunit of the Na,K-ATPase, a 7-kDa single-span membrane protein, is a member of the FXYD gene family. Several FXYD proteins have been shown to bind to Na,K-ATPase and modulate its properties, and each FXYD protein appears to alter enzyme kinetics differently. Different results have sometimes been obtained with different experimental systems, however. To test for effects of {gamma} in a native tissue environment, mice lacking a functional {gamma} subunit gene (Fxyd2) were generated. These mice were viable and without observable pathology. Prior work in the mouse embryo showed that {gamma} is expressed at the blastocyst stage. However, there was no delay in blastocele formation, and the expected Mendelian ratios of offspring were obtained even with Fxyd2–/– dams. In adult Fxyd2–/– mouse kidney, splice variants of {gamma} that have different nephron segment-specific expression patterns were absent. Purified {gamma}-deficient renal Na,K-ATPase displayed higher apparent affinity for Na+ without significant change in apparent affinity for K+. Affinity for ATP, which was expected to be decreased, was instead slightly increased. The results suggest that regulation of Na+ sensitivity is a major functional role for this protein, whereas regulation of ATP affinity may be context-specific. Most importantly, this implies that {gamma} and other FXYD proteins have their effects by local and not global conformation change. Na,K-ATPase lacking the {gamma} subunit had increased thermal lability. Combined with other evidence that {gamma} participates in an early step of thermal denaturation, this indicates that FXYD proteins may play an important structural role in the enzyme complex.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The {gamma} subunit of Na,K-ATPase ({gamma}, FXYD2) is a single-span membrane protein that is thought to regulate the Na,K-ATPase by modifying its kinetic properties. It is a member of a family of related proteins that have a 35-amino acid stretch of homology, including the transmembrane span and residues on both sides of the membrane. The homologous stretch has 7 invariant and 16 highly conserved amino acids, and it begins with the shared sequence motif Pro-Phe-X-Tyr-Asp that gives the family its name (1). Five members of this family have been shown to interact with Na,K-ATPase so far. Most interestingly, each appears to have a different effect on its kinetic properties (2). Disruption of the genes for phospholemman (FXYD1) and CHIF1 (FXYD4) have helped to define the functional roles of those proteins and have revealed cardiac and renal deficits, respectively (3, 4). We generated mice with a disruption of the {gamma} subunit gene (Fxyd2)2 to determine its effect on Na,K-ATPase properties and to see if its absence impairs embryogenesis or ion homeostasis.

The {gamma} subunit co-immunoprecipitates and co-purifies with the Na,K-ATPase {alpha} and {beta} subunits (5–9). It is abundant in the kidney, where it is expressed in proximal and distal tubule and in the thick ascending limb (5, 9, 10), and transcripts have been detected in embryos and certain other tissues as well (1, 11, 12). The function of the {gamma} subunit has been explored in a variety of ways: by assessing the properties of pump current in Xenopus oocytes; by antagonizing {gamma} function in kidney membranes using blocking antibodies; by transfecting {gamma} into mammalian cell lines that lack it; by mutating it and deleting its N and C termini; by mimicking its effects with synthetic peptides; and by inducing and repressing its expression in cell lines. These studies have revealed various influences of {gamma}. Most prominently, it reduces the apparent affinity for Na+ (13–20), an effect due in large part to a greater sensitivity of the intracellular Na+-binding sites to competition by intracellular K+ (14, 16, 17). It reduces the apparent affinity for K+ (13, 20, 21) but only in the presence of competing extracellular Na+ and only at fairly depolarized membrane potentials (15). At hyperpolarized potentials, it increases the apparent K+ affinity instead (15, 20, 21). In some experimental cases it increases the enzyme's affinity for ATP (8, 14, 22). Hypertonicity stress-induced expression of the {gamma}a splice variant decreases Vmax of Na,K-ATPase, and the effect is blocked by silencing {gamma} expression with small interfering RNA (23). Thus {gamma} appears to be an accessory protein that modulates the enzyme's properties, but a surprising variety of specific effects has been reported.

Other FXYD proteins have different effects on Na,K-ATPase properties. Phospholemman (FXYD1) has been reported to decrease apparent Na+ affinity like {gamma}, but so far this has been observed only in oocytes (24). It also causes a small decrease in intrinsic affinity for K+, without major effect of membrane potential or competition by extracellular Na+. In phospholemman knock-out mice, its absence resulted in reduced Vmax without a major effect on Na+ affinity (3). Antibodies also reduced Na,K-ATPase activity, consistent with a role as an activator (25). Phospholemman regulation of pump activity also entails phosphorylation (26, 27). CHIF (FXYD4) increases the Na,K-ATPase affinity for Na+, the opposite of the effects of {gamma} and phospholemman, apparently without effects on Vmax, affinity for ATP, or shifts in conformation (15, 20, 28). CHIF has no effect on the intrinsic affinity for K+; however, it greatly increases its sensitivity to competition by extracellular Na+, with the consequence that apparent K+ affinity is reduced in physiological conditions (15, 20). FXYD7 has a different effect; it decreases intrinsic K+ affinity. Like phospholemman but different from CHIF, this was without extracellular Na+ competition or an effect of membrane potential. FXYD7 was also without effect on intracellular Na+ affinity (20, 29). Phospholemman-like shark protein, a FXYD protein found in dogfish shark salt gland, is proposed to have yet a different effect, an inhibition that is relieved by kinase-mediated phosphorylation (30, 31).

Apparently the Na,K-ATPase {alpha}{beta} complex is a highly plastic target of FXYD proteins, in that so many different kinds of kinetic effects have been seen. It is also curious that in the case of phospholemman and {gamma}, different results have been observed with different experimental approaches. For example, although the effects of {gamma} on affinity for ATP have been extensively documented in HeLa cells (14, 16, 18, 22), the same has not been observed in NRK-52E cells (17). Examination of the basic properties of Na,K-ATPase from a {gamma} knock-out mouse kidney is a potential way to determine which of the reported functional effects can be detected in the native membrane environment.

The exceptional plasticity of Na,K-ATPase kinetics in association with different FXYD proteins also raises the question whether FXYD proteins are accessory proteins or subunits. Prior work suggested that they are not indispensable, but our present results concerning the thermal sensitivity of mouse renal Na,K-ATPase without {gamma} suggest that the FXYD protein does play a structural role.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
All procedures involving mice were consistent with the Guiding Principles in the Care and Use of Animals promulgated by the American Physiological Society and were carried out using protocols approved by the Animal Use Subcommittee of the Department of Animal Care and Veterinary Services of the University of Western Ontario.

Targeted Disruption of the Fxyd2 Gene—A genomic Fxyd2 clone (AY035583 [GenBank] ), previously isolated from a strain 129/Sv mouse genomic library (12), was used to build the targeting construct. A 5.2-kb PstI-Asp7001 fragment was subcloned into a pBKS vector containing a lacZ reporter gene before cloning these two segments together into a pPNT vector with a neoR cassette, 1.5 kb of 3' homologous Fxyd2 sequence, and an hsvtk cassette. Most of exon 4 containing the sequence coding for the transmembrane domain and a portion of intron 4 were thereby deleted in the targeting vector (see Fig. 1). The lacZ sequence included a nuclear localization signal to concentrate the enzyme in cell nuclei and was preceded by an internal ribosome entry site. The targeting construct was linearized with NotI and electroporated into the R1 line of strain 129 embryonic stem (ES) cells. Targeted clones were doubly selected with G418 (250 µg/ml geneticin, Invitrogen) and ganciclovir (2 µM Cytovene, Hoffmann-La Roche). Resistant clones were collected and screened by PCR (neo1–5' primer, GCTTGCCGAATATCATGGTGGA; gamgen1–3' primer, ACATGGTGGCAGACAGAAGTG) to identify homologous recombinants. Two such clones were confirmed by HindIII digestion and Southern blotting using the 5' probe (Fig. 1). Targeted ES cells from both clones were aggregated with strain CD1 mouse morulae to obtain chimeras. Male chimeras were mated with CD1 females to obtain Fxyd2+/– mice that were intercrossed to generate homozygous offspring. To verify that the recombinant allele had the expected structure, overlapping segments of the {gamma} gene from an Fxyd2–/– pup were PCR-amplified and sequenced. Subsequently, offspring were genotyped by PCR amplification of earpunch DNA taken at weaning. Primers used for identifying the wild type allele were Fxyd2G-3' (CTGTGCTGGACTGGGGACAT) and Fxyd2G-5' (GCAACTGTGGGGGCAGAG). To identify the mutant allele, the neo1–5' primer (above) was used in conjunction with the Fxyd2G-3' primer.



View larger version (53K):
[in this window]
[in a new window]
  		FIG. 1.
Generation and genotyping of {gamma}-deficient mice. A, strategy employed for disrupting the Fxyd2 gene in mouse embryonic stem cells. The order of exons encoding the three alternate N termini (NT), the transmembrane domain (TM), and the C terminus (CT) of the {gamma} subunit is shown in the top line (wild type (WT) allele; exons not to scale). The arrowheads indicate PCR primers used for genotyping of offspring. The middle line shows the targeting construct in which a promoterless lacZ gene and a Pgk-neoR cassette replaced most of the transmembrane-encoding exon. The mouse Pgk1 poly(A) addition site (not shown) was included downstream of neoR to terminate transcription, and a Pgk-hsvtk cassette was attached to the 3' end of the construct to allow selection against nonhomologous integrations. The bottom line shows the structure of the recombined (knock-out (KO)) allele with the positions of the three HindIII sites (H) and the 5' probe that were used to confirm correct targeting. UTR, untranslated region. B, predicted protein products of the disrupted allele. The in-frame stop codons in the internal ribosome entry site would be expected to cause chain termination, generating truncated, soluble N-terminal peptides of 4.9 kDa ({gamma}a), 4.6 kDa ({gamma}b), and 8.7 kDa ({gamma}c). The variant-specific N-terminal segments are indicated in boldface, and the internal ribosome entry site-derived translation product is underlined. C, Southern blot to confirm targeting of the Fxyd2 gene in ES cells. DNA from ES cells was digested with HindIII and the blot probed with the 5' probe. 1–51 and 2–31 are the two targeted ES cell lines, and NT indicates the nontargeted parental ES line. Restriction fragment sizes are given in kilobases. The 11.4-kb fragment represents the native gene, whereas the 9.5-kb fragment is derived from the targeted allele, which contains an additional HindIII site in the lacZ cassette. D, PCR genotyping of individual preimplantation embryos. Wild type (WT) and knock-out (KO) PCRs were carried out in separate tubes. Primers were as indicated in A, with primers 1 and 2 generating an ~800-bp amplicon from the wild type allele, and primers 3 and 2 generating an ~1200-bp amplicon from the knock-out allele. In this particular group of 11 compacted morulae, four (lanes 1, 5, 6, and 8) were mutant homozygotes. L, DNA ladder; W, water blank.

 
Analysis of Preimplantation Development—Fxyd2+/– females (mixed 129/CD1 background) were superovulated with 5 IU of serum gonadotropin from pregnant mares (from the National Hormone and Peptide Program, Torrance, CA) and 5 IU of human chorionic gonadotropin (Sigma), as described previously (32). The females were mated with heterozygous males of the same genetic background. The females were killed on day 4 of pregnancy (91 h post-human chorionic gonadotropin) by cervical dislocation following CO2 anesthesia. Their reproductive tracts were removed and flushed to recover preimplantation embryos as described (32), using flushing medium containing 0.2 mM glucose. The embryos were immediately sorted into separate pools according to developmental progress (cavitating versus noncavitating). Cavitating embryos were processed for single embryo PCR genotyping as described previously (33), using the Fxyd2G5', Fxyd2G3', and neo1–5' primers described above. Noncavitating embryos were cultured in a CO2 incubator at 37 °C in potassium-augmented simplex optimization medium (34) for another 10–20 h to assess their ability to form blastocysts before they were processed for genotyping.

Western Blot—Peptide-directed antibodies against the shared C-terminal end of {gamma} (RCT-G1 (13)) and against the splice variant N-terminal end of {gamma}b (RNGB (9)) were used. To detect Na,K-ATPase {alpha} subunit, we used anti-KETYY (gift of Dr. Jack Kyte, University of California, San Diego). Electrophoresis was on SDS-Tricine gels of 12.5% polyacrylamide (35), and detection was with chemiluminescence.

Cytology—For staining of {beta}-galactosidase activity expressed in the knock-out mice, tissues were fixed overnight at 4 °C in 0.2% paraformaldehyde in 0.1 M PIPES buffer, pH 6.9, containing 2 mM MgCl2 and 5 mM EGTA. They were cryoprotected in 30% sucrose in PBS overnight at 4 °C and then embedded in frozen section medium (Stephens Scientific, Riverdale, NJ). Five µm sections were cut on the cryostat, and slides were stored at –70 °C until use. The slides were post-fixed on ice for 10 min in 0.2% paraformaldehyde and rinsed twice with PBS and then with detergent solution (0.01% sodium deoxycholate, 0.02% Nonidet P-40, 2 mM MgCl2 in PBS, pH 7.3). Staining was carried out at 37 °C for 2 h in PBS containing 2 mM MgCl2, 0.01% sodium deoxycholate, 0.02% Nonidet P-40, 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, and X-gal (1 mg/ml). The slides were washed in PBS, counterstained with 1% eosin for 1 min, dehydrated, and mounted with Permount.

Immunofluorescence detection of {gamma} and {alpha} subunits was performed as described elsewhere in more detail (10). Cryostat sections of paraformaldehyde/lysine/periodate-fixed kidneys were treated with SDS for antigen retrieval (36) and then stained with rabbit antibodies RCT-G1 against the C terminus or RNGB against the {gamma}b splice variant or with monoclonal antibody 6F against Na,K-ATPase {alpha}1 (Developmental Studies Hybridoma Bank, Iowa City, IA). Detection was with Cy-3 (Accurate Chemicals, Westbury, NY) or fluorescein isothiocyanate (Jackson ImmunoResearch)-conjugated secondary antibodies. Images were collected on a Bio-Rad MRC1024 scanning laser confocal system.

Analysis of Na,K-ATPase from Mutant Kidneys—Isolation of membranes and purification of Na,K-ATPase from mouse kidney (cortex plus outer medulla) was performed by the Jorgensen procedure (37). Briefly, a plasma membrane-enriched fraction was collected by differential centrifugation, followed by treatment with 0.56 mg of SDS/mg of protein to extract contaminating proteins, and then equilibrium density centrifugation on sucrose gradients. Purified rat renal medulla Na,K-ATPase was prepared by the same method but starting with dissected outer medulla only, and was used as a positive control on immunoblots.

ATP hydrolysis reactions were performed at 37 °C for 30 min in medium buffered with 30 mM histidine, pH 7.4, with 120 mM NaCl, 20 mM KCl, 3 mM Tris-ATP, and either 3 or 4 mM MgCl2 as indicated, with and without 3 mM ouabain. Ouabain-sensitive Pi release was measured colorimetrically (17). Na,K-ATPase activity was measured as a function of Na+ concentration (0–30 mM) at 20 mM K+, or as a function of K+ concentration (0–20 mM) at 120 mM Na+, in 3 mM MgCl2. ATP activation curves (0–1.6 mM) were obtained in the complete assay buffer above with 4 mM MgCl2. When measuring apparent affinity for ATP, care was taken that no more than 5% of the ATP was hydrolyzed during the assay. Data were analyzed by nonlinear regression using Sigma Plot Graph System 4.01 (Jandel Scientific). Na+ and K+ activation curves were fitted according to the Hill model for ligand binding. Km values for ATP were derived from the Michaelis-Menten equation, also by nonlinear regression. Student's t test was used to assess the significance of differences. Five different preparations each from wild type and knock-out were analyzed. Specific activities of ATP hydrolysis ranged from 600 to 1,100 µmol/h/mg protein.

Measurement of Na+, K+, and Mg2+ in Urine—Twenty four-hour urine samples were collected from mice 6 to 12 weeks of age housed singly in metabolic cages (Nalgene, Nalge Nunc International, Rochester, NY). Urine electrolytes were analyzed by the Trace Elements Laboratory, London Laboratory Services Group, London, Ontario, Canada, using a Finnigan MAT element high resolution inductively coupled plasma mass spectrometer. Urine creatinine was assayed using a reagent set and standard from Point Scientific Inc., Lincoln Park, MI. Briefly, the picric acid and surfactant reagents were mixed with the buffer reagent as per the kit instructions, prewarmed to 37 °C, and added to cuvettes. Sample (urine diluted in water) or standard was added to the cuvette, mixed, and the time zero absorbance at 510 nm read. After exactly 60 s, the absorbance was read again, and the difference in the absorbance readings was used to create values for the standard curve in the case of standards or to determine concentrations for samples. Urine electrolyte levels were expressed with respect to urine creatinine to correct for variation because of evaporation during the collection interval. Samples were stored at –20 °C until a sufficient number had been collected, and then all were analyzed at once. The data were tested for statistical significance by single factor analysis of variance. No significant differences were noted between male and female mice; hence the data from the two sexes were combined.

Thermostability Assay—Purified enzyme from kidney of either Fxyd2–/– or wild type mice was diluted to a concentration of 5 µg/ml in a buffer (ATPase assay reaction mixture without ATP) containing 100 mM NaCl, 20 mM KCl, 4 mM MgCl2, and 30 mM histidine, pH 7.4, and incubated for 60 min at three different sets of temperatures as follows: 4, 37, and 41 °C. Subsequently, the samples were kept on ice prior to the ATPase activity assay, which was performed at 37 °C as described above, but was started with the addition of 3 mM ATP. Na,K-ATPase activity was defined as the ouabain-sensitive difference in Pi release/mg of protein/h.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Production of Mice Lacking {gamma} Subunits—The {gamma} subunit is encoded by a single gene (designated Fxyd2) belonging to the FXYD family (1). There are two {gamma} subunit splice variants in rat and human with different N-terminal amino acid sequences (1, 38–40). With the cloning of the mouse Fxyd2 gene evidence was found that there are three variants in that species, once again differing in their N termini (12). Transcripts encoding the three variants ({gamma}a, {gamma}b, and {gamma}c) are differentially distributed among mouse organs (12).

The targeting construct (Fig. 1A) was designed to replace most of the transmembrane domain-encoding sequence of the Fxyd2 gene with neoR and lacZ cassettes, providing a selectable marker and a marker of the activity of the disrupted gene, respectively. Two independently targeted 129 strain ES cell lines were obtained, and targeting was confirmed by Southern blot (Fig. 1C). The targeted ES cells were aggregated with CD1 morulae to generate chimeric offspring. Chimeric males representing both recombinant lines were mated with CD1 females to produce mice heterozygous for the disrupted Fxyd2 allele. Those mice were intercrossed to obtain homozygous offspring. The Fxyd2 gene of a homozygous mutant pup was sequenced to confirm that the targeting had generated the expected allele structure (not shown).

The absence of {gamma} subunits from the kidneys of homozygous mutant mice was confirmed by Western blot. Preliminary experiments showed no {gamma} detected in crude kidney membrane preparations from the knock-outs. Na,K-ATPase was purified from kidney membranes by an established detergent-extraction procedure that leaves the enzyme embedded in the membrane but removes contaminating proteins (37). The {gamma} subunit is known to remain associated with {alpha} and {beta} in this procedure (6, 7, 13, 38). The final step is a sucrose density gradient, and fractions containing Na,K-ATPase were collected. Equal amounts of protein from the two fractions at the peak were loaded on Tricine gels for preparations from knock-out and control wild type mice. The immunoblot in Fig. 2A shows the complete absence of {gamma} expression in the knock-out kidney. The top half of the blot was stained for the {alpha} subunit, verifying equal loading of Na,K-ATPase, while the bottom half was stained for {gamma} with an antibody that detects the shared C terminus. No {gamma} was detected in the knock-out even with longer exposure of the blot. In Fig. 2A, there was a difference in the proportion of {gamma}a and {gamma}b in the two sucrose density gradient fractions, indicating a slight difference in the equilibrium density of some of the membranes that contain these two splice variants. The tubule of origin (proximal; distal; medullary thick ascending limb) and purity of the membrane fractions could have been the source of this shift in membrane density.



View larger version (62K):
[in this window]
[in a new window]
  		FIG. 2.
Western blot detection of {gamma} subunits in mouse kidney. A, partially purified Na,K-ATPase was prepared from rat renal medulla and from wild type and knock-out mouse outer medulla plus cortex. Samples were resolved on Tricine gels, and the resulting blot was divided and stained for {alpha} and {gamma} subunits. Lanes 1 and 2 are the denser and lighter fractions from the peak of Na,K-ATPase on the gradient, respectively. B, the bottom half of the blot was exposed to film longer to reveal a faint higher molecular weight band in the wild type and the absence of {gamma} in the knock-out.

 
Na,K-ATPase from rat renal medulla was used as a positive control for the antibodies. It can be seen that the {gamma}a/{gamma}b doublet in the rat was barely resolved (8.0 and 6.8–7.2 kDa relative to the molecular weight markers), although the doublet in the mouse was well resolved with bands at 8.8 and 6.0–6.8 kDa. This is because of sequence differences at the N terminus between {gamma}a of mouse (MAGEISDLSANS) and rat (MTGLSMDG), resulting in a detectable difference in apparent molecular weight. The calculated molecular mass for mouse {gamma}a would be 7516 daltons with the initiation methionine or 7385 without it; the molecular mass for rat {gamma}a without the initiation methionine is only 7123 daltons (by mass spectroscopy it was reported to be 7184 daltons with carbamidomethyl cysteine (38)). The calculated masses for mouse {gamma}b and rat {gamma}b, which differ only by an Ile to Leu substitution in the membrane span and a Gly to Ser substitution in the C terminus, are 7204 and 7235 daltons, respectively. It is a known peculiarity that rat {gamma}a migrates more slowly than rat {gamma}b even though it has less mass; this is not an issue for mouse {gamma}a and {gamma}b where the predicted masses and relative mobilities correspond.

Upon longer exposure of the same gel (Fig. 2B), a faint band could be seen at a slightly higher apparent molecular weight (11–12 kDa). Although we cannot rule out that this is a post-translational modification of {gamma}a or {gamma}b, its appearance is consistent with the presence of a small amount of the {gamma}c variant that was predicted from the mouse genomic sequence and detected in both fetal and adult mouse kidney by reverse transcription-PCR (12). It has a predicted size of 11,275 kDa. Staining of all three bands was abolished by preincubation of the antibody with competing peptide (data not shown). More of the higher Mr band was seen in the denser of the two gradient fractions in this experiment, as well as a higher proportion of {gamma}a.

Viability of Fxyd2–/– Mice—Mice homozygous for the mutation are viable and fertile and live a normal life span, and no differences have been detected between the two independently targeted lines. The expected Mendelian ratio (25.7% wild type, 50.2% heterozygous, 24.1% homozygous mutant) was obtained from 261 offspring of heterozygote crosses tested at weaning, indicating that there is no loss of mutant offspring during embryonic, fetal, or postnatal development. Furthermore, litter sizes did not differ between crosses of heterozygous (13.37 ± 0.36 pups) and homozygous mutant mice (13.23 ± 0.82 pups; 3–7 litters were counted from each of 4 mating pairs of the two genotypes). The body weights of homozygous mutant adults were compared with heterozygous adults (Table I) and were also found not to differ according to genotype (Student's t test, p > 0.05).


View this table:
[in this window]
[in a new window]
  		TABLE I
Body weights (mean ± S.D.) of mice at 11 months of age

 
Because {gamma} subunits are prominently expressed in blastocysts (11), we analyzed preimplantation embryos from heterozygote crosses to look for a correlation between embryo genotype and the timing of cavitation. Embryos were flushed from uteri on the morning of day 4 of gestation, when cavitation would normally be in progress. The embryos (n = 229) were immediately segregated according to whether or not a blastocele had begun to form, and noncavitating embryos (48.5% of the population) were placed in culture to continue development. PCR genotyping (Fig. 1D) of the two classes of embryos revealed a slight excess of homozygous mutant embryos in the noncavitating class (28.6%) and a slight deficiency in the cavitating class (21.6%), with the proportion of homozygotes in the two classes combined being 24.9%. However, a {chi}2 test indicated that the numbers of homozygous mutant embryos in the two classes did not differ significantly from the expected 25% at p = 0.05. Most (81.6%) embryos in the noncavitating class eventually formed blastoceles in culture. Because many of the embryos that failed to cavitate had arrested before the 8-cell stage, when Fxyd2 transcripts first appear (11), their failure could not be attributed to the mutation. Thus the absence of embryonic {gamma} subunits had little, if any, effect on cavitation.

Renal electrolytes in the {gamma}-deficient adult mice were assessed by measuring Na+, K+, and Mg2+ concentrations in 24-h urine samples. The data are summarized in Table II. There was no significant effect of genotype on the concentrations of these cations in the urine (single factor analysis of variance for each cation, p > 0.05 in all cases).


View this table:
[in this window]
[in a new window]
  		TABLE II
Urine electrolytes (mg/mg creatinine, mean ± S.E.) of different genotypes

 
Expression of Fxyd2 in the Mouse Kidney—As with all mammals, the Na,K-ATPase of the mouse kidney is known to be expressed at different levels in different segments of the nephron. The highest level is in the distal convoluted tubule and much less is in the proximal convoluted tubule (41, 42). In the rat, expression of total {gamma} subunit parallels Na,K-ATPase expression levels in most renal segments, except where {gamma} is absent (cortical thick ascending limb and collecting tubule) (9, 10, 14, 28). Fig. 3A shows that the mouse kidney has the same pattern of {gamma} distribution in the renal cortex, as detected with an antibody against its C terminus. Label in the wild type was confined to the basolateral membrane of the tubule, with light label in the proximal convoluted tubule and heavy label in the distal convoluted tubule. Similar to the rat, {gamma}b was essentially confined to distal segments in the wild type (Fig. 3C). The proximal tubule stain seen in Fig. 3A, which is not seen with the {gamma}b antibody, must be the stain for {gamma}a as shown in the rat (9). The same antibody against the C terminus detected nothing in the knock-out (Fig. 3B), as expected because the epitope lies in the portion of the protein deleted by the targeted disruption.



View larger version (53K):
[in this window]
[in a new window]
  		FIG. 3.
Expression of {gamma} and the knocked-in {beta}-galactosidase in the kidney. A and C, wild type; B and D, knock-out. A, immunofluorescence with an antibody that recognizes the shared C-terminal end of the {gamma} subunit in the mouse renal cortex. PCT, proximal convoluted tubule; DCT, distal convoluted tubule. B, nothing was detected by the same antibody in the knock-out mouse renal cortex. C, immunofluorescence with an antibody raised against the N terminus of {gamma}b. G, glomerulus; MD, macula densa. D, {beta}-galactosidase stain of the knock-out mouse renal cortex.

 
The macula densa is a patch of specialized cells in the wall of the cortical thick ascending limb that forms part of the juxtaglomerular complex where the tubule passes the glomerulus. The macula densa is thought to sense NaCl concentration in the lumen of the tubule and to send messages through the rest of the complex to control the glomerular filtration rate and the secretion of renin. There is agreement that {gamma}a is expressed in the basolateral membrane of the macula densa, colocalizing with the Na,K-ATPase {alpha} subunit, but there has been some discussion about whether {gamma}b is expressed there (9, 14). Fig. 3C shows two examples of {gamma}b expression in macula densa in wild type mouse renal cortex.

Fig. 3D shows the pattern of {beta}-galactosidase expression in mutant kidney cortex that results from transcription of the lacZ gene inserted in the Fxyd2 locus. The pattern indicates that segment-specific gene expression has been conserved in the knock-out. Very heavy labeling was seen over distal tubule segments, and much lighter over the (more abundant) proximal tubule segments. Just as seen for the Na,K-ATPase {alpha} subunit, no label was detected in the glomerulus. No {beta}-galactosidase staining was detected in sections of wild type kidney (not shown). A heavy patch of {beta}-galactosidase stain at the edge of a glomerulus might be in a macula densa, although the heavy stain obscured any surrounding histology that would help to identify it.

Fig. 4, A–D, shows double-label stain for the Na,K-ATPase {alpha}1 subunit (blue) and {gamma}b N terminus (red) in wild type and knock-out mice. In the knock-out, some faint cytoplasmic {gamma}b immunoreactivity was detected in the same distal segments (identified by their high level of {alpha}1 immunoreactivity; arrows). We postulate that this represents residual levels of the truncated gene product, which contains the {gamma}b epitope but is unable to associate with membranes (diagrammed in Fig. 1B). It would be expected to be expressed in proportion to the expression of {beta}-galactosidase and to be degraded eventually as a misfolded protein fragment.



View larger version (89K):
[in this window]
[in a new window]
  		FIG. 4.
Double-label immunofluorescence for {gamma}b and the {alpha}1 subunit of the Na,K-ATPase. A and B, {gamma}b; C and D, {alpha}1. A and C, wild type; B and D, knock-out. The {gamma}b antibody binds at the N terminus, and the faint cytoplasmic stain for {gamma}b(arrow in B and inset) in the knock-out is probably residual truncated protein. This stain is more intense in the same segments with higher stain for {alpha} subunit (arrow in D and inset). DCT, distal convoluted tubule.

 
We also surveyed day 10 fetuses and additional organs from adult mice (brain, heart, kidney, liver, lung, spleen, small intestine, mammary gland, testis, epididymus, ovary, and oviduct) for {beta}-galactosidase expression. {beta}-Galactosidase activity was not detected in any of these fetal or adult organs.

Properties of Na,K-ATPase in Mice Lacking {gamma} Subunits— Starting with whole mouse kidney minus the inner medulla (which has very little Na,K-ATPase), membranes were prepared, and the membrane-bound Na,K-ATPase was partially purified by detergent extraction. Purification was expected to isolate the enzyme from possible regulatory alterations or differences in trafficking that might have contributed to in vivo adaptation to the absence of {gamma}. The kinetic properties of the enzyme were then assessed by using a test tube assay for ATP hydrolysis. Three basic properties were investigated that are thought to influence the physiological properties of the enzyme as follows: the apparent affinities for Na+, K+, and ATP.

Prior work with {gamma}-transfected mammalian cells and {gamma}-injected Xenopus oocytes identified a reduction in affinity for Na+. Fig. 5A shows that there is a corresponding significant increase in apparent Na+ affinity in the knock-out mouse preparation. Differences in K+ affinity have been reported in the literature, but the effects have been small in membrane fragments (without membrane potential), and in our control and knock-out purified enzyme preparations K+ affinities were not significantly different (Fig. 5B). As discussed below, the simultaneous knock-out of both {gamma}a and {gamma}b and the use of whole kidney rather than individual nephron segments for enzyme preparation may mask some of the more subtle effects of the {gamma} splice variants and of their post-translational modification.



View larger version (12K):
[in this window]
[in a new window]
  		FIG. 5.
Na+, K+, and ATP affinity of the Na,K-ATPase. Na,K-ATPase was partially purified from the kidney of wild type and knockout mice. ATP hydrolysis was measured as a function of the concentrations of Na+ (A), K+ (B), and ATP (C). Open circles are the knock-out; closed circles are the wild type. Vmax was determined for each preparation separately. Differences in affinities for Na+ and ATP were significant, p < 0.001 (Student's t test). In both cases, affinities were higher in the absence of {gamma}.

 
On the basis of effects of blocking antibodies, {gamma}-transfectants of HeLa and HEK-293 cells, and transfection of truncated derivatives of the {gamma} subunit, it has been proposed that {gamma} increases the affinity of the Na,K-ATPase for ATP (8, 14, 16). Any effects on ATP affinity in {gamma}-transfected NRK-52E cells did not reach statistical significance, however (17). When we compared enzyme from wild type mouse kidney with that from the knockout, the ATP affinity in the wild type was not greater (Fig. 5C). On the contrary, ATP affinity was slightly lower in the {gamma}-containing wild type enzyme than in the knock-out. The kinetic parameters are summarized in Table III.


View this table:
[in this window]
[in a new window]
  		TABLE III
Kinetic constants for Na,K-ATPase

K0.5 is the concentration at half-maximal activation; nH is the Hill coefficient, and Km is the Michaelis constant.

 
Thermal Stability of Na,K-ATPase from Fxyd2–/– Mice— There is much evidence that association of {alpha} and {beta} is essential for the proper folding and stability of the Na,K-ATPase. Clearly, the expression of normal levels of Na,K-ATPase in the knock-out mouse kidney shows that the absence of {gamma} is not prohibitively destabilizing at physiological temperatures. We applied a very moderate level of heat to purified enzyme in vitro (37 and 41 °C) to determine whether a reduction in stability could be detected. As shown in Fig. 6, {gamma}-containing Na,K-ATPase purified from control mice had no loss of activity, whereas enzyme from Fxyd2–/– mice had a significant loss.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 6.
Thermal denaturation of Na,K-ATPase without {gamma} subunit. Na,K-ATPase activity was measured immediately following the 60-min incubation at 37 or 41 °C. Activity was expressed as percentage of that of samples kept on ice for 60 min. Data are means ± S.E. (n = 6). *, p < 0.001 versus control (4 °C); **, p < 0.0001 versus control (4 °C). No statistically significant difference was found between the samples from Fxyd2+/– mice heated at either 37 or 41 °C as compared with control (4 °C).

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Alterations of Na,K-ATPase Properties—The increase in apparent affinity for Na+ for the Na,K-ATPase isolated from Fxyd2–/– mice is consistent with observations both from mammalian cell transfectants and from expression of {gamma} subunit in Xenopus oocytes. A difference in half-maximal activation for Na+ from 5.7 to 7.6 mM was readily detected in the Fxyd2–/– Na,K-ATPase, even at 20 mM K+. The magnitude of the difference is in the physiological range for the modulation of Na,K-ATPase by hormones (43), and it is predicted to affect the activity of the Na,K-ATPase in vivo because the intracellular concentration of Na+ is normally rate-limiting. Na,K-ATPase in cells operates well below its Vmax and additionally shows a marked cooperativity in activation by Na+.

No significant difference in K+ affinity was observed between wild type and knock-out mice. This is in contrast to prior reports where K+ interaction with the Na,K-ATPase was altered in at least some conditions in several kinds of mammalian cell transfectants, depending on the host cell line, the splice variant, and post-translational modification of {gamma} (13, 14, 17, 22). The differences are of uncertain biological significance if the concentration of K+, which is bound from the blood side of epithelia, is unlikely to be low enough to limit pump rate. However, one of the earliest observations of a functional effect of {gamma} was that the activation of pump current by extracellular K+ in Xenopus oocytes varied as a function of membrane potential (21). The possible effect of membrane potential, which affects pump current, is not addressed by the experiments performed here with isolated enzyme, and future studies might shed more light on this and its interaction with Na+ affinity and K+ affinity.

Differences in ATP affinity with and without {gamma} subunit have proven to be the most puzzling kinetic effect. Increases in ATP affinity with {gamma} expression have been reported for some cell lines (14, 16, 22) but not others (17), and the present evidence indicates a decrease in affinity, rather than an increase, when {gamma} is present. Blostein and co-workers (22, 44) have obtained evidence that an increase in ATP affinity reflects a tendency of {gamma} to favor the E1 conformation of the Na,K-ATPase. An increase in E1 should in principle also increase intrinsic Na+ affinity and decrease K+ affinity, but {gamma}, its splice variants, and the modified forms and other FXYD proteins appear to have quite independent effects on Na+ affinity and K+ affinity. It may be instructive that different parts of the {gamma} subunit structure appear to be responsible for ATP and Na+ affinity effects. Deletions in either the N- or C-terminal extramembranous domains abolished the effect on ATP affinity, while preserving the effect on Na+ affinity (16), whereas addition of soluble peptides containing only the transmembrane domain affected Na+ affinity and not ATP affinity (18). This suggests that kinetic effects of association with {gamma} can be ascribed to local influences on {alpha}{beta} structure and conformation, rather than a global shift of E1-E2 equilibrium. This framework is commensurate with the general plasticity of Na,K-ATPase responses to the presence of FXYD family proteins, considering that the proteins have their greatest homologies in the transmembrane span and flanking regions, while having highly divergent N and C termini.

Characteristics of {gamma}-Deficient Mice—The {gamma} subunit has been detected in preimplantation mouse and cow embryos where the blastocyst trophectoderm, with basolaterally localized Na,K-ATPase, acts as a transporting epithelium similar in some ways to the nephron (11, 45). The absence of {gamma} did not disrupt blastocyst development or implantation, however, even in crosses involving null mutant females. Such females produced litters of normal size with expected Mendelian genotype ratios. Thus development of Fxyd2–/– embryos to the blastocyst stage and beyond cannot be attributed to {gamma} subunits synthesized during oogenesis and already present prior to fertilization. Failure of a null mutation to disrupt events in preimplantation development can mean that the gene has functions that become critical only later in development (46). Indeed, even targeted disruption of the Atp1a1 gene encoding the {alpha}1 subunit of Na,K-ATPase failed to impair blastocyst development, although the mutant embryos were eventually lost during the peri-implantation period (47).

Renal function was not obviously impaired in {gamma}-deficient animals kept in optimal care. In theory, higher pump activity in the proximal tubule due to the absence of {gamma}, without parallel change in the activity of sodium-proton exchanger 3, the principal Na+ influx pathway, would increase Na+ reabsorption. The resulting decrease in Na+ delivery to the macula densa might stimulate renin release and depress glomerular filtration rate to achieve a normal Na+ excretion balance. Because {gamma} is also expressed in macula densa (10, 48) and its role there is not yet known, the actual consequences of {gamma} knock-out cannot be readily predicted. Enhanced Na,K-ATPase in distal segments due to increased Na,K-ATPase activity in the knock-out might also affect urine concentrating ability and final output composition. In practice, however, the kidney has many mechanisms for adjusting urine output, and it is not surprising that renal function remains within the normal range in {gamma}-deficient animals.

Humans with a disruptive mutation in the transmembrane span of {gamma} (G41R) in fact do not manifest symptoms that would indicate a gross alteration of Na,K-ATPase activity or regulation, but instead have a hereditary dominant renal hypomagnesemia (40). We tested the knock-out mouse urine for electrolytes, and we found no abnormalities in Mg2+ excretion. Preliminary data on serum Mg2+ levels also showed no abnormality (data not shown). However, it is not surprising that the complete deletion of a gene product does not mimic the effects of a dominant, penetrant mutation that disrupts the structure and trafficking of a membrane protein (16, 18, 40, 49). In all likelihood it will be necessary to subject the Fxyd2–/– mice to physiological stress to detect abnormal renal function. Because the kinetic effects of {gamma} measured in transfected cells are complex and depend on the splice variant and whether it is post-translationally modified (50), and because the splice variants have different nephron segment distributions, considerable progress may need to be made before effectual physiological perturbations can be predicted.

Structural Stabilization of Na,K-ATPase by the {gamma} Subunit— The normal properties of Na,K-ATPase (the assembly of {alpha}{beta} hetero-oligomers, trafficking to the plasma membrane, ouabain binding, enzymatic activity, and cation transport) can be obtained in heterologous expression systems without the {gamma} subunit (51–55). In Xenopus oocytes, it has been observed that {gamma} associates with {alpha} and core-glycosylated {beta} in the endoplasmic reticulum (21), but evidently {alpha}{beta} alone successfully escapes the endoplasmic reticulum and forms active enzyme. This also occurs when the disruptive mutant of {gamma}, G41R, is expressed in HeLa cells; {alpha}{beta} goes to the membrane, whereas {gamma} is delayed intracellularly (16). Apparently {alpha}{beta} is successfully synthesized in the knock-out mouse too, although it is formally possible that there is substitution by an undetected alternative FXYD protein.

In previous work, it was observed that a step on the pathway of Na,K-ATPase heat denaturation (at 50–55 °C) was the loss of the C terminus and C-terminal transmembrane hairpin, spans M9 and M10, to the extracellular space, where they could be bound by antibodies and kinases and degraded by proteases (56, 57). Subsequently, it was observed that the {gamma} subunit was extruded from the membrane with the M9-M10 hairpin, whereas the {beta} subunit remained anchored, and the topology of the rest of the {alpha} subunit was preserved (58). This suggests that {gamma} is associated with the C-terminal hairpin, and in fact recent mutagenesis studies of residues in M9 have provided evidence that this transmembrane span indeed interacts with FXYD2 ({gamma}), FXYD4 (CHIF), and FXYD7 (20).

Normally, the purified renal Na,K-ATPase ({gamma}-containing) is stable at 37 °C, and although with differential scanning microcalorimetry, the heat capacity profile begins at that temperature (59). Most interestingly, the related Ca2+-ATPase SERCA1a, which does not have a subunit corresponding to {beta}, begins to denature at 37 °C (60). We reasoned that if {gamma} binds to the C-terminal portion of the Na,K-ATPase {alpha} subunit that is most readily denatured by heat, the enzyme might be more labile in its absence. This was the case, with sensitivity seen at both 41 and 37 °C. We recently observed that {gamma} (specifically the {gamma}a splice variant) is up-regulated in several cell lines when exposed to stress conditions, including among other conditions heating the cells to 43 °C for 1 h (23). It is tempting to speculate that among its many roles, stabilization of the enzyme complex is one of the functions of the {gamma} subunit.


   FOOTNOTES
 
* This work was supported by grants from the Medical Research Council of Canada (to G. M. K. and G.-H. F.), the Canadian Institutes of Health Research (to G. M. K.), and the NHLBI Grant R01-HL36271 from the National Institutes of Health (to K. J. S.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

b These authors contributed equally to this work. Back

c Present address: University of Ontario Institute of Technology, 2000 Simcoe Street N., Oshawa, Ontario L1H 7L7, Canada. Back

e Present address: Cell Signalling Technology, 166B Cummings Center, Beverly, MA 01915. Back

g Present address: Van Andel Research Institute, 333 Bostwick Ave. N.E., Grand Rapids, MI 49503. Back

h Present address: Genes and Development Research Group, Dept. of Biochemistry and Molecular Biology, University of Calgary, 3330 Hospital Drive N.W., Calgary, Alberta T2N 4N1, Canada. Back

i Present address: Dept. of Physiology/Center for Vascular Biology, University of Connecticut Health Center, 263 Farmington Ave., Farmington, CT 06030. Back

j To whom correspondence should be addressed: Dept. of Physiology and Pharmacology, Dental Sciences Bldg., Dock 15, the University of Western Ontario, London, Ontario N6A 5C1, Canada. Tel.: 519-661-3132; Fax: 519-850-2562; E-mail: gerald.kidder{at}fmd.uwo.ca.

1 The abbreviations used are: CHIF, corticosteroid-induced factor; ES, embryonic stem cells; PIPES, 1,4-piperazinediethanesulfonic acid; X-gal, 5-bromo-4-chloro-3-indolyl-{beta}-D-galactopyranoside; PBS, phosphate-buffered saline; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)-ethyl]glycine. Back

2 The gene nomenclature used for the FXYD domain-containing ion transport regulators for human and rodents is FXYD and Fxyd, respectively. Back


   ACKNOWLEDGMENTS
 
We thank Dr. A. F. Parlow of the National Hormone and Peptide Program for supplying serum gonadotropin from pregnant mares for superovulating mice; Kathryn Naus for assistance with X-gal staining and genotyping; and Jennifer Pascoa for assistance with thermal denaturation studies.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Sweadner, K. J., and Rael, E. (2000) Genomics 68, 41–56[CrossRef][Medline] [Order article via Infotrieve]
  2. Crambert, G., and Geering, K. (2003) Science's STKE http://stke.sciencemag.org/cgi/content/full/sigtrans;2003/166/re1
  3. Jia, L.-J., Donnet, C., Bogaev, R. C., Blatt, R. J., McKinney, C. E., Day, K. H., Berr, S. S., Jones, L. R., Moorman, J. R., Sweadner, K. J., and Tucker, A. (2005) Am. J. Physiol. 288, H1982–H1988
  4. Aizman, R., Asher, C., Fuzesi, M., Latter, H., Lonai, P., Karlish, S. J. D., and Garty, H. (2002) Am. J. Physiol. 283, F569–F577
  5. Mercer, R. W., Biemesderfer, D., Bliss, D. P., Jr., Collins, J. H., and Forbush, B., III (1993) J. Cell Biol. 121, 579–586[Abstract/Free Full Text]
  6. Forbush, B., III, Kaplan, J. H., and Hoffman, J. F. (1978) Biochemistry 17, 3667–3676[CrossRef][Medline] [Order article via Infotrieve]
  7. Or, E., Goldshleger, R., Tal, D. M., and Karlish, S. J. D. (1996) Biochemistry 35, 6853–6864[CrossRef][Medline] [Order article via Infotrieve]
  8. Therien, A. G., Goldshleger, R., Karlish, S. J. D., and Blostein, R. (1997) J. Biol. Chem. 272, 32628–32634[Abstract/Free Full Text]
  9. Arystarkhova, E., Wetzel, R. K., and Sweadner, K. J. (2002) Am. J. Physiol. 282, F393–F407
  10. Wetzel, R. K., and Sweadner, K. J. (2001) Am. J. Physiol. 281, F531–F545
  11. Jones, D. H., Davies, T. C., and Kidder, G. M. (1997) J. Cell Biol. 139, 1545–1552[Abstract/Free Full Text]
  12. Jones, D. H., Golding, M. C., Barr, K. J., Fong, G.-H., and Kidder, G. M. (2001) Physiol. Genomics 6, 129–135[Abstract/Free Full Text]
  13. Arystarkhova, E., Wetzel, R. K., Asinovski, N. K., and Sweadner, K. J. (1999) J. Biol. Chem. 274, 33183–33185[Abstract/Free Full Text]
  14. Pu, H. X., Cluzeaud, F., Goldshleger, R., Karlish, S. J. D., Farman, N., and Blostein, R. (2001) J. Biol. Chem. 276, 20370–20378[Abstract/Free Full Text]
  15. Beguin, P., Crambert, G., Guennoun, S., Garty, H., Horisberger, J.-D., and Geering, K. (2001) EMBO J. 20, 3993–4002[CrossRef][Medline] [Order article via Infotrieve]
  16. Pu, H. X., Scanzano, R., and Blostein, R. (2002) J. Biol. Chem. 277, 20270–20276[Abstract/Free Full Text]
  17. Arystarkhova, E., Donnet, C., Asinovski, N. K., and Sweadner, K. J. (2002) J. Biol. Chem. 277, 10162–10172[Abstract/Free Full Text]
  18. Zouzoulas, A., Therien, A. G., Scanzano, R., Deber, C. M., and Blostein, R. (2003) J. Biol. Chem. 278, 40437–40441[Abstract/Free Full Text]
  19. Lindzen, M., Aizman, R., Lifshitz, Y., Lubarski, I., Karlish, S. J. D., and Garty, H. (2003) J. Biol. Chem. 278, 18738–18743[Abstract/Free Full Text]
  20. Li, C., Grosdidier, A., Crambert, G., Horisberger, J.-D., Michielin, O., and Geering, K. (2004) J. Biol. Chem. 279, 38895–38902[Abstract/Free Full Text]
  21. Beguin, P., Wang, X., Firsov, D., Puoti, A., Claeys, D., Horisberger, J. D., and Geering, K. (1997) EMBO J. 16, 4250–4260[CrossRef][Medline] [Order article via Infotrieve]
  22. Therien, A. G., Karlish, S. J. D., and Blostein, R. (1999) J. Biol. Chem. 274, 12252–12256[Abstract/Free Full Text]
  23. Wetzel, R. K., Pascoa, J. L., and Arystarkhova, E. (2004) J. Biol. Chem. 279, 41750–41757[Abstract/Free Full Text]
  24. Crambert, G., Fuzesi, M., Garty, H., Karlish, S., and Geering, K. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 11476–11481[Abstract/Free Full Text]
  25. Feschenko, M. S., Donnet, C., Wetzel, R. K., Asinovski, N. K., Jones, L. R., and Sweadner, K. J. (2003) J. Neurosci. 23, 2161–2169[Abstract/Free Full Text]
  26. Fuller, W., Eaton, P., Bell, J. R., and Shattock, M. J. (2004) FASEB J. 18, 197–199[Abstract/Free Full Text]
  27. Silverman, B. D., Fuller, W., Eaton, P., Deng, J., Moorman, J. R., Cheung, J. Y., James, A. F., and Shattock, M. J. (2005) Cardiovasc. Res. 65, 93–103[Abstract/Free Full Text]
  28. Garty, H., Lindzen, M., Scanfano, R., Aizman, R., Fuzesi, M., Goldshleger, R., Farman, N., Blostein, R., and Karlish, S. J. D. (2002) Am. J. Physiol. 283, F607–F615
  29. Beguin, P., Crambert, G., Monnet-Tschudi, F., Uldry, M., Horisberger, J.-D., Garty, H., and Geering, K. (2002) EMBO J. 21, 3264–3273[CrossRef][Medline] [Order article via Infotrieve]
  30. Mahmmoud, Y. A., Vorum, H., and Cornelius, F. (2000) J. Biol. Chem. 275, 35969–35977[Abstract/Free Full Text]
  31. Mahmmoud, Y. A., Cramb, G., Maunsbach, A. B., Cutler, C. P., Meischke, L., and Cornelius, F. (2003) J. Biol. Chem. 278, 37427–37438[Abstract/Free Full Text]
  32. MacPhee, D. J., Barr, K. J., De Sousa, P. A., Todd, S. D. L., and Kidder, G. M. (1994) Dev. Biol. 162, 259–266[CrossRef][Medline] [Order article via Infotrieve]
  33. De Sousa, P. A., Juneja, S. C., Caveney, S., Houghton, F. D., Davies, T. C., Reaume, A. G., Rossant, J., and Kidder, G. M. (1997) J. Cell Sci. 110, 1751–1758[Abstract]
  34. Erbach, G. T., Lawitts, J. A., Papaioannou, V. E., and Biggers, J. D. (1994) Biol. Reprod. 50, 1027–1033[Abstract]
  35. Schagger, H., and von Jagow, G. (1987) Anal. Biochem. 166, 368–379[CrossRef][Medline] [Order article via Infotrieve]
  36. Brown, D., Lydon, J., McLaughlin, M., Tilly, A. S., Tyszkowski, R., and Alper, S. (1996) Histochem. Cell Biol. 105, 261–267[CrossRef][Medline] [Order article via Infotrieve]
  37. Jorgensen, P. L. (1988) Methods Enzymol. 156, 29–43[Medline] [Order article via Infotrieve]
  38. Küster, B., Shainskaya, A., Pu, H. X., Goldshleger, R., Blostein, R., and Karlish, S. J. D. (2000) J. Biol. Chem. 275, 18441–18446[Abstract/Free Full Text]
  39. Sweadner, K. J., Wetzel, R. K., and Arystarkhova, E. (2000) Biochem. Biophys. Res. Commun. 279, 196–201[CrossRef][Medline] [Order article via Infotrieve]
  40. Meij, I. C., Koenderink, J. B., van Bokhoven, H., Assink, K. F. H., Groenestege, W. T., De Pont, J. J. H. H. M., Bindels, R. J. M., Monnens, L. A. H., van den Heuvel, L. P. W. J., and Knoers, N. V. A. M. (2000) Nat. Genet. 26, 265–266[CrossRef][Medline] [Order article via Infotrieve]
  41. Siegel, G. J., Holm, C., Schreiber, J. H., Desmond, T., and Ernst, S. A. (1984) J. Histochem. Cytochem. 32, 1309–1318[Abstract]
  42. Watson, A. J., and Kidder, G. M. (1988) Dev. Biol. 126, 80–90[CrossRef][Medline] [Order article via Infotrieve]
  43. Feraille, E., and Doucet, A. (2001) Physiol. Rev. 81, 345–418[Abstract/Free Full Text]
  44. Therien, A. G., Pu, H. X., Karlish, S. J. D., and Blostein, R. (2001) J. Bioenerg. Biomembr. 33, 407–414[CrossRef][Medline] [Order article via Infotrieve]
  45. Barcroft, L. C., Gill, S. E., and Watson, A. J. (2002) Reproduction 124, 387–397[Abstract]
  46. Houghton, F. D., Barr, K. J., Walter, G., Gabriel, H.-D., Grümmer, R., Traub, O., Leese, H. J., Winterhager, E., and Kidder, G. M. (2002) Biol. Reprod. 66, 1403–1412[Abstract/Free Full Text]
  47. Barcroft, L. C., Moseley, A. E., Lingrel, J. B., and Watson, A. J. (2004) Mech. Dev. 121, 417–426[Medline] [Order article via Infotrieve]
  48. Wetzel, R. K., and Sweadner, K. J. (2003) Am. J. Physiol. 285, F121–F129
  49. Meij, I. C., Koenderink, J. B., De Jong, J. C., De Pont, J. J. H. H. M., Monnens, L. A. H., van den Heuvel, L. P. W. J., and Knoers, N. V. A. M. (2003) Ann. N. Y. Acad. Sci. U. S. A. 986, 437–443[CrossRef][Medline] [Order article via Infotrieve]
  50. Arystarkhova, E., and Wetzel, R. K. (2003) Ann. N. Y. Acad. Sci. U. S. A. 986, 416–419[Medline] [Order article via Infotrieve]
  51. Noguchi, S., Mishina, M., Kawamura, M., and Numa, S. (1987) FEBS Lett. 225, 27–32[CrossRef][Medline] [Order article via Infotrieve]
  52. DeTomaso, A. W., Xie, Z. J., Liu, G., and Mercer, R. W. (1993) J. Biol. Chem. 268, 1470–1478[Abstract/Free Full Text]
  53. Scheiner-Bobis, G., and Farley, R. A. (1994) Biochim. Biophys. Acta 1193, 226–234[Medline] [Order article via Infotrieve]
  54. Laughery, M. D., Todd, M. L., and Kaplan, J. H. (2003) J. Biol. Chem. 278, 34794–34803[Abstract/Free Full Text]
  55. Strudgatsky, D., Gottschalk, K. E., Goldshleger, R., Bibi, E., and Karlish, S. J. D. (2005) J. Biol. Chem. 278, 46064–46073
  56. Arystarkhova, E., Gibbons, D. L., and Sweadner, K. J. (1995) J. Biol. Chem. 270, 8785–8796[Abstract/Free Full Text]
  57. Goldshleger, R., Tal, D. M., and Karlish, S. J. D. (1995) Biochemistry 34, 8668–8679[CrossRef][Medline] [Order article via Infotrieve]
  58. Donnet, C., Arystarkhova, E., and Sweadner, K. J. (2001) J. Biol. Chem. 276, 7357–7365[Abstract/Free Full Text]
  59. Grinberg, A. V., Gevondyan, N. M., Grinberg, N. V., and Grinberg, V. Y. (2001) Eur. J. Biochem. 268, 5027–5036[Medline] [Order article via Infotrieve]
  60. Tupling, A. R., Gramolini, A. O., Duhamel, T. A., Kondo, H., Asahi, M., Tsuchiya, S. C., Borrelli, M. J., Lepock, J. R., Otsu, K., Hori, M., MacLennan, D. H., and Green, H. J. (2004) J. Biol. Chem. 279, 52382–52389[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Am. Soc. Nephrol.Home page
R. T. Alexander, J. G. Hoenderop, and R. J. Bindels
Molecular Determinants of Magnesium Homeostasis: Insights from Human Disease
J. Am. Soc. Nephrol., August 1, 2008; 19(8): 1451 - 1458.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
E. Arystarkhova, C. Donnet, A. Munoz-Matta, S. C. Specht, and K. J. Sweadner
Multiplicity of expression of FXYD proteins in mammalian cells: dynamic exchange of phospholemman and {gamma}-subunit in response to stress
Am J Physiol Cell Physiol, March 1, 2007; 292(3): C1179 - C1191.
[Abstract] [Full Text] [PDF]

Home page
 DevelopmentHome page
Y. Yamaguchi, S. Yonemura, and S. Takada
Grainyhead-related transcription factor is required for duct maturation in the salivary gland and the kidney of the mouse
Development, December 1, 2006; 133(23): 4737 - 4748.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
K. Pihakaski-Maunsbach, H. Vorum, B. Honore, S. Tokonabe, J. Frokiaer, H. Garty, S. J. D. Karlish, and A. B. Maunsbach
Locations, abundances, and possible functions of FXYD ion transport regulators in rat renal medulla
Am J Physiol Renal Physiol, November 1, 2006; 291(5): F1033 - F1044.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Lindzen, K.-E. Gottschalk, M. Fuzesi, H. Garty, and S. J. D. Karlish
Structural Interactions between FXYD Proteins and Na+,K+-ATPase: {alpha}/beta/FXYD SUBUNIT STOICHIOMETRY AND CROSS-LINKING
J. Biol. Chem., March 3, 2006; 281(9): 5947 - 5955.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
K. Geering
FXYD proteins: new regulators of Na-K-ATPase
Am J Physiol Renal Physiol, February 1, 2006; 290(2): F241 - F250.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/19/19003    most recent
M500697200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jones, D. H.
Right arrow Articles by Kidder, G. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jones, D. H.
Right arrow Articles by Kidder, G. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement