Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M412238200 on March 22, 2005

J. Biol. Chem., Vol. 280, Issue 20, 19551-19562, May 20, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/20/19551    most recent
M412238200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Braglia, P.
Right arrow Articles by Dieci, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Braglia, P.
Right arrow Articles by Dieci, G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Sequence Context Effects on Oligo(dT) Termination Signal Recognition by Saccharomyces cerevisiae RNA Polymerase III*

Priscilla Braglia, Riccardo Percudani, and Giorgio Dieci{ddagger}

From the Dipartimento di Biochimica e Biologia Molecolare, Università degli Studi di Parma, Parco Area delle Scienze 23/A, 43100 Parma, Italy

Received for publication, October 28, 2004 , and in revised form, March 18, 2005.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Eukaryotic RNA polymerase (Pol) III terminates transcription at short runs of T residues in the coding DNA strand. By genomic analysis, we found that T5 and T4 are the shortest Pol III termination signals in yeasts and mammals, respectively, and that, at variance with yeast, oligo(dT) terminators longer than T5 are very rare in mammals. In Saccharomyces cerevisiae, the strength of T5 as a terminator was found to be largely influenced by both the upstream and the downstream sequence context. In particular, the CT sequence, which is naturally present downstream of T5 in the 3'-flank of some tDNAs, was found to act as a terminator-weakening element that facilitates translocation by reducing Pol III pausing at T5. In contrast, tDNA transcription termination was highly efficient when T5 was followed by an A or G residue. Surprisingly, however, when a termination-proficient T5 signal was taken out from the tDNA context and placed downstream of a fragment of the SCR1 gene, its termination activity was compromised, both in vitro and in vivo. Even the T6 sequence, acting as a strong terminator in tRNA gene contexts, was unexpectedly weak within the SNR52 transcription unit, where it naturally occurs. The observed sequence context effects reflect intrinsic recognition properties of Pol III, because they were still observed in a simplified in vitro transcription system only consisting of purified RNA polymerase and template DNA. Our findings strengthen the notion that termination signal recognition by Pol III is influenced in a complex way by the region surrounding the T cluster and suggest that read-through transcription beyond T clusters might play a significant role in the biogenesis of class III gene products.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Eukaryotic RNA polymerase (Pol)1 III is unique among DNA-dependent RNA polymerases in recognizing a simple run of T residues on the coding strand as a termination signal, in the apparent absence of accessory factors. The minimal signal thought to be sufficient to provoke Pol III termination varies among different eukaryotes. T4 suffices for termination by Xenopus and human Pol III (1, 2), T4/T5 for Schizosaccharomyces pombe Pol III (3), and T5/T6 for Saccharomyces cerevisiae Pol III (4). Pol III termination within T clusters is generally heterogeneous and progressive (5), and termination efficiency tends to increase with the length of the T run (4). Mechanistically, Pol III termination involves extensive pausing, dictated by the T cluster itself (5, 6). Even during elongation, the addition of three UMP residues in succession is particularly slow (5). Pol III pausing at T clusters sets cycles of hydrolytic RNA chain retraction (7). Both pausing and the associated hydrolytic RNA cleavage are affected by mutations in the C160, C128, and C11 subunits of yeast Pol III (79). In the case of C128 and C11, the same mutations have also been shown to affect the termination properties of Pol III, thus suggesting a functional interplay between hydrolytic RNA cleavage and transcription termination (9, 10). The termination-prone character of Pol III is consistent with class III genes being very short, a fact that reduces the probability of unwanted termination signals within the coding regions. At the same time, the high efficiency of Pol III termination, by favoring polymerase recycling and transcription reinitiation, is likely to contribute in a crucial way to the high level of transcript production typical of Pol III (1113).

The facility of Pol III termination poses questions that have not yet been addressed exhaustively. One of them relates to the mechanism allowing for easy termination by Pol III. Pol I and Pol II transcription units very often contain long T clusters, yet these two RNA polymerases do not terminate at these sequences, although T clusters are thought to generally induce RNA polymerase pausing. On which molecular features thus resides the distinctive ability of Pol III to terminate efficiently at short T clusters? At least part of the Pol III termination proneness has been attributed to the presence in this enzyme of the Rpc11p subunit, which is endowed with RNA cleavage-stimulating activity (9). Such a feature, however, seems not to be unique to Pol III, since Pol I and Pol II both contain subunits that share sequence homology with Rpc11p and might similarly be involved in termination (14). A recent study has further suggested that the termination-prone character of Pol III may also come from a marked propensity of the enzyme toward RNA release, such that every T-rich sequence at which Pol III pauses for a sufficiently long time would become a termination site (15). Such a termination propensity takes us to another important question, arising from the observation that Pol III-transcribed genes often contain internal stretches of T residues that would be predicted to provoke transcription termination. Is intragenic termination impaired in such cases, and by which mechanisms? A previously characterized example related to this issue is that of a tRNALys gene from Xenopus laevis, in which two T4 tracts, one located at a canonical downstream position and the other one within the gene itself, determine transcription termination to different extents, with the internal T4 cluster behaving as a much weaker terminator than the external one (16). The idea that the sequence context can generally influence the efficiency of T clusters first emerged from early studies of Pol III termination (1) and was confirmed and extended by later studies of transcription termination on the adenovirus VA RNA genes (17, 18). The surrounding sequences seem to influence Pol III termination especially at short T clusters. In Xenopus, for example, only T4 terminators display a context-dependent strength, whereas clusters of five or more T residues are highly efficient as terminators independently from the context (1). The few documented cases of surrounding sequence effects can hardly be accommodated into general rules of sequence specificity, because the same flanking nucleotides were found to produce different (or even opposite) effects on the terminators of different class III templates (1, 16, 18). Further adding to the complexity of the sequence requirements for Pol III termination, several observations also suggested the existence of Pol III termination signals that do not conform to the general "T-cluster" rule (1820).

In this study, we show that termination at oligo(dT) tracts by S. cerevisiae Pol III can be influenced by the flanking sequences to a previously unsuspected extent, and we address the sequence requirements and molecular mechanisms of such effects.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Statistical Analysis of tDNA 3'-Flanking Regions—Coordinates for the tDNA downstream regions were predicted directly from the genomic sequences of S. cerevisiae, S. pombe, Mus musculus and Homo sapiens by using Pol3scan (21) and tRNAscan-SE (22). Predicted tRNA genes were considered for the analysis if the tRNA boundaries and anticodon type were found to be identical by the two methods. Although this criterion does not guarantee the identification of all the genomic tDNAs, it strongly limits the occurrence of false positive results. The portions corresponding to the 100 nucleotides immediately downstream to the mature tRNA coding sequence were extracted as FASTA files and used for the analysis of terminator signals. A Perl script was designed for statistical analysis of T-runs of arbitrary length, making use of the BioPerl library (23).

DNA Templates—For tRNA gene nomenclature, we refer to MIPS (Munich Information Center for Protein Sequences; available on the World Wide Web at mips.gsf.de/proj/yeast/rna/trna.html). The P(AG-G)CR, N(GTT)CR, N(GTT)KL, and N(GTT)OL tDNAs have been described (24). The V(AAC)MR2 tDNA is carried by the previously described pY7 plasmid (25). The Saccharomyces cerevisiae tDNA L(CAA)LR2 was PCR-amplified from yeast genomic DNA (strain S288C) by using the high fidelity Deep Vent DNA polymerase (New England Biolabs) and the oligonucleotide primers L_fw (5'-GCAAATAAACGTTGGAAATTGGC) and L_rev (5'-GGTAGGAAAAAAAGATGCTGCAC). The tDNAs S(AGA)EL and M(CAT)E were amplified by using the Pfu Turbo DNA polymerase (Stratagene) and the following pairs of oligonucleotide primers: S_fw (5'-GGGAACTCTCAGAACGGGGG) and S_rev (5'-CGAGTTTTTACCCATTTAGGAAAAG); M_fw (5'-GCGACATGGAGAGATAGAGATAG), and M_rev (5'-CGCAGAAGTTAAAGCTTATAGTC). The 3'-mutant forms of N(GTT)CR and L(CAA)LR2 were obtained by PCR using the cloned tDNAs as templates and the appropriate mutagenic reverse primers. All of the amplification products were inserted into pUC-derived plasmid vectors and sequence-verified by dideoxy chain termination sequencing. The SCR1{Delta}_T7 construct is the previously described 3'{Delta}+90 variant of SCR1 (26). For in vivo analysis, this SCR1 gene variant was subcloned into the YEp352 shuttle vector. The SCR1{Delta}_3'L template was obtained using the cloned wild type SCR1 gene as a template, the oligonucleotide 5'-TGATCAACTTAGCCAGGACATCC as a forward primer, and the oligonucleotide 5'-AAAAAAAAAACTTCAAAATTTTCGGAAGGCAAAAACGTGCAATCCGG as a reverse primer. The amplified fragment, corresponding to the fusion of the first 90 bp of the SCR1 gene with the T5 terminator plus 20 bp of 3'-flank of L(CAA)LR2 followed by a T10 terminator, was cloned into the YEp352 vector. The 5'U6-L(CAA)LR2 and 5'U6-L_3'N templates were created by PCR using the corresponding cloned constructs as templates and the forward primer 5'-TTTCGGCTACTATAAATAAATGTTTTTTTCGGAGCTCTTACAACAAATAAGTGGTTGTTTGG, carrying the 5'-flanking sequence of the SNR6 gene of S. cerevisiae immediately followed by a SacI site (underlined). The amplified fragments were inserted into a modified pNEB193 plasmid whose polylinker SacI site was disrupted. The 5'U6-SCR1{Delta}_3'L construct was generated by PCR using the oligonucleotide 5'-TTTCGGCTACTATAAATAAATGTTTTTTTCGCAACTAGCTAGGCTGTAATGGCTTTCTG, carrying the 5' sequence of the SNR6 gene, as a forward primer. In a different construct, the SacI restriction site was placed 5 bp upstream of SCR1{Delta}_3'L; the SCR1{Delta}_3'L variants were both inserted into the modified pNEB193. The SNR52 transcription unit was PCR-amplified from yeast genomic DNA (strain S288C) by using Pfu Turbo DNA polymerase and the following oligonucleotide primers: SNR52_fw (5'-TGATCAACTTAGCCAGGACATCC), SNR52_rev (5'-GTTCTAAGTATTCTCATTTTATCC). The SNR52_mutT mutant was constructed by recombinant PCR (27). Two overlapping PCR primary products were generated using the SNR52_fw oligonucleotide in combination with the mutT_rev primer (5'-GTAGGGTGTGAACGAATGCGCACC) and the SNR52_rev oligonucleotide in combination with the mutT_fw primer (5'-GGTGCGCATTCGTTCACACCCTAC). Mutated positions in mutT_rev and mutT_fw are underlined. After gel purification, primary amplification products were mixed and used as templates in a subsequent amplification reaction, employing SNR52_fw and SNR52_rev as "outside" primers, which yielded the desired full-length secondary product. The 5'U6_SNR52 variant of SNR52, carrying the 5'-flanking sequence of SNR6, was generated by PCR using cloned wild type SNR52 as a template and the oligonucleotide 5'-TTTCGGCTACTATAAATAAATGTTTTTTTCGCAACTA as a forward primer. All of the SNR52 variants were cloned into the pNEB193 plasmid vector.

In Vitro Transcription Analyses—In vitro transcription reaction conditions and procedures for RNA purification and analysis were essentially as described (13, 28). Reactions contained 40 fmol of plasmid-borne class III template and the following amounts of transcription proteins: 150 ng of TFIIIC purified up to the DEAE-Sephadex A-25 step (29); 40 ng of pure, recombinant TATA box-binding protein, and 80 ng of recombinant Brf1, both purified from overexpressing Escherichia coli cells (29); 0.5 µg of B'' fraction partially purified, up to the Bio-Rex 70 chromatography step, from chromatin pellets generated during yeast nuclear extract preparation (30). The last three components reconstitute a highly active TFIIIB factor. Unless otherwise indicated, the ATP, CTP, and GTP concentration was 500 µM, and UTP concentration was 250 µM. Transcripts were radiolabeled using [{alpha}-32P]UTP. Template DNA was first incubated with TFIIIC and TFIIIB for 20 min at 20 °C, and then Pol III (10 ng) and NTPs were added, and transcription was allowed to proceed for 20 min at 20 °C. In Fig. 7, A and B, transcription complexes were assembled either in the presence or in the absence of TFIIIC, using increased amounts of the different components of TFIIIB: 400 ng of TATA box-binding protein, 240 ng of Brf1 and either 0.7 µg of B'' fraction (Fig. 8B), or 20 ng of recombinant yeast Bdp1 (13) (Fig. 7A). For the factorless transcription experiment in Fig. 7B, 3'-overhanged restriction fragments were obtained by digesting the above described SacI site-containing templates with SacI, cutting 5 bp upstream of the natural transcription start site, and either BamHI (for L(CAA)LR2) or NdeI (for L_3'N and SCR1{Delta}_3'L), cutting downstream of the cloned insert in the plasmid polylinker. Restriction fragments were gel-purified, treated once with phenol/chloroform, and ethanol-precipitated prior to use in transcription assays. General transcription conditions were the same as in factor-directed transcription. The 3'-overhanged fragment (30 ng) was first incubated with 20 ng of purified Pol III and 400 µM CpU dinucleotide primer in transcription buffer containing 160 µg/ml bovine serum albumin for 15 min at 20 °C in a total volume of 25 µl. NTPs and [{alpha}-32P]UTP (10 µCi) were then added, and transcription was allowed to proceed for 30 min at 20 °C. In all transcription experiments, radioactive transcripts were quantified by phosphorimaging. For termination efficiency measurements, the signals corresponding to RNAs of different length were normalized for the number of incorporated U residues.

In Vivo RNA Analysis—Yeast cells (YPH500 strain) were transformed with the different YEp352-SCR1{Delta} constructs by the lithium acetate procedure (31), and the resulting transformants were selected for uracil auxotrophy. Total RNA was prepared according to a previously described procedure (32). RNA samples (10 µg) were electrophoresed on 6% polyacrylamide, 7 M urea gels and transferred to a Gene-Screen Plus membrane (PerkinElmer Life Sciences), which was then probed with a 5'-labeled oligonucleotide (5'-CTGGCCGAGGAACAAATCCTTCCTCGCGGC) complementary to the coding region of SCR1 between positions +43 and +73. Hybridization was carried out overnight at 28 °C in 5x SSC solution, 5x Denhardt's solution, 0.1 mg/ml denatured salmon sperm DNA, 0.5% (w/v) SDS, followed by one short washing in 2x SSC solution containing 0.1% SDS and two short washings in 1x SSC solution containing 0,1% SDS. Hybridization products were visualized and quantified by phosphorimaging.



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 1.
Distribution of tDNA terminator length among different eukaryotes. Frequency distribution analysis of poly(dT) terminator length was conducted on the subsets of tDNAs (from S. cerevisiae, S. pombe, M. musculus, and H. sapiens genomes) possessing a single Pol III termination signal starting within the first 40 bp downstream of the mature tRNA coding region. Such subsets comprised 148, 76, 214, and 250 tDNAs in the case of S. cerevisiae, S. pombe, H. sapiens, and M. musculus, respectively. Upper panel, T-run length distribution in the yeasts S. cerevisiae and S. pombe. Lower panel, T-run length distribution in H. sapiens and M. musculus.

 

    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Oligo(dT) Termination Signals in Different Eukaryotic Genomes—The flanking regions of eukaryotic tRNA genes present conserved sequence patterns that diverge considerably in going from yeast to mammalian genomes (24). As a further element of divergence, yeast and human RNA polymerase III enzymes respond differently to oligo(dT) terminators (3). To gain insight into Pol III termination signals on a genome-wide scale, we thus decided to analyze and compare the tDNA transcription terminators in two yeast (S. cerevisiae and S. pombe) and two mammalian (M. musculus and H. sapiens) genomes. Using the complete tRNA gene inventories from these genomes, we initially searched for the presence of runs of 4 or more T residues within the first 100 bp of the 3'-flanking region, because T4 is the shortest known oligo(dT) tract causing Pol III termination (33). In S. cerevisiae and S. pombe, T4 was never found as the sole potential termination signal: a run of 5 or more T residues was always present, and it always started within the first 40 bp following the end of the mature tRNA coding sequence.2 This was taken as an indication that runs of less than 5 T residues are not used as Pol III terminators in yeast and that Pol III termination signals appear within the first 40 bp of 3'-flanking sequence. In contrast, many mammalian tDNAs had a run of 4 T residues as the sole potential termination signal in the same region, in agreement with the reported ability of human Pol III to terminate efficiently at T4, and with the observation that yeast Pol III requires longer T stretches than vertebrate Pol III in order to terminate efficiently (3, 33). Again, most termination signals occurred within 40 bp of the 3'-flanking region. Therefore, we considered T5 and T4 as the minimal termination signals for yeast and mammalian tDNA transcription, respectively. By limiting further analysis to the first 40 bp of 3'-flanking sequence, we then selected, from each tDNA set, the tDNAs having a single T run within that region. Such "single terminator" tDNAs represented 56, 47, 69, and 67% of all tDNAs in S. cerevisiae, S. pombe, H. sapiens, and M. musculus, respectively. We then calculated, for the subsets of single terminator tDNAs from each genome, the frequency distribution of T run length. The aim of such analysis was to establish whether the T run length in the different tDNA sets correlates with lineage-specific differences in termination signal recognition by Pol III. The tDNAs with more than one termination signal within the first 40 bp of 3'-flank were excluded from analysis, because the presence of a potential "back up" terminator could have reduced the selective pressure on the upstream terminator. The results of this analysis are shown in Fig. 1. In S. cerevisiae and S. pombe, the most frequent T run lengths are 6 and 7, and (as already mentioned) there is no single terminator shorter than T5. Remarkably, the tDNA terminators in fission yeast tend to be ~1 nt shorter than in S. cerevisiae, in agreement with a previous analysis showing that S. cerevisiae Pol III requires slightly longer T runs than the fission yeast enzyme in order to terminate efficiently (3). The T-run length distribution in mammals is completely different: T4 is the most frequent tDNA terminator, and terminators longer than T5 are rare. Again, this finding is in agreement with the reported ability of human Pol III (and, more generally, of vertebrate Pols III) to terminate efficiently at T4 sequences (1, 3, 18, 33).



View larger version (61K):
[in this window]
[in a new window]
 
FIG. 2.
In vitro transcription of yeast tRNA genes displaying T5 as the first termination signal. A, nucleotide sequences of the terminator regions of eight yeast tRNA genes displaying T5 as the first encountered termination signal. The sequences are aligned on the T5 terminator (underlined). The sequence corresponding to the mature tRNA is in boldface and italic type. For tDNA 1, the sequence of a 44-bp tract (location indicated) has been omitted. B, in vitro transcription of the templates in A. Lanes 1–8 refer to the templates identified by the same number in A. All of the tDNAs except for number 2 possess a downstream back-up terminator that allows to monitor polymerases reading through T5; template 2 was linearized 121 bp downstream of T5 in order to reveal read-through events as run-off transcripts. Left, the transcription reactions were carried out in the presence of 25 µM UTP; right, the transcription reactions were carried out in the presence of 250 µM UTP. The percentage of tDNA transcripts terminated at T5 is reported below each lane.

 
Variable Strength of the T5 Terminator in S. cerevisiae tDNAs—Of the 148 "single terminator" tDNAs of S. cerevisiae, 22 bear a simple run of 5 Ts as a termination signal. For such tDNAs, the T5 sequence is thus expected to be endowed with the ability to induce efficient Pol III termination. On the other hand, previous studies have shown that 5 consecutive T residues in the 3'-flanking sequence of yeast tDNAs are only partially effective in inducing Pol III transcription termination (3, 4). To better define the termination properties of the T5 sequence, we initially analyzed transcription termination on eight yeast tRNA genes all displaying T5 as the first termination signal encountered in the 3'-flanking region. These genes are listed in Fig. 2A, together with the features of their 3'-flanks. Two of them (numbers 1 and 2) are classified as "single terminator" tDNAs. In the other tRNA genes, T5 is followed by a back up terminator located 3–20 bp downstream. The presence of a downstream T run allows to easily monitor polymerases reading through the T5 terminator by their production of longer transcripts terminated at the downstream T cluster. This is also true in the case of tDNA 1 (L(CAA)LR2), since a back-up T run is present starting at 66 bp downstream of T5. In the case of P(AGG)CR, where no back-up T run is present, the tDNA-containing plasmid was linearized 121 bp downstream of T5, so as to be able to reveal reading-through polymerases by their production of longer, run-off transcripts. All of these templates were used to program in vitro transcription reactions in a reconstituted system from S. cerevisiae (see "Experimental Procedures"). Transcription was performed in the presence of either a low UTP concentration (25 µM; Fig. 2B, left panel) or a 10-fold higher UTP concentration (Fig. 2B, right panel) closer to the in vivo UTP concentration, estimated to be in the millimolar range (34, 35). Fig. 2B shows that the strength of T5 as a terminator varies considerably in the different contexts and that T5 read-through by Pol III is in some cases strongly favored at the higher UTP concentration (cf., for example, lanes 3 and 4 of the left panel with the same lanes of the right panel), in other words under conditions that increase the polymerization rate and thus decrease the dwell time of the enzyme at T5. For six of the eight genes, the T5 element acted as a strong terminator (lanes 1, 2, and 5–8). In contrast, for two tDNAs (lanes 3 and 4), a large fraction of polymerases read through the T5 element and terminated at the back up terminator. The two T5 elements behaving as weak terminators are both immediately followed by the sequence CT and, a few base pairs downstream, by a longer T run acting as a back up terminator (tDNA 3 and 4 in Fig. 2A). In contrast, the six T5 elements acting as strong terminators are all immediately followed by A or G, with the exception of M(CAT)E (tDNA 5). The T5 element of M(CAT)E is immediately followed by C and is characterized by a slightly lower strength as a terminator (cf. lane 5 with lanes 1, 2, 6, 7, and 8 in the right panel of Fig. 2B). It is interesting to note that T5 is flanked by almost identical upstream sequences in the case of N(GTT)CR (tDNA 3), N(GT-T)KL (tDNA 6), and N(GTT)OL (tDNA 7). Therefore, the remarkable difference in terminator strength between N(GT-T)CR (lane 3) and the other two tRNAAsn genes (lanes 6 and 7) can reasonably be attributed to the downstream sequence context.



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 3.
Termination properties of 3'-flank variants of L(CAA)LR2 and N(GTT)CR tDNAs. A, nucleotide sequence of the terminator-surrounding regions of L(CAA)LR2 and N(GTT)CR tDNAs and their 3'-flank variants. The T5 terminator is in boldface type and underlined. When present, the back-up terminator is in boldface type. The L_{Delta}3' and N_{Delta}3' constructs were both linearized 16 bp downstream of T5 in order to reveal read-through events by the presence of run-off transcripts. B, in vitro transcription assay (conducted in the presence of 250 µM UTP) of the templates reported in A. The arrows on the left and on the right indicate the migration positions of transcripts terminated at the T5 element of L(CAA)LR2 and N(GTT)CR, respectively.

 
Influence of the Downstream Sequence on Pol III Termination at T5To investigate in more detail the downstream sequence effect on T5 terminator strength, we focused on two of the tDNAs tested in the previous experiment: L(CAA)LR2 (tDNA 1), whose T5 is one of the strongest terminators, and N(GTT)CR (tDNA 3), whose T5 is the weakest terminator observed in Fig. 2 and is flanked by a back up terminator 7 bp downstream. We initially constructed and tested two hybrid templates (Fig. 3A): the L_3'N template, in which the sequence downstream of the L(CAA)LR2 T5 terminator was replaced by the CT4CT13 sequence naturally present downstream of T5 in N(GTT)CR and the N_3'L template, in which the sequence downstream of the N(GTT)CR T5 element was replaced by 20 bp of the sequence naturally present downstream of the L(CAA)LR2 T5 terminator, followed by an artificially placed T10 back-up terminator. In the L_3'N context, the T5 terminator of L(CAA)LR2 turned out to be remarkably weakened, displaying (at 250 µM UTP) a termination efficiency of 55% as compared with 98% in the case of the wild type L(CAA)LR2 gene (Fig. 3B, cf. lanes 1 and 2). On the other hand, when N(GTT)CR with its T5 element was fused to the 3'-flanking sequence derived from L(CAA)LR2, the strength of T5 as a terminator was greatly increased (Fig. 3B, cf. lanes 4 and 5). There are two possible explanations for the above observations. The T5 element might be intrinsically weak as a terminator, and the particular downstream context in L(CAA)LR2 would potentiate its termination proficiency; in this case, T5 weakening in L_3'N would be simply due to the removal, and T5 strengthening in N_3'L to the insertion, of a terminator-strengthening sequence. Alternatively, the CT4CT13 sequence naturally present 3' to the T5 element in N(GTT)CR might directly act as (or contain) a terminator-weakening element. According to the second hypothesis, the replacement of the sequence downstream of T5 in N(GTT)CR with an unrelated sequence should increase the T5 strength as a terminator, whereas the replacement of the sequence downstream of T5 in L(CAA)LR2 with an unrelated sequence should not decrease the T5 terminator efficiency. In the experiment in Fig. 3B, the termination properties of the unmodified L(CAA)LR2 and of the L_3'N construct were compared with those of a L(CAA)LR2 derivative (L_{Delta}3') in which the 3'-flanking sequence downstream of T5 was replaced by a plasmid sequence (lane 3). Similarly, the termination properties of unmodified N(GTT)CR and of the N_3'L construct were compared with those of a N(GTT)CR derivative (N_{Delta}3') in which the T5 3'-flank was replaced by the same plasmid sequence as in L_{Delta}3' (lane 6). Termination at T5 appeared to be unaffected in the L_{Delta}3' construct with respect to unmodified L(CAA)LR2 (cf. lanes 1 and 3), whereas the strength of the N(GTT)CR T5 element was greatly increased in the N_{Delta}3' construct (cf. lanes 4 and 6). (Since no rescue terminator is present downstream of T5 in the L_{Delta}3' and N_{Delta}3' templates, they were linearized with BamHI at a position 16 bp downstream of the T5 sequence). The CT4CT13 sequence thus behaves as (or appears to contain) a terminator-weakening element. This conclusion is further supported by the observation that T5 is weak in only two of the eight tDNAs tested in the experiment in Fig. 2 (N(GTT)CR and S(AGA)EL) and that in both cases T5 is followed by similar CT-containing sequences (CT4CT13 in the case of N(GTT)CR, CTCT8C in the case of S(AGA)EL).

Sequence and Positional Requirements for T5 Terminator Weakening—To better understand the T5 terminator weakening effect, we concentrated on the L_3'N chimeric template, whose downstream weakening sequence, CT4CT13, was subjected to mutational analysis. In particular, mutants were constructed in which the CT4C sequence was variously replaced, whereas the downstream T13 tract was left unvaried (or shortened to T10) and used as a back-up terminator. All of the mutant constructs, schematically illustrated in Fig. 4A, were tested in an in vitro reconstituted system in at least three independent experiments. The results are shown in Fig. 4B. Pol III transcriptional read-through at T5 was first calculated on the basis of the ratio between T5-terminated and T13/T10-terminated transcripts. In each experiment, the extent of T5 terminator read-through observed with the L_3'N template (lane 2) was arbitrarily set to 100, and the effect of the mutations was evaluated as relative T5 read-through with respect to L_3'N. When the first 3 nucleotides downstream of T5 (CTT) were changed to GCC, so as to render the 6 base pairs downstream of T5 identical to the sequence found in the wild type L(CAA)LR2 tDNA, the weakening effect was strongly diminished (~5-fold) with respect to L_3'N (cf. lanes 2 and 4). Since the CTT to GCC substitution, which increases the predicted stability of the DNA double helix immediately downstream of T5, strongly affected its weakening potential, we wondered whether replacing the downstream sequence with other sequences characterized by a similar (or even lower) DNA duplex stability would preserve (or increase) the weakening effect, and thus T5 read-through. To address this point, the T4 stretch in CT4C was replaced by TATA, ATAT, or A4. As shown in Fig. 4B, lanes 6–8, and in the bar plot above the gel, such substitutions led to a partial loss of the weakening effect: a 40–50% loss in the case of A4 and ATAT and only a 20% loss in the case of TATA. The prediction of DNA duplex stability on the basis on nearest neighbor thermodynamics gives A4 = T4 > ATAT > TATA (36). Therefore, among the three substitutions, the one causing the strongest read-through (TATA) is also the one displaying the lesser DNA duplex stability. However, despite its higher predicted stability, the original T4 sequence causes more read-through than TATA. We conclude that a low DNA duplex stability in the region immediately downstream of T5 is not sufficient for full T5 terminator weakening, even if it somehow contributes to the weakening effect. This conclusion is also supported by the comparison of the termination properties of tDNAs 3 and 7 in Fig. 2. The T5 terminator of tDNA 7 is much stronger than the T5 terminator of tDNA 3, yet the predicted stability of the immediately downstream 6-bp sequence (CT4C for tDNA 3, GAATAC for tDNA 7) is very similar (36). With another series of constructs (templates 5, 9, and 10 in Fig. 4) we then analyzed the positional requirements for T5 terminator weakening. In all of these constructs, the T13 element was replaced by T10, a sequence that works as efficiently as T13 as a downstream terminator and does not interfere with the T5 weakening effect (data not shown). In construct 5, the distance between the T4 and T10 stretches, which are separated by only 1 bp in the L_3'N template (lane 2), was increased to 11 bp. As shown in Fig. 4B, T5 terminator weakening in this context was very similar to that observed with L_3'N(cf. lanes 2 and 5). The CT4C sequence thus appears to act as an autonomous, termination-weakening element. In contrast, the weakening effect was found to be compromised in constructs in which the distance between T5 and the CT4C sequence was increased by 3 bp (construct 10, lane 10) or even by only 1 bp (construct 9, lane 9). The terminator weakening effect exerted by the CT4C sequence thus seems to depend in a critical way on its distance from the T5 terminator. Having restricted the terminator-weakening function to the CT4C sequence, we constructed other mutants (constructs 11–15 in Fig. 4A) in order to identify the minimal sequence requirements for the terminator weakening effect. As shown in lane 13, the C residue separating the T4 stretch from the downstream T10 sequence could be mutated without any loss of terminator weakening (on the contrary, a 50% increase in T5 read-through with respect to L_3'N was reproducibly observed with this mutant; cf. lanes 2 and 13). With templates 14 and 15, in which the length of the T4 stretch was progressively reduced, the weakening effect was maintained (lanes 14 and 15). The mutation of the C residue, immediately following the T5 element, to A reproducibly reduced the read-through efficiency by ~65% with respect to L_3'N (cf. lanes 2 and 11). The mutation of the same residue to G produced a more modest, but still significant effect, reducing T5 read-through by ~40% with respect to L_3'N (cf. lanes 2 and 12). A C residue immediately downstream of T5 is thus required for full weakening efficiency. The results of this mutational analysis, together with the data in Fig. 2, suggest that a CT dinucleotide immediately downstream of a T5 terminator represents a minimal sequence element capable of producing a significant terminator weakening effect. That CT alone is sufficient to induce read-through is especially evident from the termination properties of tDNA 4 in Fig. 2 and template 8 in Fig. 4. This weakening element, however, appears to be only effective on the T5 terminator. When the termination signal length was increased to T6, the weakening effect was lost (Fig. 4B, lane 16).



View larger version (40K):
[in this window]
[in a new window]
 
FIG. 4.
Properties of the L(CAA)LR2 T5 terminator fused with different 3'-flanking sequences. A, nucleotide sequence of the L(CAA)LR2 variants resulting from mutagenesis of the region downstream of T5. Only the sequence 3' to the T5 terminator (in boldface type and underlined) is reported. The back-up terminator is in boldface type. Templates 1–3 are the same as in Fig. 3. B, the lower part shows the results of in vitro transcription assays of the templates listed in A (identified by the numbers above the lanes). The migration positions of the different tDNA transcription products, terminated at the first or the second T-run, are indicated on the right, together with the position of a 415-nt-long DNA used as a recovery marker (RM). Reported in the upper part is a bar plot deriving from quantification of three independent experiments. Pol III transcriptional read-through at the first terminator was calculated on the basis of the ratio between tDNA transcripts terminated at the first and second T-run. In each experiment, the transcriptional read-through observed with the L_3'N template (template 2) was set to 100, and the effect of the mutations was evaluated as relative T5 read-through with respect to L_3'N and reported on the y axis, with error bars indicating the S.E.

 



View larger version (49K):
[in this window]
[in a new window]
 
FIG. 5.
Transcriptional read-through at a T5 terminator is influenced by the concentration of the next incoming nucleotide. In vitro transcription assays of the L(CAA)LR2, L_3'N, and L_3'GT4 templates (template 1, 2, and 12 of Fig. 4, respectively) were carried out in the presence of either standard concentrations of NTPs (500 µM ATP, CTP, and GTP; 250 µM UTP; lanes 1–3), low CTP concentration (50 µM; lanes 4–6), or low GTP concentration (50 µM, lanes 7–9). The migration positions of the transcripts terminated at the first or second T-run are indicated on the right. The percentage of tDNA transcripts terminated at T5 is reported below each lane.

 
Mechanism of T5 Terminator Weakening by Downstream Sequence—The oligo(dT) tracts acting as Pol III terminators have the ability to induce both RNA polymerase pausing and transcript release. These two features are functionally distinguishable and are characterized by different sequence requirements (6, 15). Weakening of the T5 terminator by a CT sequence placed immediately downstream may involve an impairment of both (or only one) of these abilities. To gain insight into the mechanism of T5 terminator weakening, we first analyzed termination on the L_3'N template (construct 2 in Fig. 4A) and on the L_3'GT4 template (template 12 of Fig. 4A, in which the C immediately downstream of T5 is replaced by G) in the presence of a standard (500 µM) and a 10-fold lower concentration of CTP. Lowering CTP concentration is expected to increase the dwell time of Pol III across the T5 sequence in L_3'N, but not in L_3'GT4, by reducing the rate of incorporation of the first nucleotide downstream of T5. In the same way, lowering the GTP concentration should increase the dwell time of Pol III onto the T5 element in L_3'GT4, but not in L_3'N. As shown in Fig. 5, in the presence of 50 µM CTP (lane 5) the T5 terminator in L_3'N turned out to be significantly stronger than with 500 µM CTP (lane 2), with a ~3-fold reduction in the fraction of reading-through polymerases (from 45% in lane 2 to 14% in lane 5). Lowering the GTP concentration had instead no effect on T5 read-through with this template (cf. lanes 2 and 8). With the L_3'GT4 template, lowering the CTP concentration did not influence the extent of T5 read-through, whereas the fraction of reading-through polymerases was slightly (but reproducibly) decreased at low GTP concentration (from 22% in lane 3 to 17% in lane 9). T5 terminator weakening can thus be specifically counteracted by reaction conditions that favor polymerase pausing on T5.

Effect of the Upstream Sequence Context on T5 Terminator Efficiency—Altogether the above data show that termination efficiency at T5 can be strongly influenced by the downstream sequence context, in a manner that is independent from the specific tRNA coding sequence preceding the T5 element. To further test for possible effects of the upstream flanking sequence on T5-dependent termination, we generated a construct (SCR1{Delta}_3'L) in which the L(CAA)LR2 T5 terminator, plus 20 bp of its natural 3'-flanking sequence followed by T10, were fused to the first 90 bp of the SCR1 gene, coding for the S. cerevisiae 7SL RNA. Apart from the presence of A- and B-blocks allowing for efficient in vitro transcription by the Pol III system (26), this portion of the SCR1 gene is essentially unrelated to tRNA coding sequences. As shown in Fig. 6A, lane 1, the insertion of a T7 terminator at position +90 of SCR1 results in a template (SCR1{Delta}_T7) whose transcription is efficiently terminated at T7, thus generating 90-nt-long transcripts; no read-through transcription products were observed when this template was linearized 25 bp downstream of T7 (data not shown). Surprisingly, the L(CAA)LR2-derived T5 element plus 3'-flank, which produced a 97% termination efficiency in the case of the original template (see, for example, Fig. 2, lane 1), behaved as a poor terminator in the SCR1{Delta}_3'L construct, allowing ~40% of the polymerases to read through and terminate at the downstream T10 terminator in the presence of 250 µM UTP (Fig. 6A, lane 2). Read-through was significantly less in the presence of 25 µM UTP (lane 4) and almost absent with 2.5 µM UTP (lane 6), thus suggesting that the SCR1-derived upstream sequence reduces termination at T5 by affecting Pol III pausing. Transcription termination with the SCR1{Delta}_3'L construct could also be monitored in vivo, because the 20-bp distance between the T5 element and the downstream T10 terminator allows for the production of transcripts that differ from each other in size significantly and that are characterized by comparable in vivo stabilities.3 The SCR1{Delta} T7 and SCR1{Delta}_3'L templates were inserted into the high copy number YEp352 vector and transformed into the YPH500 S. cerevisiae strain. The RNAs derived from logarithmically growing cells were then subjected to Northern blot analysis with an SCR1-specific antisense oligonucleotide. As shown in Fig. 6B (lane 2) 55% of the plasmid-encoded, SCR1-derived transcripts were terminated at T5, whereas 45% were 20 nt longer and derived from T5 read-through and termination at the downstream T10 sequence. By comparison, the T7 terminator in the SCR1{Delta}_T7 construct appeared to be fully efficient in vivo (lane 1).



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 6.
Upstream sequence effect on T5 terminator strength in vitro and in vivo. A, in vitro transcription of the SCR1{Delta}_T7 and SCR1{Delta}_3'L templates was carried out in the presence of 250 µM UTP (lanes 1 and 2), 25 µM UTP (lanes 3 and 4), or 2.5 µM UTP (lanes 5 and 6). The migration positions of transcripts terminated at the first or second T-run of the SCR1-derived templates are indicated on the right. B, in vivo expression profiles of the SCR1{Delta}_T7 and SCR1{Delta}_3'L templates. Total RNA was extracted from yeast cells (YPH500 strain) transformed with YEp352 carrying the template indicated above the lanes. Fractionated RNA samples (10 µg each) were probed with a radiolabeled oligonucleotide annealing within the first 90 bp of the SCR1 RNA product. The migration positions of the transcripts derived from the chromosome-encoded SCR1 gene and from the two plasmid-borne SCR1-derived templates (1st T and 2nd T) are indicated on the right.

 
Distinguishing between Weak and Strong T5 Terminator Sequences Is an Intrinsic Property of Pol III—The observed sequence context effects on Pol III termination at T5 might in principle be mediated by TFIIIC, a transcription factor that usually covers a large part of the transcription unit, extending up to the terminator region of tRNA genes (37, 38). TFIIIC-associated activities have previously been proposed to influence Pol III termination in humans (39), and yeast TFIIIC has recently been shown to facilitate transcription reinitiation by Pol III on long transcription units (13). The role of TFIIIC is thus not restricted to preinitiation complex assembly. To test whether TFIIIC influences termination at T5 in different sequence contexts, some of the templates in which the T5 terminator is weakened were modified so as to allow for their TFIIIC-independent transcription. To this end, the transcribed portions of L(CAA)LR2, L_3'N and SCR1{Delta}_3'L were fused to the 5'-flanking region of the S. cerevisiae SNR6 gene, which is known to support TATA box-mediated TFIIIB assembly and transcription initiation in the absence of TFIIIC (13, 40). As shown in Fig. 7A, a pronounced weakening of T5 by both the 3'N downstream context and the SCR1{Delta} upstream context was observed in the absence of TFIIIC (cf. lanes 5 and 6 with lane 4), thus demonstrating that the weakening effects do not depend on this factor. A comparison of the termination efficiencies in the presence (lanes 1–3) or absence (lanes 4–6) of TFIIIC rather suggests that TFIIIC somehow facilitated T5 termination signal recognition by Pol III, an effect that is especially evident with the 5'U6-L_3'N template (cf. lanes 2 and 5 in Fig. 7A). To test in a more direct way whether distinguishing between weak and strong T5 termination signals is an intrinsic property of Pol III, we exploited the reported ability of Pol III to initiate transcription on linear templates containing a 3'-overhanging end (41). Linear, 3'-overhanged versions of L(CAA)LR2, L_3'N and SCR1{Delta}_3'L templates were prepared as described under "Experimental Procedures" and transcribed in vitro with purified RNA polymerase III in the absence of any transcription factor. As shown in Fig. 7B, and in agreement with a previous study (41), purified Pol III specifically and efficiently transcribed these templates. Transcription initiation was made to occur at the 3'-overhanging end generated by SacI cleavage, at a position 5 bp upstream of the natural transcription start site. Pol III terminated transcription at the same terminator region present in the original templates, in which a T5 element of variable strength is followed by a back-up terminator (placed 67, 7, and 21 bp downstream of T5 in L(CAA)LR2, L_3'N, and SCR1{Delta}_3'L, respectively). A small percentage of transcription complexes (10% at most) failed to recognize both the T5 and back-up terminators, thus giving rise to run-off products (the DNA fragments used as templates ended 99, 238, and 249 bp downstream of T5 in L(CAA)LR2, L_3'N, and SCR1{Delta}_3'L, respectively). Such a small amount of run-off transcripts probably derives from transcription complexes unable to displace the RNA from RNA/DNA hybrids, a reported artifact of initiating transcription at 3'-overhanged or dC-tailed templates (6, 41). Run-off transcripts were thus not considered for quantification purposes. The T5 signal in the wild type context of L(CAA)LR2 acted as a rather strong terminator, both at 25 µM and at 250 µM UTP, with only 19% of transcription complexes reading through and terminating at the T7 back up terminator (Fig. 7B, lanes 1 and 4). In contrast, the T5 termination signal was remarkably weakened in the L_3'N and SCR1{Delta}_3'L contexts, both at 25 µM UTP (lanes 2 and 3) and at 250 µM UTP (lanes 5 and 6). The weakening effect was dramatic in the case of SCR1{Delta}_3'L, for which no transcripts terminated at T5 could be detected at 250 µM UTP (lane 6). Weakening of T5 by both the upstream and the downstream sequence contexts thus clearly reflect intrinsic recognition properties of Pol III. By comparing the extents of T5 weakening observed at 250 µM UTP in the absence of transcription factors with those observed under the same conditions with a complete transcription system (e.g. see Fig. 5, lane 2, and Fig. 6, lane 2), we note that the weakening effect is significantly enhanced in the factor-free system. Such a T5 read-through enhancement can at least in part be attributed to the absence of TFIIIC (see above in reference to Fig. 7A).



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 7.
Transcriptional readthrough of the T5 terminator is an intrinsic property of Pol III. A, in vitro transcription of L(CAA)LR2, L_3'N, and SCR1{Delta}_3'L derivatives fused to the 5'-flanking region of SNR6 was carried out at 250 µM UTP either in the presence (lanes 1–3) or in the absence (lanes 4–6) of TFIIIC. The percentage of transcripts terminated at the T5 element is reported below each lane. All of the shown lanes were part of the same transcription gel. However, lanes 4–6 derive from a ~10-fold darker exposure than lanes 1–3, to compensate for the lower transcription output obtained in the absence of TFIIIC. The migration positions of the transcripts terminated at the first or second T-run of either the SCR1-derived template (1st T(SCR) and 2nd T(SCR)) or the L(CAA)LR2-derived templates (1st T(LEU) and 2nd T(LEU)) are indicated on the right. B, 3'-overhanged restriction fragments containing the L(CAA)LR2, L_3'N and SCR1{Delta}_3'L templates were transcribed in vitro in the presence of purified Pol III and either 25 µM (lanes 1–3) or 250 µM (lanes 4–6) UTP. The percentage of transcripts terminated at the T5 element is reported below each lane. The migration positions of the transcripts terminated at the first or second T-run of either the SCR1-derived template (1st T(SCR) and 2nd T(SCR)) or the L(CAA)LR2-derived templates (1st T(LEU) and 2nd T(LEU)) are indicated on the right, together with the migration position of run-off transcripts (RO).

 
Antitermination within a Natural Pol III Transcription Unit—Recent studies of the genome-wide localization of the Pol III transcription machinery have identified the snoRNA encoding SNR52 gene as a new class III gene (4244). Northern blot and primer extension analyses suggested that the primary transcript of SNR52 is a ~250-nt precursor RNA from which a leader sequence of 160 nt is cleaved to generate the ~90-nt mature snoRNA product, and sequence analysis revealed the presence of putative A- and B-block elements within the leader sequence (42, 43). An unusual feature of this sequence, however, is that a run of 6 T residues is present within the transcribed region, a few bp downstream of the putative A-block. The T6 sequence is a highly efficient termination signal for yeast Pol III, as illustrated by the results shown in Fig. 4B (lane 16) and by the results of in vitro transcription experiments with several tDNAs bearing a T6 terminator (data not shown). As shown in Fig. 8 (lane 1), in vitro transcription of SNR52, in the presence of 25 µM UTP, produced two main transcripts. The longer transcript was identified as the SNR52 primary transcript on the basis of its size (250 nt). The shorter RNA had the size expected for a transcript terminated at the intragenic T6 element. Indeed, transcription of a mutant SNR52 template, in which T6 was changed to TTCGTT, produced higher levels of the longer transcript, whereas the shorter transcript disappeared (cf. lanes 1 and 2). Quantification of the transcripts in lane 1, corrected for the number of incorporated U residues, led us to estimate that as much as 70% of the polymerases read through the T6 element in SNR52. T6 thus behaves as an unusually weak terminator in the SNR52 context, even under conditions (low UTP concentration) that favor termination at T stretches. The inactive T6 element of SNR52 is located just downstream of a putative A-block promoter element within the transcribed region. Since TFIIIC is expected to contact such region during transcription, this factor might be required in order for Pol III to read through the internal T6. To test this possibility, the SNR52 transcription unit was fused with the 5'-flanking region of the S. cerevisiae SNR6 gene to allow for TFIIIC-independent transcription of the resulting chimeric template. As shown in Fig. 8B, the presence or absence of TFIIIC on SNR52 had no influence on the termination behavior of Pol III, characterized by highly inefficient termination at the internal T6 element at 250 µM UTP (cf. lanes 2 and 4).



View larger version (55K):
[in this window]
[in a new window]
 
FIG. 8.
T6 read-through within a natural Pol III transcription unit. A, in vitro transcription of the SNR52 gene and of the SNR52_mutT variant (in which the internal T6 element is disrupted). The reactions in lanes 1 and 2 were carried out in the presence of 25 µM UTP. The reactions in lanes 3 and 4 were carried out in the presence of 250 µM UTP. The migration positions of the full-length primary transcript and of the T6-terminated transcript are indicated on the left. B, in vitro transcription of the 5'U6-SNR52 template was carried out either in the presence (lanes 1 and 2) or in the absence (lanes 3 and 4) of TFIIIC. The reaction mixtures contained either 25 µM UTP (lanes 1 and 3) or 250 µM UTP (lanes 2 and 4).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
This work demonstrates that the recognition of oligo(dT) termination signals by S. cerevisiae RNA polymerase III can be strongly influenced by the sequence context in which the T stretch is embedded. Such influence becomes evident with the shortest termination signals encountered in yeast class III genes, namely T5 and T6, that together characterize ~40% of the yeast tDNAs possessing a single T run as a termination signal (see Fig. 1). We have been able to distinguish between two types of sequence context effect; one, that we have more extensively addressed, is due to the few base pairs immediately downstream of T5; the other was observed when a non-tDNA sequence was fused upstream of a strong terminator region (composed of T5 plus a particular 3'-flank) derived from L(CAA)LR2 tDNA. An extreme example of sequence context effect was observed with the SNR52 transcription unit, in which a T6 element placed between the A-block and the B-block promoter elements was barely recognized as a terminator by Pol III.

The main conclusion emerging from the study of the downstream sequence effect is that T5, when associated with tRNA genes, is intrinsically strong as a terminator, because it induces highly efficient termination in most of the contexts analyzed; however, features of the downstream sequence exist that can significantly weaken the T5 termination potential. A specific weakening element identified in this study seems to minimally consist of the CT dinucleotide placed immediately downstream of T5 in the coding DNA strand. The tested natural tDNAs displaying such a feature were characterized by incomplete termination at T5. The 3'-flank of N(GTT)CR, one of these tDNAs, could be transplanted 3' to another tDNA, L(CAA)LR2, without losing its T5 terminator weakening properties. By extensive mutagenesis, we were able to show that T5 weakening absolutely requires a C residue immediately downstream of T5 and is greatly favored by the presence of at least one T just after the C. With this respect, it is interesting to note that, in an early study of yeast Pol III termination, termination at T5 was found to be incomplete, both in vitro and in vivo, for a template in which T5 was followed by CT (4). T5 terminator weakening might not be an exclusive property of the CT element, and other short weakening sequences may exist. However, neither natural tDNA analysis nor extensive mutagenesis of the N(GTT)CR-derived weakening element could reveal any other sequence with higher or similar weakening activity. By which mechanism does CT downstream of T5 induce terminator read-through? Our data suggest that CT facilitates Pol III translocation by reducing its pause time at T5. Indeed, read-through tends to be lesser under conditions (such as low UTP or CTP concentrations) that increase the dwell time of Pol III across the T5 tract. We also tested the sensitivity of T5 terminator weakening to variations in KCl concentration (50–150 mM range) and Mg2+ ion concentration (3–10 mM range), which have the potential to influence the RNA release step of intrinsic bacterial termination (34), but we did not observe any significant variation in termination efficiency at T5 either in the L(CAA)LR2 or in the L_3'N contexts (data not shown). Possible mechanistic explanations of the effect of downstream DNA on translocation include the stability of the duplex that must be melted or NTP binding to a melted region of downstream DNA, which would facilitate translocation (4649). Our data tend to exclude a simple correlation between T5 terminator weakening by downstream DNA and the ease of duplex melting. For example, template 6 in Fig. 4 displayed the same duplex stability as template 2 in the region immediately downstream of T5 (CA4 versus CT4), yet the weakening effect was ~2-fold lower with CA4 than with CT4. Also, the introduction, in template 9 of Fig. 4, of an A residue before CT4 completely abolished the weakening effect of CT4 without changing significantly the duplex stability of this region. Our data rather suggest that the CT element might increase the processivity of Pol III at the position immediately upstream, possibly by a mechanism involving the binding of the corresponding NTPs to an allosteric NTP binding site, as recently proposed to explain downstream DNA effects on elongation by both E. coli RNA polymerase (49) and yeast RNA polymerase II (48).

Having established that T5, followed by the sequence naturally present in the L(CAA)LR2 tDNA, behaves as a strong terminator for Pol III, even when fused 3' to a completely different tDNA (see Fig. 3), we were surprised to find that the same sequence becomes a much weaker terminator when fused 3' to an A- and B-block-containing segment of the SCR1 gene. Even more surprising was the finding that the T6 sequence, generally producing highly efficient Pol III termination, was substantially inactive as a terminator in the context of the SNR52 gene, where it is naturally present between the A-block and B-block promoter elements preceding the snoRNA coding sequence. Although the sequence and positional requirements for both the SCR1 and the SNR52 effects were not investigated in detail, in both cases read-through was found to be favored at higher UTP concentrations, thus indicating that these effects involve an alteration of Pol III pausing. The results of experiments in which transcription initiation and termination were made to occur in the absence of TFIIIC further suggest that T5/T6 read-through in these two contexts does not require TFIIIC. Rather, in the absence of TFIIIC, read-through tended to be more pronounced, an observation that might be explained by postulating that DNA-bound TFIIIC slightly slows RNA chain elongation, thus favoring termination at T5. DNA-bound TFIIIC has previously been shown to exert no significant effect on RNA chain elongation by Pol III in the sense direction of the SUP4 tRNATyr gene (41). It cannot be excluded, however, that in specific sequence contexts, TFIIIC contributes to Pol III pausing and termination. By in vitro transcription experiments conducted in the presence of purified Pol III and template DNA only, we showed that T5 terminator weakening also occurs in the absence of any transcription factor and thus reflects intrinsic recognition properties of Pol III, a conclusion in agreement with that of an early study of termination by Xenopus Pol III (2). The T5 weakening effect was especially evident when the strong L(CAA)LR2 terminator region was placed downstream of an A- and B-block-containing fragment of the SCR1 gene. In this case, T5 read-through enhancement can only depend on particular features of the upstream DNA region. This region might influence the Pol III behavior at T5 through polymerase-DNA interactions, but it might also play an active role in the termination process through the corresponding RNA product, as is well known for the stem-loop coding portion of intrinsic bacterial terminators (50, 51).

The lack of termination at T6 within the SNR52 transcription unit is of evident biological significance, since the snoRNA coding portion of SNR52 is entirely located downstream of the T6 element. Curiously, such a sequence, which is potentially detrimental to SNR52 gene transcription, is also present in the genomes of at least two other Saccharomyces species (Saccharomyces paradoxus and Saccharomyces mikatae (52)), thus indicating a possible relevant role in SNR52 expression. In principle, the T6 element might influence the accessibility and/or transcriptional activity of SNR52 in vivo, or it might play a role in pre-snoRNA processing. Less evident is the biological role of T5 terminator weakening by short downstream sequences like CT in the case of tRNA genes. As a result of T5 read-through, Pol III is expected to synthesize in vivo tRNA precursors with elongated 3' trailers, that might in principle stabilize the pre-tRNA from 3' exonucleolytic digestion. In organisms from yeast to humans, binding of La protein also protects the pre-tRNA 3' trailer from exonucleolytic digestion (reviewed in Ref. 53). La protein binds the UUUOH at the 3' end of nascent Pol III transcripts, and, by favoring the formation of correctly folded pre-tRNAs, it can affect pre-tRNA stability, processing, localization, and charging (5356). The 3' trailer extension caused by Pol III read-through might influence each of these processes either directly or by affecting La binding. In support of this view, it has recently been shown that an increase in 3'-terminal oligo(U) length of pre-tRNAs can influence association with La and tRNA maturation (57). The modulation of Pol III terminator readthrough might be of even higher significance in mammals. In the mouse and human genomes, T4 is by far the most frequent termination signal for tRNA gene transcription, and in many cases, it is the sole potential termination signal encountered 3' to the tDNA. Since runs of 4 T residues are often present within the internal transcribed region of tRNA genes, there must be features of the sequence context capable of strongly affecting Pol III termination at T4. Such features, however, are not simply represented by conserved sequence elements flanking the T4 terminator, as revealed by statistical analysis of such regions in mouse and human tDNA data sets.4 Why did mammalian tDNA terminators evolve toward the shortest possible T runs? One possible answer is that, in the presence of weak T run terminators, more room is left for the modulation of termination by accessory factors, such as NF1, affecting transcription termination by human Pol III (39). Alternatively, the predominance of very short T runs downstream of mammalian tDNAs might reflect the importance of short 3' polyuridylate tails for the post-transcriptional fate of mammalian pre-tRNAs.


    FOOTNOTES
 
* This study was supported by Human Frontier Science Program Organization Grant RGY0011/2002-C and by the Italian Ministry of Education, University, and Research (MIUR, 2003 COFIN Program). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed. Tel.: 39-0521-905649; Fax: 39-0521-905151; E-mail: giorgio.dieci{at}unipr.it.

1 The abbreviations used are: Pol, RNA polymerase; TFIIIB and TFIIIC, transcription factor IIIB and IIIC, respectively; nt, nucleotide(s); SnoRNA, small nucleolar RNA. Back

2 The only exceptions were represented by dimeric tDNAs, in which the upstream tDNA unit has no termination signal (45, 58). Back

3 The very low stability of 3'-extended derivatives with respect to 3'-matured products of tRNA genes, together with the presence in multiple copies of most tRNA genes (21), generally complicates the detection of in vivo termination products in the case of natural tRNA genes. Back

4 R. Percudani, unpublished observations. Back


    ACKNOWLEDGMENTS
 
We thank George Kassavetis, Christophe Carles, and Olivier Lefebvre for insightful discussions; Simone Ottonello for critical reading of the manuscript; Roberto Ferrari and Elisa Guffanti for SNR52 constructs; and Joël Acker for recombinant Bdp1.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bogenhagen, D. F., and Brown, D. D. (1981) Cell 24, 261-270[CrossRef][Medline] [Order article via Infotrieve]
  2. Cozzarelli, N. R., Gerrard, S. P., Schlissel, M., Brown, D. D., and Bogenhagen, D. F. (1983) Cell 34, 829-835[CrossRef][Medline] [Order article via Infotrieve]
  3. Hamada, M., Sakulich, A. L., Koduru, S. B., and Maraia, R. J. (2000) J. Biol. Chem. 275, 29076-29081[Abstract/Free Full Text]
  4. Allison, D. S., and Hall, B. D. (1985) EMBO J. 4, 2657-2664[Medline] [Order article via Infotrieve]
  5. Matsuzaki, H., Kassavetis, G. A., and Geiduschek, E. P. (1994) J. Mol. Biol. 235, 1173-1192[CrossRef][Medline] [Order article via Infotrieve]
  6. Campbell, F. E., Jr., and Setzer, D. R. (1992) Mol. Cell. Biol. 12, 2260-2272[Abstract/Free Full Text]
  7. Bobkova, E. V., and Hall, B. D. (1997) J. Biol. Chem. 272, 22832-22839[Abstract/Free Full Text]
  8. Thuillier, V., Brun, I., Sentenac, A., and Werner, M. (1996) EMBO J. 15, 618-629[Medline] [Order article via Infotrieve]
  9. Chedin, S., Riva, M., Schultz, P., Sentenac, A., and Carles, C. (1998) Genes Dev. 12, 3857-3871[Abstract/Free Full Text]
  10. Shaaban, S. A., Bobkova, E. V., Chudzik, D. M., and Hall, B. D. (1996) Mol. Cell. Biol. 16, 6468-6476[Abstract]
  11. Dieci, G., and Sentenac, A. (1996) Cell 84, 245-252[CrossRef][Medline] [Order article via Infotrieve]
  12. Dieci, G., and Sentenac, A. (2003) Trends. Biochem. Sci. 28, 202-209[CrossRef][Medline] [Order article via Infotrieve]
  13. Ferrari, R., Rivetti, C., Acker, J., and Dieci, G. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 13442-13447[Abstract/Free Full Text]
  14. Prescott, E. M., Osheim, Y. N., Jones, H. S., Alen, C. M., Roan, J. G., Reeder, R. H., Beyer, A. L., and Proudfoot, N. J. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 6068-6073[Abstract/Free Full Text]
  15. Guffanti, E., Corradini, R., Ottonello, S., and Dieci, G. (2004) J. Biol. Chem. 279, 20708-20716[Abstract/Free Full Text]
  16. Mazabraud, A., Scherly, D., Muller, F., Rungger, D., and Clarkson, S. G. (1987) J. Mol. Biol. 195, 835-845[CrossRef][Medline] [Order article via Infotrieve]
  17. Gunnery, S., and Mathews, M. B. (1995) Mol. Cell. Biol. 15, 3597-3607[Abstract]
  18. Gunnery, S., Ma, Y., and Mathews, M. B. (1999) J. Mol. Biol. 286, 745-757[CrossRef][Medline] [Order article via Infotrieve]
  19. Emerson, B. M., and Roeder, R. G. (1984) J. Biol. Chem. 259, 7926-7935[Abstract/Free Full Text]
  20. Hess, J., Perez-Stable, C., Wu, G. J., Weir, B., Tinoco, I., Jr., and Shen, C. K. (1985) J. Mol. Biol. 184, 7-21[Medline] [Order article via Infotrieve]
  21. Percudani, R., Pavesi, A., and Ottonello, S. (1997) J. Mol. Biol. 268, 322-330[CrossRef][Medline] [Order article via Infotrieve]
  22. Lowe, T. M., and Eddy, S. R. (1997) Nucleic Acids Res. 25, 955-964[Abstract/Free Full Text]
  23. Stajich, J. E., Block, D., Boulez, K., Brenner, S. E., Chervitz, S. A., Dagdigian, C., Fuellen, G., Gilbert, J. G., Korf, I., Lapp, H., Lehvaslaiho, H., Matsalla, C., Mungall, C. J., Osborne, B. I., Pocock, M. R., Schattner, P., Senger, M., Stein, L. D., Stupka, E., Wilkinson, M. D., and Birney, E. (2002) Genome Res. 12, 1611-1618[Abstract/Free Full Text]
  24. Giuliodori, S., Percudani, R., Braglia, P., Ferrari, R., Guffanti, E., Ottonello, S., and Dieci, G. (2003) J. Mol. Biol. 333, 1-20[CrossRef][Medline] [Order article via Infotrieve]
  25. Baker, R. E., Eigel, A., Vögtel, D., and Feldmann, H. (1982) EMBO J. 1, 291-295[Medline] [Order article via Infotrieve]
  26. Dieci, G., Giuliodori, S., Catellani, M., Percudani, R., and Ottonello, S. (2002) J. Biol. Chem. 277, 6903-6914[Abstract/Free Full Text]
  27. Higuchi, R. (1990) in PCR Protocols: A Guide to Methods and Applications (Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J., eds) pp. 177-183, Academic Press, Inc., San Diego
  28. Dieci, G., Percudani, R., Giuliodori, S., Bottarelli, L., and Ottonello, S. (2000) J. Mol. Biol. 299, 601-613[CrossRef][Medline] [Order article via Infotrieve]
  29. Huet, J., Manaud, N., Dieci, G., Peyroche, G., Conesa, C., Lefebvre, O., Ruet, A., Riva, M., and Sentenac, A. (1996) Methods Enzymol. 273, 249-267[Medline] [Order article via Infotrieve]
  30. Kassavetis, G. A., Joazeiro, C. A. P., Pisano, M., Geiduschek, E. P., Colbert, T., Hahn, S., and Blanco, J. A. (1992) Cell 71, 1055-1064[CrossRef][Medline] [Order article via Infotrieve]
  31. Ito, H., Fukuda, Y., Murata, K., and Kimura, A. (1983) J. Bacteriol. 153, 163-168[Abstract/Free Full Text]
  32. Wise, J. A. (1991) Methods Enzymol. 194, 405-415[Medline] [Order article via Infotrieve]
  33. Geiduschek, E. P., and Tocchini-Valentini, G. P. (1988) Annu. Rev. Biochem. 57, 873-914[CrossRef][Medline] [Order article via Infotrieve]
  34. Reynolds, R., Bermudez-Cruz, R. M., and Chamberlin, M. J. (1992) J. Mol. Biol. 224, 31-51[CrossRef][Medline] [Order article via Infotrieve]
  35. Matthews, C. (1972) J. Biol. Chem. 247, 7430-7438[Abstract/Free Full Text]
  36. Breslauer, K. J., Frank, R., Blocker, H., and Marky, L. A. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 3746-3750[Abstract/Free Full Text]
  37. Klemenz, R., Stillman, D. J., and Geiduschek, E. P. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, 6191-6195[Abstract/Free Full Text]
  38. Camier, S., Gabrielsen, O., Baker, R., and Sentenac, A. (1985) EMBO J. 4, 491-500[Medline] [Order article via Infotrieve]
  39. Wang, Z., Bai, L., Hsieh, Y. J., and Roeder, R. G. (2000) EMBO J. 19, 6823-6832[CrossRef][Medline] [Order article via Infotrieve]
  40. Moenne, A., Camier, S., G., A., Margottin, F., Beggs, J., and Sentenac, A. (1990) EMBO J. 9, 271-277[Medline] [Order article via Infotrieve]
  41. Bardeleben, C., Kassavetis, G. A., and Geiduschek, E. P. (1994) J. Mol. Biol. 235, 1193-1205[CrossRef][Medline] [Order article via Infotrieve]
  42. Harismendy, O., Gendrel, C. G., Soularue, P., Gidrol, X., Sentenac, A., Werner, M., and Lefebvre, O. (2003) EMBO J. 22, 4738-4747[CrossRef][Medline] [Order article via Infotrieve]
  43. Roberts, D. N., Stewart, A. J., Huff, J. T., and Cairns, B. R. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 14695-14700[Abstract/Free Full Text]
  44. Moqtaderi, Z., and Struhl, K. (2004) Mol. Cell. Biol. 24, 4118-4127[Abstract/Free Full Text]
  45. Mao, J., Schmidt, O., and Soll, D. (1980) Cell 21, 509-516[Medline] [Order article via Infotrieve]
  46. Palangat, M., Hittinger, C. T., and Landick, R. (2004) J. Mol. Biol. 341, 429-442[CrossRef][Medline] [Order article via Infotrieve]
  47. Yarnell, W. S., and Roberts, J. W. (1999) Science 284, 611-615[Abstract/Free Full Text]
  48. Nedialkov, Y. A., Gong, X. Q., Hovde, S. L., Yamaguchi, Y., Handa, H., Geiger, J. H., Yan, H., and Burton, Z. F. (2003) J. Biol. Chem. 278, 18303-18312[Abstract/Free Full Text]
  49. Holmes, S. F., and Erie, D. A. (2003) J. Biol. Chem. 278, 35597-35608[Abstract/Free Full Text]
  50. von Hippel, P. H. (1998) Science 281, 660-665[Abstract/Free Full Text]
  51. Nudler, E., and Gottesman, M. E. (2002) Genes Cells 7, 755-768[Abstract]
  52. Kellis, M., Patterson, N., Endrizzi, M., Birren, B., and Lander, E. S. (2003) Nature 423, 241-254[CrossRef][Medline] [Order article via Infotrieve]
  53. Wolin, S. L., and Cedervall, T. (2002) Annu. Rev. Biochem. 71, 375-403[CrossRef][Medline] [Order article via Infotrieve]
  54. Maraia, R. J., and Intine, R. V. (2002) Gene Expr. 10, 41-57[Medline] [Order article via Infotrieve]
  55. Intine, R. V., Dundr, M., Misteli, T., and Maraia, R. J. (2002) Mol. Cell 9, 1113-1123[CrossRef][Medline] [Order article via Infotrieve]
  56. Chakshusmathi, G., Kim, S. D., Rubinson, D. A., and Wolin, S. L. (2003) EMBO J. 22, 6562-6572[CrossRef][Medline] [Order article via Infotrieve]
  57. Huang, Y., Intine, R. V., Mozlin, A., Hasson, S., and Maraia, R. J. (2005) Mol. Cell. Biol. 25, 621-636[Abstract/Free Full Text]
  58. Schmidt, O., Mao, J., Ogden, R., Beckmann, J., Sakano, H., Abelson, J., and Soll, D. (1980) Nature 287, 750-752[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
M.-L. Bortolin-Cavaille, M. Dance, M. Weber, and J. Cavaille
C19MC microRNAs are processed from introns of large Pol-II, non-protein-coding transcripts
Nucleic Acids Res., June 1, 2009; 37(10): 3464 - 3473.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
P. Richard and J. L. Manley
Transcription termination by nuclear RNA polymerases
Genes & Dev., June 1, 2009; 23(11): 1247 - 1269.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. G. Ozanick, X. Wang, M. Costanzo, R. L. Brost, C. Boone, and J. T. Anderson
Rex1p deficiency leads to accumulation of precursor initiator tRNAMet and polyadenylation of substrate RNAs in Saccharomyces cerevisiae
Nucleic Acids Res., January 1, 2009; 37(1): 298 - 308.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
A. Simoes-Barbosa, D. Meloni, J. A. Wohlschlegel, M. M. Konarska, and P. J. Johnson
Spliceosomal snRNAs in the unicellular eukaryote Trichomonas vaginalis are structurally conserved but lack a 5'-cap structure
RNA, August 1, 2008; 14(8): 1617 - 1631.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
J. Kawauchi, H. Mischo, P. Braglia, A. Rondon, and N. J. Proudfoot
Budding yeast RNA polymerases I and II employ parallel mechanisms of transcriptional termination
Genes & Dev., April 15, 2008; 22(8): 1082 - 1092.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. S. Gilmour and R. Fan
Derailing the Locomotive: Transcription Termination
J. Biol. Chem., January 11, 2008; 283(2): 661 - 664.
[Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. Braglia, S. L. Dugas, D. Donze, and G. Dieci
Requirement of Nhp6 Proteins for Transcription of a Subset of tRNA Genes and Heterochromatin Barrier Function in Saccharomyces cerevisiae
Mol. Cell. Biol., March 1, 2007; 27(5): 1545 - 1557.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Guffanti, R. Percudani, O. Harismendy, J. Soutourina, M. Werner, M. G. Iacovella, R. Negri, and G. Dieci
Nucleosome Depletion Activates Poised RNA Polymerase III at Unconventional Transcription Sites in Saccharomyces cerevisiae
J. Biol. Chem., September 29, 2006; 281(39): 29155 - 29164.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
C. Li, J. E. Mueller, and M. Bryk
Sir2 Represses Endogenous Polymerase II Transcription Units in the Ribosomal DNA Nontranscribed Spacer
Mol. Biol. Cell, September 1, 2006; 17(9): 3848 - 3859.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Guffanti, R. Ferrari, M. Preti, M. Forloni, O. Harismendy, O. Lefebvre, and G. Dieci
A Minimal Promoter for TFIIIC-dependent in Vitro Transcription of snoRNA and tRNA Genes by RNA Polymerase III
J. Biol. Chem., August 18, 2006; 281(33): 23945 - 23957.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C. Marck, R. Kachouri-Lafond, I. Lafontaine, E. Westhof, B. Dujon, and H. Grosjean
The RNA polymerase III-dependent family of genes in hemiascomycetes: comparative RNomics, decoding strategies, transcription and evolutionary implications.
Nucleic Acids Res., January 1, 2006; 34(6): 1816 - 1835.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/20/19551    most recent
M412238200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Braglia, P.
Right arrow Articles by Dieci, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Braglia, P.
Right arrow Articles by Dieci, G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement