Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M414522200 on March 23, 2005

J. Biol. Chem., Vol. 280, Issue 21, 20604-20611, May 27, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
280/21/20604    most recent
M414522200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ren, S.
Right arrow Articles by Hewison, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ren, S.
Right arrow Articles by Hewison, M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Alternative Splicing of Vitamin D-24-Hydroxylase

A NOVEL MECHANISM FOR THE REGULATION OF EXTRARENAL 1,25-DIHYDROXYVITAMIN D SYNTHESIS*{boxs}

Songyang Ren{ddagger}, Lisa Nguyen{ddagger}, Shaoxing Wu{ddagger}, Carlos Encinas{ddagger}, John S. Adams{ddagger}, and Martin Hewison§

From the {ddagger}Department of Medicine, Division of Endocrinology, Burns and Allen Research Institute, Cedars-Sinai Medical Center, Los Angeles, California 90048 and the §Division of Medical Sciences, Institute of Biomedical Research, University of Birmingham, Birmingham, B15 2TT, United Kingdom

Received for publication, December 23, 2004 , and in revised form, March 22, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Synthesis of the active form of vitamin D, 1,25-dihydroxyvitamin D (1,25-(OH)2D), by renal epithelial cells is tightly controlled during normal calcium homeostasis. By contrast, macrophage production of 1,25-(OH)2D is often dysregulated with potential hypercalcemic complications. We have postulated that this is due to abnormal catabolism of 1,25-(OH)2D by the feedback control enzyme, vitamin D-24-hydroxylase (CYP24). Using chick HD-11 and human THP-1 myelomonocytic cell lines, we have shown that macrophage-like cells express a splice variant of the CYP24 gene (CYP24-SV), which encodes a truncated protein. Compared with the holo-CYP24 gene product in chick and human cells (508 and 513 amino acids, respectively), the truncated CYP24-SV versions consisted of 351 and 372 amino acids. These CYP24-SV proteins retained intact substrate-binding domains but lacked mitochondrial targeting sequences and were therefore catalytically inactive. In common with CYP24, expression of the CYP24 variants was induced by 1,25-(OH)2D but without a concomitant rise in 24-hydroxylase activity. However, overexpression of CYP24-SV in HD-11 and THP-1 cells reduced synthesis of 1,25-(OH)2 D (40–50%), whereas antisense CYP24-SV expression increased 1,25-(OH)2D production by 2–7-fold. These data suggest that alternative splicing of CYP24 leads to the generation of a dominant negative-acting protein that is catalytically dysfunctional. We theorize that expression of the CYP24-SV may contribute to the extracellular accumulation of 1,25(OH)2D in human health and disease.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Synthesis of the secosteroid 1,25-dihydroxyvitamin D3 (1,25-(OH)2D)1 from its precursor 25-hydroxyvitamin D3 (25-OHD) is catalyzed by the enzyme 25-(OH)D-1{alpha}-hydroxylase (1{alpha}-OHase; encoded by the CYP27B1 gene), a mitochondrial cytochrome P450 enzyme which resides mainly in renal proximal tubule cells (1, 2). Both 1,25-(OH)2D and its precursor 25-OHD can also be metabolized by a related mitochondrial P450 enzyme vitamin D-24-hydroxylase (24-OHase; encoded by the CYP24 gene), which catalyzes synthesis of 1,24,25-trihydroxyvitamin D and 24,25-dihydroxyvitamin D (3–5). Consistent with its role as a negative feedback enzyme, expression of 24-OHase is sensitively induced by 1,25-(OH)2D itself through binding of liganded vitamin D receptor and its heterodimeric partner, the retinoid X receptor to vitamin D-responsive elements in the promoter region of CYP24 (6, 7). Thus, the 24-OHase plays an important role in attenuating the potentially detrimental hypercalcemic side effects of vitamin D by catalyzing the catabolism of active 1,25-(OH)2D to less active downstream metabolites and by competing with 1{alpha}-OHase for their common substrate, 25-OHD (8, 9).

Although proximal tubule epithelial cells are the major source of 1,25(OH)2D detectable in the circulation, it is now clear that 1{alpha}-OHase is expressed by many extrarenal tissues, including the skin, macrophages, placenta, colon, brain, prostate, and endothelium (10–14). At these sites, 1{alpha}-OHase has been postulated to act in an autocrine or paracrine fashion by increasing local concentrations of 1,25-(OH)2D in a tissue-specific manner. Whereas kidney-synthesized 1,25-(OH)2D functions to systemically regulate serum calcium and phosphorous levels for bone homeostasis (2), extrarenal production of 1,25-(OH)2D appears to play an important role in cell differentiation, proliferation (16), and immune responsiveness (17).

Synthesis of 1,25-(OH)2D in peripheral tissues is catalyzed by the same 1{alpha}-OHase gene product that is present in the kidney (18, 19), but the manner by which expression and activity of the enzyme are regulated is distinct. From an endocrine standpoint, 1,25-(OH)2D tightly controls its own synthesis by 1) inhibition of parathyroid hormone gene expression, 2) induction of 24-OHase catabolic function (6–9), and 3) direct, negative regulation of CYP27B1 transcription (20). By contrast, the abundant extrarenal production of 1,25-(OH)2D by cells such as activated macrophages is characterized by 1) unresponsiveness to stimulation by parathyroid hormone (21); 2) lack of feedback inhibition of 1{alpha}-OHase by 1,25-(OH)2D itself (22, 23); 3) relatively low levels of 1,25-(OH)2D-directed catabolic 24-hydroxylase activity (22, 24). The latter mechanism appears to be particularly important in macrophages, because CYP24 gene expression is readily stimulated by 1,25-(OH)2Din these cells without any apparent induction of catabolic 24-OHase enzyme activity (25). To clarify this, we have characterized a novel mechanism for the regulation of 1,25-(OH)2D production in macrophages, which involves alternative splicing of the CYP24 gene and expression of a catalytically inactive, amino-terminally truncated 24-OHase protein. As such, regulated expression of the CYP24 splice variant (CYP24-SV) can rheostatitically control the production of 1,25-(OH)2D in macrophages.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—HD-11 cells were generously provided by Dr. T. Graf (EMBO, Heidleberg, Germany) and grown in monolayers in Dulbecco's modified Eagle's medium (DMEM; Invitrogen) supplemented with 15% fetal bovine serum (FBS; Omega, Tarzana, CA), 4 mM L-glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin (Invitrogen) at 37 °C in a humidified atmosphere of 5% CO2 and 95% air. Human monocytic THP-1 cells (catalog no. TIB-202; American Type Culture Collection, Manassas, VA) were grown in suspension in RPMI 1640 medium with 2 mM L-glutamine, 10 mM HEPES, 1 mM sodium pyruvate, 4.5 g/liter glucose, and 1.5 g/liter bicarbonate, supplemented with 10% fetal bovine serum (v/v) and 0.05 mM 2-mercaptoethanol. Differentiated THP-1 cells (dTHP-1) with macrophage characteristics were produced by treating THP-1 cells with 160 nM 12-O-tetradecanoylphorbol-13-acetate (TPA; Sigma) in regular culture medium for 24 h. After 24-h treatment, the cells were 80–90% adherent, and the medium containing TPA was replaced with normal culture medium for cell maintenance until experimental reagents were added. In addition to the HD-11 and THP-1 cells, other human cells were used for RT-PCR analysis of CYP24 expression. These included HKC-8 proximal tubules cells (26) and peripheral blood-derived macrophages (27). Human skin epidermal keratinocytes (catalog no. C-001-5C; Cascade Biologics, Inc., Portland, OR) were grown in Medium 154 (catalog no. M-154-500; Cascade Biologics) supplemented with human keratinocyte growth supplement (catalog no. M-154-500; Cascade Biologics).

Human Tissue—Placenta was obtained from a third trimester term pregnancy with patient consent and ethical approval (South Birmingham Ethics Committee, Birmingham, UK). Total RNA from human heart and brain were purchased from Clontech (Palo Alto, CA).

RT-PCR Analysis of CYP24 Transcripts in Chick HD-11 Macrophages—Total RNA was extracted from cultured HD-11 cells, preincubated with 200 nM 1,25-(OH)2D (BIOMOL, Plymouth Meeting, PA), for 24 h using the TRIzol Reagent (Total RNA Isolation Reagent; Invitrogen). Reverse transcription of mRNA was performed by PowerScript Reverse Transcriptase (Clontech) and tailed primer oligo(dT) (16) to produce cDNA for PCR templates. Multiple sets of PCR primers were synthesized according to the published chick kidney 24-OHase cDNA sequence (CYP24; GenBankTM accession number AF019142 [GenBank] ), among which the following series of nested PCR primer pairs yielded a predominant PCR product of ~1.4 kb: 1) forward primer 5'-GCCCTACCTAAAAGCATGTCTGAAGG (1104–1129) and reverse primer 5'-TCTGTCATGCACAGTCCTTCTGCTGC (1819–1794); 2) forward primer 5'-GGAAGGAAAGGACTGGCAGAGG (432–453) and reverse primer 5'-CTCTGCTAAGCGACGGCCAATGC (1389–1367). PCR was carried out using the Advantage cDNA PCR kit (Clontech) applying the following parameters: 94 °C for 3 min followed by 30 cycles of denaturation at 94 °C for 12 s and annealing/extension at 68 °C for 3 min with a final extension of 3 min at 68 °C. The PCR products were separated by electrophoresis on a 1.2% agarose (Invitrogen) gel with a 1-kb Plus DNA Ladder (Invitrogen) as a size marker and visualized by ethidium bromide staining. The predicted size-matched bands on the gel were purified by a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into the PCR4-TOPO plasmid vector and TOP10 competent Escherichia coli cells using the TOPO TA Cloning Kit (Invitrogen). The selected, subcloned E. coli cells were cultured and subjected to the plasmid extraction by the PlasmidPURE DNA Mini-Prep kit (Sigma). From purified plasmids, the PCR products of interest were then sequenced by an automatic sequencing machine (ABI PRISM 377 DNA Sequencer, Applied Biosystems, Foster City, CA).

Isolation of Full-length cDNAs for the CYP24 Variants—To obtain a full-length cDNA for the CYP24 splice variants isolated from HD-11 cells, 5'- and 3'-RACE procedures were performed using the GeneRacer kit (Invitrogen). Poly(A) RNA was extracted from cultured HD-11 cells preincubated with 200 nM 1,25-(OH)2D for 24 h using the Oligotex Direct mRNA Purification Kit (Qiagen). Random and oligo(dT) (16) primers were used for reverse transcription to produce cDNA templates for 5'- and 3'-RACE, respectively. Two pairs of the nested PCR primers were synthesized for 5'- and 3'-RACE separately, according to the cDNA sequences available from RT-PCR results above: reverse primer A 5'-CTCTGCTAAGCGACGGCCAATGC (CYP24 cDNA 1389–1367) and reverse primer B 5'-CCAGTTTCACCACCTCCTTGGGTTTCATCAG (508–478) for 5'-RACE; forward primer A 5'-GAGAAACTGCAACGCGCGTCACTCA (1611–1635) and forward primer B 5'-CCCCTGGTTGGAATTCCCTTATTGG (1672–1696) for 3'-RACE. Because of the GC-rich region at the 5'-end of the template, Me2SO (5%; Sigma) was added in the PCR mixture for 5'-RACE reactions. The RACE products were sequenced as described above.

PCR and GenomeWalker Analysis of CYP24 Genomic DNA Sequences—To acquire further sequence information for the chick CYP24 gene, genomic DNA was extracted from cultured HD-11 cells by QIAmp Blood Kit (Qiagen). PCR primers were derived from the cDNA sequences determined from RT-PCR and RACE results described above: forward primer, 5'-AGATGCCTCCCTGCACGTGTCGTA (CYP24-SV cDNA 125–148); reverse primer, 5'-CCACAGGTGTCACCATCATCATTCC (CYP24-SV cDNA 516–492). PCR was carried out using the Advantage-GC Genomic PCR Kit (Clontech) with a 1 M GC-Melt concentration and the same cycle parameters described for the RT-PCRs. The 5'-flanking genomic DNA sequence of the chick CYP24 gene was obtained from HD-11 cell genomic DNA using the Universal GenomeWalker Kit (Clontech) and the Advantage-GC Genomic PCR Kit (Clontech) according to the manufacturer's protocols. The nested antisense primers arising from the 5'-end of CYP24-SV cDNA were reverse primer "A" 5'-CCAGTTTCACCACCTCCTTGGGTTTCATCAG (CYP24-SV cDNA 270–240) and reverse primer "B" 5'-CTCTGCCAGTCCTTTCCTTCCCTAGGCGTAA (214–184). The products of PCR and GenomeWalker were cloned and sequenced as described above.

Cloning and Sequencing of a Human Form of CYP24-SV—Total RNA was extracted from TPA-differentiated THP-1 cells (dTHP-1) in the presence or absence of 200 nM 1,25-(OH)2D (BIOMOL, Plymouth Meeting, PA) for 24 h using the TRIzol Reagent (Total RNA Isolation Reagent; Invitrogen). Reverse transcription of mRNA was performed by PowerScript Reverse Transcriptase (Clontech) and tailed primer oligo(dT) (16) to produce cDNA for PCR templates. Multiple sets of PCR primers were synthesized according to the published human 24-OHase cDNA (GenBankTM number L13268 [GenBank] ) and genomic DNA (GenBankTM number AL138805 [GenBank] ), among which the following series of bridged PCR primer pairs yielded a predominant PCR product of ~1.4 kb: 1) forward primer (5'-GCTC TAAATGTATTCCTGCTTCTCTCAC) (AL138805 [GenBank] 73837–73864, in intron II) and reverse primer (5'-GCTCTAAATGTATTCCTGCTTCTCTCAC) (L13268 [GenBank] 1231–1256, in exons IV and IIV) for the first PCR reaction; 2) forward primer (5'-GGACACCTCAAAATCCCTGAACCCAA) (AL138805 [GenBank] : 74092–74117, in intron II) and reverse primer (5'-GCTCTAAATGTATTCCTGCTTCTCTCAC) (L13268 [GenBank] : 1231–1256, in exons IV and IIV) for the second PCR; and 3) forward primer (5'-GCTCTAAATGTATTCCTGCTTCTCTCAC) (AL138805 [GenBank] 73837–73864, in intron II) and reverse primer (5'-ACTCAGTCCGCTTCCCTGAGTTGGA) (L13268 [GenBank] 1994–1970, in exon XII) for the third PCR. PCR conditions and subsequent procedures for PCR products such as purification, cloning, subcloning, and sequencing were the same as those described for cloning of the chick CYP24-SV.

RT-PCR Analysis of CYP24-SV mRNA Expression—Expression of mRNA for the alternatively spliced CYP24 gene was evaluated by RT-PCR and Northern blot analyses. Reverse transcription was performed by random primer and PowerScript reverse transcriptase (Clontech). Three pairs of PCR primers were designed according to the unique cDNA sequence of 1) chick CYP24-SV (forward primer, 5'-AGATGCCTCCCTGCACGTGTCGTA (cDNA 125–148); reverse primer, 5'-TGCTGCAGGAGACCAAACCTCTTTC (430–406), spanning 306 bp or with reverse primer 5'-CCTTCAGACATGCTTTTAGGTAGGGCA (891–866), spanning 766 bp); 2) chick kidney CYP24 (forward primer, 5'-ATGGGAGGCTGCAGCATCCTTCTC (cDNA 13–36); reverse primer, 5'-TGCTGCAGGAGACCAAACCTCTTTC (668–644), spanning 655 bp); and 3) chick {beta}-actin (forward primer, 5'-ACCACAGCCGAGAGAGAAAT (cDNA 672–691); reverse primer, 5'-GACAGGGAGGCCAGGATAGA (1117–1098), spanning 445 bp). PCR was performed by Advantage-GC cDNA PCR Kit (Clontech) with a final GC-Melt concentration of 1 M and the same PCR parameters as above, with the {beta}-actin primers as a control for each PCR. The PCR products were separated by electrophoresis on a 1.2% agarose gel with a 1-kb Plus DNA Ladder.

PCR primers for the human CYP24-SV were designed according to the unique cDNA sequence of 1) hCYP24 (forward primer, 5'-GAGACTGGTGACATCTACGGCGTACA (L13268 [GenBank] 468–493, in exon I) and reverse primer 5'-CCATAAAATCGGCCAAGACCTCATTG (L13268 [GenBank] 952–927, in exons III and IV), spanning 484 bp); 2) hCYP24-SV (forward primer, 5'-GGACACCTCAAAATCCCTGAACCCAA (AL138805 [GenBank] 74092–74117, in intron II); reverse primer, 5'-CCATAAAATCGGCCAAGACCTCATTG (L13268 [GenBank] 952–927, in exon III and IV), spanning 396 bp); and 3) human {beta}-actin (forward primer, 5'-AGAGAGGCATCCTCACCCTG (GenBankTM number NM_001101 [GenBank] 221–238); reverse primer, 5'-TCACCGGAGTCCATCACGAT (NM_001101 [GenBank] 543–524), spanning 288 bp). PCR conditions and electrophoresis procedures were the same as those described for chick CYP24-SV.

Northern Blot Analysis—Total RNA was extracted from HD-11 cells using the same conditions and methods as described above under "RT-PCR Analysis of mRNA." Aliquots (50 µg) of total RNA were loaded in each lane and separated by electrophoresis using a 1% agarose (Invitrogen), 2.2 M formaldehyde (J. T. Baker, Phillipsburg, NJ) gels containing ethidium bromide. The resolved RNA was transferred onto nylon membranes (Millipore Corp., Bedford, MA) in 10x SSC buffer (0.3 M NaCl, 0.03 M sodium citrate, pH 7) for 16 h. The transferred filters were prehybridized with QuikHyb Hybridization Solution (Stratagene, La Jolla, CA) at 68 °C for 1 h and then hybridized in the same solution at 68 °C for 12 h to a random primed 32P-labeled 715-bp probe (wild type CYP24 cDNA 1104–1819) sharing the same cDNA sequences between the chick CYP24 and its splice variant. The filters were then washed in 0.1x SSC, 0.1% SDS at 55 °C for 30 min and exposed to x-ray film at –70 °C overnight.

Preparation of Polyclonal Antiserum against Chick CYP24 and CYP24-SV—A custom chick CYP24-SV peptide N'-GKRFGLLQQDVEEES (CYP24-SV amino acids 55–69) sharing the same sequence with that of CYP24 and the custom rabbit polyclonal antiserum against this peptide were prepared and tested with high pressure liquid chromatography and enzyme-linked immunosorbent assay by Sigma-Genosys (Woodlands, TX). The antiserum titer determined by enzyme-linked immunosorbent assay for the peptide-specific antibody was >1:500,000.

Western Blot Analysis—HD-11 cells were preincubated with vehicle or 1,25-(OH)2D (200 nM) for 24 h before extracting whole cell or mitochondrial protein. The mitochondrial extraction procedure was the same as previously described (28). The extracted mitochondrial pellets and the whole cultured cells were washed with PBS at room temperature, and the protein extracts were then prepared by lysis of mitochondria and cells on ice with radioimmune precipitation buffer (PBS, 0.5% sodium deosycholate, 0.2% Triton X-100, 0.1% SDS, 1 mM phenylmethylsulfonyl fluoride), passing through the 21-gauge needle to shear DNA and other cellular components, and centrifugation at 10,000 x g for 10 min at 4 °C. A Micro-BCA protein assay reagent kit (Pierce) was used to determine protein concentration. 30 µg of protein from each group was loaded for each lane on the 10% Tris-HCl Precast Gel and separated by the SDS-PAGE system following the protocol recommended by the supplier (Bio-Rad). Proteins were electrophoretically transferred onto a polyvinylidene difluoride membrane (Amersham Biosciences), probed with the rabbit polyclonal antiserum for the chick CYP24-SV (1:500 diluted), and visualized by Western Light detection system (Tropix, Bedford, MA) according to the manufacturer's instructions. For protein loading and mitochondrial expression positive control, the goat polyclonal IgG against GRP75 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) (1:500 diluted) was also used to probe the Western blot following the same procedure described above. The blots with the same protein loading but probed by the anti-cCYP24-SV and anti-GRP75 were compared.

Transfection of CYP24 and CYP24-SV Expression Constructs—Three cDNA expression constructs were prepared for transfection studies by RT-PCR using the primer pairs synthesized according to the sequences of chick CYP24 and its splice variant (CYP24-SV), each containing restriction enzyme excision sites. The sequences for these primer pairs were as follows (the underlines indicate the restriction enzyme excision sites): 1) antisense CYP24-SV construct (located at the 5'-end of CYP24-SV cDNA) (forward primer, 5'-TTTCTCTAGAGATGCTGCGGACT (CYP24-SV cDNA 42–52); reverse primer, 5'-AGGTCTCGAGGCGTAAATAAAAGCAG (189–174); 2) sense CYP24-SV construct (containing full-length open reading frame (ORF) of CYP24-SV) (forward primer, 5'-AGCTCGAGATGAAACCCAAGGAGGTGGTGACAAGGAGGTGGTGA (CYP24-SV cDNA 243–264); reverse primer, 5'-CCCTCTAGAGGCCGTCATTAGTCAAGCTGCA (1306–1285)); 3) antisense CYP24 construct (located at the 5'-end of CYP24 cDNA) (forward primer, 5'-GGTCTAGATATGGGAGGCTGCAGCATCCTTC (CYP24 cDNA 12–34); reverse primer, 5'-GTCTCGAGAGTCCCGATAGGCTTTCCA (400–382)).

The resulting PCR products were digested with XbaI and XhoI restriction enzyme sites, run on agarose gels, appropriate bands were excised, and the resulting cDNAs were subcloned into a eukaryotic expression vector, pcDNA3.1 (Invitrogen). After cloning and sequence analysis, expression constructs containing the sense and antisense cDNAs for CYP24 and CYP24-SV were transiently transfected into HD-11 cells by lipofection (LipoTAXI; Stratagene, La Jolla, CA) following the manufacturer's protocol. Briefly, HD-11 cells were seeded in wells on 12-well plates 24 h prior to transfection and grown to 80% confluence. 0.5 µg of plasmid DNA and 15 µl of LipoTAXI reagent were added in culture wells with DMEM alone. 5 h later, an equal volume of DMEM containing 20% FBS was added to each well, and another 16 h later the medium above was replaced by normal culture medium. After a 24-h incubation in the normal culture medium, the transfected cells were ready for vitamin D metabolism assessment (see below). For stable tranfection, 5 µg of plasmid DNA and 70 µl of LipoTAXI reagent were added to HD-11 cells in each 60-mm tissue culture dish following the same transfection procedure above. After a 24-h incubation with normal culture medium, tranfected cells were cultured and maintained in DMEM containing 600 µg/ml G418 (Omega, Tarzana, CA). The medium was changed every 3 days. Four weeks after, G418-resistant clones were picked and grown for further experiments.

Similar experiments were also carried out using sense and antisense expression constructs for hCYP24-SV. These constructs were produced using the following sets of primers: 1) antisense hCYP24-SV construct (located at the 5'-end of the CYP24-SV cDNA) (forward primer, 5'-AACCTCTAGAGACTAGGAGGAAAGG (hCYP24-SV 61–75, in intron II of hCYP24); reverse primer, 5'-CAAACTCGAGGTGAGAGAAGCAGGA (hCYP24-SV 281–267, in intron II of hCYP24); 2) sense hCYP24-SV construct (containing full-length ORF of hCYP24-SV) (forward primer, 5'-CCCCTCGAGCTCTAAATGTATTCCTGC (hCYP24-SV 255–272); reverse primer, 5'-CCCTCTAGAGCGTATTATCGCTGG (hCYP24-SV 1384–1368).

Purification and subcloning procedures were as outlined for chick CYP24-SV. However, for hCYP24-SV, the transfection protocol for THP-1 cells was as follows; THP-1 cells in suspension were centrifuged and briefly washed with DMEM (Gibco), seeded in wells on 12-well plates (5 x 106 cells/well) prior to transfection. Aliquots (2 µg) of plasmid DNA and 10 µl of LipoTAXI reagent were added in culture wells with DMEM alone. 6 h later, an equal volume of completed RPMI 1640 medium containing 20% FBS was added to each well, and another 18 h later, a double volume of completed RPMI 1640 medium containing 10% FBS and 240 nM TPA was added, reaching the final concentration of 10% FBS and 160 nM TPA. After a 24-h exposure of TPA, the transiently transfected THP-1 cells were differentiated into macrophage-like dTHP-1 cells recognized because 90% of the cells were found to be adhesive, and were ready for vitamin D metabolism assessment (see below).

Measurement of 1,25-Dihydroxyvitamin D (1,25-(OH)2D) Production—Cultures of HD-11 or dTHP-1 cells were grown in 12-well plates. After washing with FBS-free medium three times, cells were incubated with 200 nM 25-OHD (Sigma), solubilized in absolute ethanol (0.1% final concentration) in 1% FBS culture medium (1 ml/well) for 3 h. Incubation of whole cell preparations with substrate was terminated by the addition of 1 volume of acetonitrile (J. T. Baker Inc.). The conditioned medium and cell monolayers were harvested, vortexed, and centrifuged. Supernatant was transferred into a half-volume of 400 mM KH2PO4 (pH 10.5) for chromatography and 1,25-(OH)2D assay by the 1,25-(OH)2D 125I RIA kit (DiaSorin, Stillwater, MN), following the manufacturer's protocol. Cells were also collected without acetonitrile from a separate well for cell counting. Data were then reported as fmol of 1,25-(OH)2D produced/h/106 cells.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Cloning and Sequence Analysis of a Splice Variant of the Vitamin D-24-hydroxylase (CYP24-SV) in the Chick Macrophage Cell Line HD-11—Using a series of primers based on the chicken 24-hydroxylase cDNA sequence, we cloned a novel 2.5-kb cDNA variant of CYP24 from chick macrophage HD-11 cells (GenBankTM/EBI accession number AF428109 [GenBank] ). The variant cDNA was 200 bp shorter than the published sequence for chick CYP24; the last 2324 bp showed almost 100% sequence identity to the chick CYP24, whereas the first 193 bp showed less than 40% identity (see Appendix 1 as supplemental material). Alignment with the genomic DNA sequence for chick CYP24 (GenBankTM/EBI accession number AY857864 [GenBank] , see Appendix 2 as supplemental material) indicated that exons 1 and 2 were missing from the variant cDNA. Instead, the first 193 bp of the variant cDNA were derived from intron 2 of the CYP24 gene. This suggested that the 2.5-kb cDNA cloned from HD-11 cells was a splice variant of CYP24 and is subsequently referred to as CYP24-SV (Fig. 1). Alternative splicing appears to occur at the intron 2/exon 3 boundary, resulting in the 5' extension of exon 3 to include part of intron 2 from the stop codon at position 2306 of the genomic sequence (see Appendix 2 as supplemental material). Because of the stop codon located near the beginning of intron 2 (see Appendix 2 as supplemental material), the open reading frame of the CYP24-SV was predicted to start at an ATG site at position 2547 of the CYP24 gene sequence, which corresponded to position 243 of the CYP24-SV cDNA (Fig. 1). The alternative splicing and translation start site did not result in a cDNA frameshift, and it was therefore possible to predict a CYP24-SV protein that was 351 amino acids long (see Appendix 3 as supplemental material). This protein retained the same intact sterol- and heme-binding domains found in the holo-CYP24 protein (Fig. 1). However, because the truncated CYP24-SV protein lacks the amino-terminal 156 amino acids of wild-type 24-OHase (508 amino acids), encoded by exon 1 and 2 of CYP24, it contained no mitochondrial targeting sequence.



View larger version (45K):
[in this window]
[in a new window]
  		FIG. 1.
cDNA sequence comparison between chick 24-OHase (CYP24) and a 24-OHase splice variant (CYP24-SV) isolated from the HD-11 myelomonocytic cell line. RNA extracted from 1,25(OH)2D-stimulated HD-11 cells was used to clone a novel 2.5-kb CYP24 cDNA with an incomplete 5' sequence and a 3' poly(A) tail. The first 193 bp of the cloned cDNA had less than 40% identity with CYP24 cDNA, whereas the remaining sequence shared more than 99% homology with CYP24 (see Appendix 1 as supplemental material). Sequence analysis of chick genomic DNA (see Appendix 2 as supplemental material) indicated that, unlike CYP24, the novel cDNA did not include exons 1 and 2 of the CYP24 gene, and it was therefore referred to as a splice variant of CYP24 (CYP24-SV). The first 193 bp of CYP24-SV were derived from intron 2 of CYP24 to form an extended exon 3. A stop codon (TAA) was identified at the beginning of CYP24-SV, although this was upstream of a translation initiator codon (ATG) located at nucleotide 243 of CYP24-SV (position 481 CYP24), which encoded an open reading frame for CYP24-SV. By contrast, the translation initiator codon (atg) for CYP24 was located in exon 1 of CYP24. Analysis of the deduced amino acid sequence (see Appendix 3 as supplemental material) showed that the 156 N-terminal amino acids encoded by exons 1 and 2 of CYP24 were truncated in CYP24-SV, leading to the absence of the CYP24 mitochondrial membrane targeting sequence (shown in italic type). The remaining 351 amino acids of CYP24-SV were >99% homologous with 24-OHase, including the sterol- and heme-binding domains (both underlined). Sequence data are shown for exons 1–3 of chick CYP24 only, with the remaining CYP24 and CYP24-SV cDNAs showing >99% identity.

 
Expression of CYP24-SV mRNA and Protein in HD-11 Cells—Expression of mRNA for CYP24-SV in HD-11 cells was initially examined by RT-PCR using primer combinations that were specific for splice variant and wild-type CYP24. In vehicle and 25-OHD-treated cells, there was negligible expression of CYP24 (766 bp) and CYP24-SV (655 bp), but both transcripts were strongly up-regulated following treatment with 1,25-(OH)2D (Fig. 2A). Northern blot analysis (Fig. 2B) was performed using a 715-bp probe (CYP24 cDNA 1104–1819), which was identical in CYP24-SV and CYP24. A single band of 2.7 kb was detected in cells cultured with 200 nM 1,25-(OH)2D for 24 h. This suggested that the full-length transcripts for CYP24 and CYP24-SV were approximately the same size, presumably reflecting further sequence variation in upstream parts of the 5'-untranslated region of CYP24-SV yet to be sequenced. Western blot analysis using a rabbit polyclonal antiserum against CYP24 and CYP24-SV identified a 36-kDa band corresponding to the 351 amino acid fragment deduced from the ORF of CYP24-SV, as well as the 55-kDa CYP24 peptide (Fig. 2C). However, unlike CYP24, this was only detectable in whole cell protein extracts, suggesting that the CYP24-SV protein resided outside the mitochondria. Expression of the 36-kDa CYP24-SV peptide was much stronger in 1,25-(OH)2D-treated cells, further emphasizing the positive control of the splice variant by 1,25-(OH)2D.



View larger version (52K):
[in this window]
[in a new window]
  		FIG. 2.
Expression and regulation of CYP24-SV and CYP24 in HD-11 cells. Chick macrophage HD-11 cells were preincubated with vehicle only, 200 nM 25-OHD for 1 h, or 200 nM 1,25-(OH)2D for 24 h before RNA was extracted. A, RT-PCR analysis of CYP24-SV (766 bp), CYP24 (655 bp), and chick {beta}-actin (445 bp) mRNA expression. Transcripts for CYP24 and CYP24-SV were detectable only in 1,25-(OH)2D-treated cells. B, Northern blot analysis of CYP24-SV mRNA, CYP24 mRNA, and 18 S rRNA expression. A single 2.7-kb band was detected in 1,25-(OH)2D-stimulated HD-11 cells. C, Western blot analysis of CYP24 and CYP24-SV protein expression in HD-11 cells using rabbit polyclonal antiserum against chick CYP24-SV/CYP24 peptide. A 36-kDa band corresponding to the 351 amino acids encoded by ORF of CYP24-SV was detected only in whole cell samples and not in mitochondrial samples and was strongly induced by 1,25-(OH)2D (100 nM, 24 h). A 55-kDa band corresponding to wild type CYP24 was also detected using this antiserum. Protein loading for Western blots was assessed by expression of the mitochondrial resident housekeeping gene grp75.

 
Cloning of a Human Form of the CYP24-SV—Using primer combinations derived from the chick cDNA sequences outlined above, a human equivalent of CYP24-SV was cloned and sequenced (GenBankTM/EBI accession number AY858838 [GenBank] ; see Appendix 4 as supplemental material). The cDNA, referred to as hCYP24-SV, showed exactly the sequence organization as the chick CYP24-SV in that exons 1 and 2 were spliced out and replaced by an alternative sequence derived from intron 2 (Fig. 3A). The resulting protein sequence for hCYP24-SV was 372 amino acids long compared with 513 amino acids for holo-human CYP24 (Fig. 3B). As with the chick splice variant, hCYP24-SV protein included no mitochondrial target sequence but retained sterol- and heme-binding domains (see Appendix 5 as supplemental material).

Tissue Distribution of hCYP24-SV—RT-PCR analyses of various human tissues indicated that hCYP24-SV was present in kidney, placenta, skin, and primary cultures of macrophages. In each case, expression of the 396-bp species corresponding to hCYP24-SV was more abundant than the corresponding 484-bp wild type CYP24 mRNA. By contrast, the splice variant was only weakly expressed in brain and was undetectable in heart (Fig. 4). In the human monocyte/macrophage cell line THP-1, expression of both hCYP24-SV and hCYP24 was potently up-regulated after treatment with 1,25-(OH)2D (100 nM for 24 h). This effect was observed in conventional THP-1 cultures and also in THP-1 cells differentiated toward a more mature macrophage phenotype by treatment with phorbol ester (dTHP-1 cells).

CYP24-SV and hCYP24-SV Regulate 1,25-(OH)2D Production by Macrophages—Compared with the holoenzyme, the CYP24-SV and hCYP24-SV showed identical sequence in the sterol binding domains. However, by contrast, both of the splice variant cDNAs had deduced amino acid sequences that did not include mitochondrial targeting domains. Therefore, it was postulated that, when expressed, CYP24-SV and hCYP24-SV might function in an entirely different fashion to 24-OHase with respect to the attenuation of 1,25-(OH)2D production. To test this hypothesis, expression constructs containing sense and antisense sequences for CYP24-SV and hCYP24-SV were transfected into 1{alpha}-OHase-positive HD-11 cells and differentiated THP-1 cells, respectively (Fig. 5, A and B). Transient transfection with antisense cDNA increased 1,25-(OH)2D production in HD-11 cells by 7-fold (p < 0.001), whereas sense cDNA for CYP24-SV suppressed production of 1,25-(OH)2D by 50% (p < 0.01). These data were generated using a substrate (25-OHD) concentration (200 nM) that approximated the reported Km values for 1{alpha}-hydroxylase and 24-hydroxylase. However, similar levels of CYP24-SV-induced suppression of 1,25-(OH)2D production were also observed using 20 or 2000 nM 25-OHD (68% of control (p < 0.01) and 55% of control (p < 0.01), respectively) (Fig. 5C). Modulation of 1{alpha}-hydroxylase activity by CYP24-SV was also observed in TPA-differentiated THP-1 cells, where antisense cDNA for hCYP24-SV increased 1,25-(OH)2D production 2-fold (p < 0.001), and sense cDNA suppressed production by 40% (p < 0.01). Transfection of CYP24 cDNA had little effect on the synthesis of 1,25-(OH)2D by HD-11 cells, and transfection of the splice variant cDNAs had no effect on 24-hydroxylase activity, which remained undetectable in both HD-11 and THP-1 cells (data not shown).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The vitamin D-24-OHase enzyme plays a pivotal role in attenuating vitamin D responsiveness by catalyzing the synthesis of less active 24-hydroxylated metabolites such as 24,25-dihydroxyvitamin D and 1,24,25-trihydroxyvitamin D. As such, it provides an effective means for the regulation of circulating levels of 1,25-(OH)2D mediated by the renal 1{alpha}-OHase (6–9, 29). This has been elegantly illustrated by studies that have attenuated 24-OHase function either by the use of specific enzyme inhibitors (30, 31) or by CYP24 gene ablation (32, 33). In each case, the overriding consequence of 24-OHase knockout was to sensitize tissues to the effects of 1,25-(OH)2D. Since CYP24 is perhaps the most sensitively regulated of all of the many target genes for 1,25-(OH)2D, it seems likely that this feedback control mechanism will operate at most sites of 1,25-(OH)2D synthesis and action. However, one abundant source of extrarenal 1{alpha}-OHase activity that does not appear to be subject to 24-OHase-mediated control is the macrophage (22–24). Indeed, autocrine synthesis of 1,25-(OH)2D associated with inflammatory diseases such as sarcoidosis (34) and Crohn's disease (35) is commonly dysregulated and may lead to increased circulating levels of 1,25-(OH)2D and concomitant hypercalcemia or hypercalciuria (36). We therefore postulated that the elevated synthesis of 1,25-(OH)2D observed in macrophages may involve a regulatory system that is distinct from the 24-OHase-mediated mechanism found in most other cell types.



View larger version (14K):
[in this window]
[in a new window]
  		FIG. 3.
Schematic comparison between cDNA sequences for human CYP24 (hCYP24) and human CYP24-SV (hCYP24-SV). A, exon organization for hCYP24 showing the localization of sequences encoding the translation start codon, mitochondrial targeting sequence, sterol binding domain, heme-binding domain, and translation stop codon. B, exon organization for hCYP24-SV highlighting an extended exon 3 due to alternative splicing of exon 3 and intron 2 (In 2).

 



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 4.
Expression of mRNA for hCYP24 and hCYP24-SV in human renal and extrarenal tissues. Total RNA was isolated from proximal tubule HKC-8 cells (kidney), placenta, peripheral blood-derived macrophages (macrophage), keratinocytes (skin), heart, and brain. RNA was also isolated from THP-1 cells treated with or without 100 nM 1,25-(OH)2D(1,25D) for 24 h in the presence or absence of 160 nM TPA as an alternative differentiating agent (dTHP-1/dTHP-1 + 1,25D). RT-PCR assays were carried out as multiplex assays using primers for hCYP24 and hCYP24-SV together with primers for the housekeeping gene {beta}-actin.

 
Using chick and human macrophage models, we cloned and characterized a CYP24 splice variant that is also detectable in the kidney and other extrarenal tissues. The human form, hCYP24-SV, retains the upstream vitamin D-responsive elements that are present in CYP24 and consequently demonstrates the same sensitive induction by 1,25-(OH)2D characteristic of the wild-type species (6, 7). hCYP24-SV also retains the intact sterol bind domain common to other vitamin D metabolic P450 enzymes (see Fig. 4) and is therefore able to bind substrates such as 25-OHD or 1,25-(OH)2D. However, unlike holo-CYP24, the splice variant lacks a 150-amino acid amino-terminal sequence containing the mitochondrial targeting domain (37–39). The loss of such a moiety presumably leaves the CYP24-SV protein with no conventional means of translocation through the mitochondria membranes (40). Thus, the variant protein will not be processed into a functionally mature enzyme; when a protein moves into the mitochondrion, its presequence (with a range of ~10–80 amino acid residues) is cleaved by a mitochondrial processing peptidase, and the resulting mature protein folds into its functional confirmation (41, 42). This was further supported by Western blot analyses, which provided direct evidence for the exomitochondrial localization of CYP24-SV protein (Fig. 4).

Mitochondrial P450 activity is dependent on the NADPH-adrenodoxin-reductase electron transport system located within the mitochondrion, suggesting that the CYP24-SV and hCYP24-SV proteins will be functionally inactive. This was confirmed by stable and transient transfection studies in which overexpression of the human or chick CYP24-SV failed to produce any 24-hydroxylase activity. Despite this, modulation of CYP24-SV expression had significant effects on 1,25-(OH)2D production, with 1{alpha}-OHase activity being increased by antisense CYP24-SV and decreased by sense CYP24-SV expression (Fig. 5). The ability of CYP24-SV to suppress synthesis of 1,25-(OH)2D was still evident at saturating doses of substrate. A possible explanation for this is that the splice variant functions in a noncatabolic fashion by competing with 1{alpha}-OHase for substrate, although alternative splicing in cytochrome P450 genes has previously been shown to cause changes in function, activity, substrate preference, and tissue specificity (43–46). Our current study is the first example of alternative splicing in CYP24 gene, although Neve et al. (40) have previously reported that deletion of 95 amino acids at the N terminus of the CYP2E1 protein abolished its mitochondrial targeting. CYP27B1 splice variants have also been reported in malignant glioma cells, although the functional significance of the resulting cDNAs is unclear (47).



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 5.
1,25-(OH)2D production in HD-11 and THP-1 cells transfected with CYP24-SV/CYP24 and hCYP24-SV cDNA expression constructs. Sense and antisense cDNAs for CYP24-SV, hCYP24-SV, and the antisense CYP24 cDNA were subcloned into pcDNA3.1, and the resulting expression constructs were transfected into either HD-11 (CYP24/CYP24-SV) or THP-1 cells (hCYP24-SV). 48 h after transfection, cells were incubated with 20–2000 nM 25-OHD for 3 h. The culture medium and cells were collected for analysis of 1,25-(OH)2D production. Data are shown as percentage change in 1,25-(OH)2D synthesis relative to plasmid-only control transfectants, and each value is the mean ± S.E. of triplicate samples. A, 1,25-(OH)2D production decreased significantly in HD-11 cells transfected with sense CYP24-SV (sense SV) (**, p < 0.01) and increased in cells transfected with antisense CYP24-SV (antisense SV) (***, p < 0.001). B, in THP-1 cells, transfection with antisense hCYP24-SV also increased synthesis of 1,25-(OH)2D (p < 0.001), whereas sense hCYP24-SV decreased synthesis of 1,25-(OH)2D (p < 0.01). Transfection with antisense CYP24 had no significant effect on 1,25-(OH)2D synthesis by HD-11 cells. C, in HD-11 cells transfection with sense cDNA for CYP24-SV maintained suppression of 1,25-(OH)2D production across a range of substrate (25-OHD) concentrations (20–2000 nM).

 
Expression studies presented here suggest that hCYP24-SV acts by sequestering vitamin D metabolites, but several important questions concerning the function of this peptide remain to be answered. In common with the holoenzyme, transcription of hCYP24-SV was potently up-regulated following treatment with 1,25-(OH)2D, so that wild-type and splice variant peptide may be in direct competition with each other for substrate binding. Further studies are required to define the stoichiometry between these two peptides in terms of substrate specificity (25-OHD and 1,25-(OH)2D) and interaction with other regulators of vitamin D metabolism. For example, CYP24-SV function may take precedence over CYP24 in cells with low base-line 24-OHase activity but sensitive 1,25-(OH)2D-induced transcriptional regulation (e.g. macrophages). By contrast, 24-OHase activity may be a feature of cells with a relatively high baseline expression of CYP24 and modest 1,25-(OH)2D-mediated transcriptional induction (e.g. kidney). Using this model, it also possible that cells from certain tissues will exhibit both CYP24 and CYP24-SV function. The underlying basis for the regulation of alternative splicing in the CYP24 gene is still unclear and may involve changes in the levels of ubiquitous splicing factors such as heterogeneous nuclear ribonuclear protein A1 or induction of tissue- or signal-specific splicing factors (48). Since both CYP24 and CYP24-SV contain upstream vitamin D-responsive element sequences and show similar levels of induction with 1,25-(OH)2D, it seems likely that other factors will be involved in mediating the differential splicing of this gene. A possible candidate for this is parathyroid hormone, which has been shown to potentiate 1,25-(OH)2D-mediated transcription of CYP24 with a concomitant increase in 24-OHase protein (49).

RNA splicing is a common feature of more advanced organisms, with up to 60% of human genes being alternatively spliced (48). Although this confers an expression advantage by expanding the capacity for regulation of RNA and the diversity of proteins, the specific biological benefit of a 24-hydroxylase variant remains unclear. CYP24-SV may reflect the dichotomy between classical calciotropic and nonclassical antiproliferative/immunomodulatory functions of 1,25-(OH)2D. Alternatively, the presence of CYP24 and CYP24-SV proteins may simply underline the need for sensitive control of vitamin D responses. In either case, the expression of CYP24-SV may have important pathological implications. In particular, the presence of this peptide in activated macrophages suggests that it may be a contributing factor to the elevated serum 1,25-(OH)2D frequently seen with inflammatory diseases (34–37). The precise mechanism by which this occurs is still to be elucidated but may involve an additional facet of CYP24-SV function. Specifically, studies presented here have focused on the ability of the splice variant protein to suppress 1{alpha}-OHase activity presumably by sequestering the substrate for this enzyme 25-OHD. However, in cells with high levels of 1{alpha}-OHase expression, CYP24-SV may also actively bind 1,25(OH)2D. This, in turn, may attenuate nuclear signaling by 1,25-(OH)2D while preventing its catabolism. Under these conditions, the accumulation of 1,25-(OH)2D in cells such as macrophages might conceivably lead to a spill-over of the vitamin D metabolite into the general circulation. This effect may not only be restricted to inflammatory disease. Recent studies have highlighted the importance of CYP24 as a determinant of vitamin D resistance in tumors (15). This is a key factor in the successful application of 1,25-(OH)2D and other deltanoids in cancer chemoprevention and therapy. As such, further analysis of CYP24-SV in tumors may help to shed light on the contribution of this novel mechanism on the tissue-specific regulation of vitamin D metabolism and function.


   FOOTNOTES
 
* This work was supported by National Institutes of Health Grants AI40403, AR50626, and RR00425. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{boxs} The on-line version of this article (available at http://www.jbc.org) contains five appendices with figures.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AF428109 [GenBank] . Back

To whom correspondence should be addressed: Division of Medical Sciences, Institute of Biomedical Research, University of Birmingham, Birmingham, B15 2TT, United Kingdom. Tel.: 44-121-414-3776; Fax: 44-121-415-8712; E-mail: M.Hewison{at}bham.ac.uk.

1 The abbreviations used are: 1,25-(OH)2 D, 1,25-dihydroxyvitamin D; 25-OHD, 25-hydroxyvitamin D3; 1{alpha}-OHase, 25-(OH)D-1{alpha}-hydroxylase; 24-OHase, 24-hydroxylase; DMEM, Dulbecco's modified Eagle's medium; FBS, fetal bovine serum; TPA, 12-O-tetradecanoylphorbol-13-acetate; RT, reverse transcription; RACE, rapid amplification of cDNA ends; ORF, open reading frame. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bland, R., Zehnder, D., and Hewison, M. (200) Curr. Opin. Nephrol. Hypertens. 9, 17–22
  2. Zehnder, D., and Hewison, M. (1999) Mol. Cell. Endocrinol. 151, 213–220[CrossRef][Medline] [Order article via Infotrieve]
  3. Ohyama, Y., and Yamasaki, T. (2004) Front. Biosci. 9, 3007–3018[Medline] [Order article via Infotrieve]
  4. Omdahl, J. L., Morris, H. A., and May, B. K. (2002) Annu. Rev. Nutr. 22, 139–166[CrossRef][Medline] [Order article via Infotrieve]
  5. Henry, H. L. (2001) Steroids 66, 391–398[CrossRef][Medline] [Order article via Infotrieve]
  6. Kerry, D. M., Dwivedi, P. P., Hahn, C. N., Morris, H. A., Omdahl, J. L., and May, B. K. (1996) J. Biol. Chem. 271, 29715–29721[Abstract/Free Full Text]
  7. Ohyama, Y., Ozono, K., Uchida, M., Yoshimura, M., Shinki, T., Suda, T., and Yamamoto, O. (1996) J. Biol. Chem. 271, 30381–30385[Abstract/Free Full Text]
  8. Reddy, G. S., and Tserng, K. Y., (1989) Biochemistry 28, 1763–1769[CrossRef][Medline] [Order article via Infotrieve]
  9. Makin, G., Lohnes, D., Byford, V., Ray, R., and Jones, G. (1989) Biochem. J. 262, 173–180[Medline] [Order article via Infotrieve]
  10. Zehnder, D., Evans, K. N., Kilby, M. D., Bulmer, J. N., Innes, B. A., Stewart, P. M., and Hewison, M. (2002) Am. J. Pathol. 161, 105–114[Abstract/Free Full Text]
  11. Zehnder, D., Bland, R., Chana, R. S., Wheeler, D. C., Howie, A. J., Williams, M. C., Stewart, P. M., and Hewison, M. (2002) J. Am. Soc. Nephrol. 13, 621–629[Abstract/Free Full Text]
  12. Zehnder, D., Bland, R., Williams, M. C., McNinch, R. W., Howie, A. J., Stewart, P. M., and Hewison, M. (2001) J. Clin. Endocrinol. Metab. 86, 888–894[Abstract/Free Full Text]
  13. Miller, W. L., and Portale, A. A. (2000) Trends Endocrinol. Metab. 11, 315–319[CrossRef][Medline] [Order article via Infotrieve]
  14. Chen, T. C., Wang, L., Whitlatch, L. W., Flanagan, J. N., and Holick, M. F. (2003) J. Cell. Biochem. 88, 315–322[CrossRef][Medline] [Order article via Infotrieve]
  15. Albertson, D. G., Ylstra, B., Segraves, R., Collins, C., Dairkee, S. H., Kowbel, D., Kuo, W. L., Gray, J. W., and Pinkel, D. (2000) Nat. Genet. 25, 144–146[CrossRef][Medline] [Order article via Infotrieve]
  16. Lou, Y. R., Laaksi, I., Syvala, H., Blauer, M., Tammela, T. L., Ylikomi, T., and Tuohimaa, P. (2004) FASEB J. 18, 332–334[Abstract/Free Full Text]
  17. Panda, D. K., Miao, D., Tremblay, M. L., Sirois, J., Farookhi, R., Hendy, G. N., and Goltzman, D. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 7498–7503[Abstract/Free Full Text]
  18. Fu, G. K., Lin, D., Zhang, M. Y., Bikle, D. D., Shackleton, C. H., Miller, W. L., and Portale, A. A. (1997) Mol. Endocrinol. 11, 1961–1970[Abstract/Free Full Text]
  19. Smith, S. J., Rucka, A. K., Berry, J. L., Davies, M., Mylchreest, S., Paterson, C. R., Heath, D. A., Tassabehji M., Read, A. P., Mee, A. P., and Mawer, E. B. (1999) J. Bone Miner. Res. 14, 730–739[CrossRef][Medline] [Order article via Infotrieve]
  20. Kong, X. F., Zhu, X. H., Pei, Y. L., Jackson, D. M., and Holick, M. F. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 6988–9693[Abstract/Free Full Text]
  21. Adams, J. S., Ren, S. Y., Arbelle, J. E., Horiuchi, N., Gray, R. W., Clemens, T. L., and Shany, S. (1994) Endocrinology 134, 2567–2573[Abstract/Free Full Text]
  22. Adams, J. S., and Gacad, M. A. (1985) J. Exp. Med. 161, 755–765[Abstract/Free Full Text]
  23. Reichel, H., Koeffler, H. P., Barbers, R., and Norman, A. W. (1987) J. Clin. Endocrinol. Metab. 65, 1201–1209[Abstract/Free Full Text]
  24. Dusso, A. S., Kamimura, S., Gallieni, M., Zhong, M., Negrea, L., Shapiro, S., and Slatopolsky, E. (1997) J. Clin. Endocrinol. Metab. 82, 2222–2232[Abstract/Free Full Text]
  25. Monkawa, T., Yoshida, T., Hayashi, M., and Saruta, T. (2000) Kidney Int. 58, 559–568[CrossRef][Medline] [Order article via Infotrieve]
  26. Bland, R., Walker, E. A., Hughes, S. V., Stewart, P. M., and Hewison, M. (1999) Endocrinology 140, 2027–2034[Abstract/Free Full Text]
  27. Hewison, M., Freeman, L., Hughes, S. V., Evans, K. N., Bland, R., Eliopoulos, A. G., Kilby, M. D., Moss, P. A., and Chakraverty, R. (2003) J. Immunol. 170, 5382–5390[Abstract/Free Full Text]
  28. Shany, S., Ren, S., Arbelle, J. E., Clemens, T. L., and Adams, J. S. (1993) J. Bone Miner. Res. 82, 69–76
  29. Christakos, S., Dhawan, P., Liu, Y., Peng, X., and Porta, A. (2003) J. Cell. Biochem. 88, 695–705[CrossRef][Medline] [Order article via Infotrieve]
  30. Xie, Z., Munson, S. J., Huang, N., Portale, A. A., Miller, W. L., and Bikle, D. D. (2002) J. Biol. Chem. 277, 36987–36990[Abstract/Free Full Text]
  31. Ly, L. H., Zhao, X. Y., Holloway, L., and Feldman, D. (1999) Endocrinology 140, 2071–2076[Abstract/Free Full Text]
  32. Masuda, S., Byford, V., Arabian, A., Sakai, Y., Demay, M. B., St-Arnaud, R., and Jones, G. (2004) Endocrinology 146, 825–834
  33. St-Arnaud, R., Arabian, A., Travers, R., Barletta, F., Raval-Pandya, M., Chapin, K., Depovere, J., Mathieu, C., Christakos, S., Demay, M. B., and Glorieux, F. H. (2000) Endocrinology 141, 2658–2666[Abstract/Free Full Text]
  34. Adams, J. S., Sharma, O. P., Gacad, M. A., and Singer, F. R. (1983) J. Clin. Invest. 72, 1856–1860[Medline] [Order article via Infotrieve]
  35. Abreu, M. T., Kantorovich, V., Vasiliauskas, E. A., Gruntmanis, U., Matuk, R., Daigle, K., Chen, S., Zehnder, D., Lin. Y. C., Yang, H., Hewison, M., and Adams, J. S. (2004) Gut 53, 1129–1136[Abstract/Free Full Text]
  36. Hewison, M., and Adams, J. S. (2005) Vitamin D, 2nd Ed., pp. 1379–1400, Academic Press, San Diego
  37. Kumamoto, T., Ito, A., and Omura, T. (1989) J. Biochem. (Tokyo) 105, 72–78[Abstract/Free Full Text]
  38. Omura, T., and Ito, A. (1991) Methods Enzymol. 206, 75–81[CrossRef][Medline] [Order article via Infotrieve]
  39. Ou, W.J., Kumamoto, T., Mihara, K., Kitada, S., Niidome, T., Ito, A., and Omura, T. (1994) J. Biol. Chem. 269, 24673–24678[Abstract/Free Full Text]
  40. Neve, E. P., and Ingelman-Sundberg, M. (2001) J. Biol. Chem. 276, 11317–11322[Abstract/Free Full Text]
  41. Ou, W. J., Ito, A., Morohashi, K., Fujii-Kuriyama, Y., Omura, T. (1986) J. Biochem. (Tokyo) 100, 1287–1296[Abstract/Free Full Text]
  42. Pfanner, N. (2000) Curr. Biol. 10, R412–R415[CrossRef][Medline] [Order article via Infotrieve]
  43. Ding, S., Lake, B. G., Friedberg, T., and Wolf, C. R. (1995) Biochem. J. 306, 161–166
  44. Huang, Z., Fasco, M. J., and Kaminsky, L. S. (1997) Arch. Biochem. Biophys. 343, 101–108[CrossRef][Medline] [Order article via Infotrieve]
  45. Christmas, P., Ursino, S. R., Fox, J. W., and Soberman, R. J. (1999) J. Biol. Chem. 274, 21191–21199[Abstract/Free Full Text]
  46. Christmas, P., Jones, J. P., Patten, C. J., Rock, D. A., Zheng, Y., Cheng, S. M., Weber, B. M., Carlesso, N., Scadden, D. T., Rettie, A. E., and Soberman, R. J. (2001) J. Biol. Chem. 276, 38166–38172[Abstract/Free Full Text]
  47. Maas, R. M., Reus, K., Diesel, B., Steudel, W. I., Feiden, W., Fischer, U., and Meese, E. (2001) Clin. Cancer Res. 7, 868–875[Abstract/Free Full Text]
  48. Akker, S. A., Smith, P. J., Chew, S. L. (2001) J. Endocrinol. 27, 123–131
  49. Armbrecht, H. J., Hodam, T. L., Boltz, M. A., Partridge, N. C., Brown, A. J., Kumar, V. B. (1998) Endocrinology 139, 3375–3381[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Biol. Reprod.Home page
N. Liu, A.T. Kaplan, J. Low, L. Nguyen, G.Y. Liu, O. Equils, and M. Hewison
Vitamin D Induces Innate Antibacterial Responses in Human Trophoblasts via an Intracrine Pathway
Biol Reprod, March 1, 2009; 80(3): 398 - 406.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
D. Bikle
Nonclassic Actions of Vitamin D
J. Clin. Endocrinol. Metab., January 1, 2009; 94(1): 26 - 34.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
R. Bouillon, G. Carmeliet, L. Verlinden, E. van Etten, A. Verstuyf, H. F. Luderer, L. Lieben, C. Mathieu, and M. Demay
Vitamin D and Human Health: Lessons from Vitamin D Receptor Null Mice
Endocr. Rev., October 1, 2008; 29(6): 726 - 776.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
J. H. White
Vitamin D Signaling, Infectious Diseases, and Regulation of Innate Immunity
Infect. Immun., September 1, 2008; 76(9): 3837 - 3843.
[Full Text] [PDF]

Home page
 EndocrinologyHome page
S. Wu, S. Ren, L. Nguyen, J. S. Adams, and M. Hewison
Splice Variants of the CYP27b1 Gene and the Regulation of 1,25-Dihydroxyvitamin D3 Production
Endocrinology, July 1, 2007; 148(7): 3410 - 3418.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
280/21/20604    most recent
M414522200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ren, S.
Right arrow Articles by Hewison, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ren, S.
Right arrow Articles by Hewison, M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement