Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M414091200 on April 1, 2005

J. Biol. Chem., Vol. 280, Issue 23, 22482-22491, June 10, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/23/22482    most recent
M414091200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moro, L.
Right arrow Articles by Greco, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moro, L.
Right arrow Articles by Greco, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Down-regulation of BRCA2 Expression by Collagen Type I Promotes Prostate Cancer Cell Proliferation*

Loredana Moro{ddagger}, Arnaldo A. Arbini§, Ersilia Marra{ddagger}, and Margherita Greco{ddagger}

From the {ddagger}Institute of Biomembranes and Bioenergetics, National Research Council (Consiglio Nazionale delle Ricerche), Bari 70126, Italy and the §Department of Pathology and Laboratory Medicine, University of Rochester School of Medicine and Dentistry, Rochester, New York 14642

Received for publication, December 15, 2004 , and in revised form, March 29, 2005.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
BRCA2 is a tumor suppressor gene that when mutated confers an increased susceptibility to developing breast and prostate carcinoma. Besides its role in mediating DNA repair, new evidence suggests that BRCA2 may also play a role in suppressing cancer cell growth. Because altered interactions between neoplastic cells and the surrounding extracellular matrix (ECM) play a pivotal role in unchecked cancer cell proliferation and metastatic progression, we hypothesized that the ECM may have an effect in BRCA2 expression. By using normal and prostate carcinoma cell lines, we demonstrated that although normal cells transiently increase BRCA2 protein levels when adhering to the ECM protein collagen type I (COL1), carcinoma cells exhibit a significant reduction in BRCA2 protein. This aberrant effect is independent from de novo protein synthesis and results from COL1-{beta}1 integrin signaling through phosphatidylinositol (PI) 3-kinase leading to BRCA2 ubiquitination and degradation in the proteasome. BRCA2 protein depletion after cancer cell adhesion to COL1 or in small RNA interference assays triggers new DNA synthesis, a trophic effect that is abrogated by recombinant BRCA2 expression. Blocking or inhibiting {beta}1 integrin, PI 3-kinase, or proteasome activity all have a negative effect on COL1-mediated DNA synthesis in cancer cells. In normal cells, the transient increase in BRCA2 expression is independent from {beta}1 integrin or PI 3-kinase and has no effect in cell proliferation. In summary, these results unravel a novel mechanism whereby prostate carcinoma cell proliferation is enhanced by the down-regulation of BRCA2 expression when interacting with COL1, a major component of the ECM at osseous metastatic sites.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Germ line mutations in the BRCA2 gene result in breast and ovarian cancer susceptibility in women and prostate carcinoma in men (14). Inheritance of one defective allele confers cancer predisposition, and neoplastic cells from predisposed individuals frequently exhibit loss of heterozygosity in the wild-type allele (5, 6). The major identified function of the BRCA2 protein is to form complexes with Rad51, which orchestrate homologous recombination repair of DNA double-strand breaks (7). Inactivation of the murine homologue Brca2 leads to embryonic lethality (811), and Brca2-null murine embryonic fibroblasts exhibit spontaneous accumulation of chromosomal abnormalities (12, 13) and defective cytokinesis (14). In addition to its role in mediating DNA repair and genome stability, new evidence suggests that BRCA2 could suppress tumor development by inhibiting cancer cell growth (15).

The majority of breast, ovarian, and prostate cancer cases is sporadic (16, 17). In these cases, mutational inactivation of BRCA2 is rare, as it would require both gene copies to be affected. Alternatively, non-mutational functional suppression could result from various mechanisms, such as binding of BRCA2 by EMSY, a protein amplified in sporadic breast and higher grade ovarian cancers (18). Any number of environmental cues may also influence BRCA2 expression during cancer initiation and/or progression. However, the regulation of BRCA2 expression during these events, as well as in other physiopathological conditions, remains largely uncharted.

The extracellular matrix (ECM)1 influences several important aspects of cancer cell behavior such as motility and invasiveness, cell growth, survival, and proliferation through modulation of gene expression (19). Indeed, altered interaction between cells and the surrounding ECM is recognized as a common feature of neoplastic cells (19). The adhesion of cancer cells to ECM within target organs has been implicated in the promotion of organ-specific metastasis (20, 21). For instance, the preferential metastasis of prostate cancer to the bone has been suggested to involve collagen type I (COL1) (20), the major structural component of the bone (22). Collagens and other ECM proteins interact with cells through integrins (23), a family of heterodimeric transmembrane receptors composed of an {alpha} and a {beta} subunit (24). These interactions activate cytoplasmic kinases, such as members of the mitogen-activated protein kinase/extracellular signal-regulated kinase-1 and -2 (25, 26) and the phosphatidylinositol (PI) 3-kinase/AKT (27, 28), which modulate the expression of genes exerting stringent control on cell proliferation (23).

In this study, we have elucidated a novel mechanism whereby adhesion of prostate carcinoma cells to the ECM protein COL1 results in BRCA2 protein degradation, which stimulates cancer cell proliferation.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—PNT1A cells (a human prostate normal cell line established by immortalization of normal adult prostate epithelial cells), PC-3 cells (a human prostate carcinoma cell line derived from a bone metastasis), and MCF-7 (a human breast adenocarcinoma cell line) were obtained from the European Collection of Cell Cultures (ECACC, Salisbury, UK). PNT1A and PC-3 cells were kept in culture as described previously (29). MCF-7 cells were cultured in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% inactivated fetal bovine serum (BioSpa, Milan, Italy), 2 mM glutamine (Invitrogen), 100 units/ml penicillin (Invitrogen), and 100 µg/ml streptomycin (Invitrogen), at 37 °C in the presence of 5% CO2.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 1.
BRCA2 mRNA and protein expression is comparable in normal and cancer prostate cells. A, semi-quantitative RT-PCR of BRCA2 mRNA from PNT1A and PC-3 cells. RT-PCR of BRCA2 mRNA from MCF-7 cells was included as positive control. RT-PCR of GAPDH mRNA was used as internal control. M, molecular size marker. Results are representative of three independent experiments. B, immunoblotting analysis of BRCA2 protein. MCF-7, PNT1A, and PC-3 cell protein extracts (100 µg) were electrophoresed on 6% SDS-polyacrylamide gel under reducing conditions and immunostained using an antibody to BRCA2. {beta}-Tubulin signals were used as loading controls. Autoradiographs are representative of five independent experiments.

 
RNA Extraction and RT-PCR—Cells were grown to 60–70% confluence and washed twice with cold phosphate-buffered saline (PBS), and total cellular RNA was isolated using the TRIzol reagent (Invitrogen) following the manufacturer's instructions. The amount of BRCA2 mRNA present in the cells was measured by semi-quantitative reverse transcription. Total RNA was reverse-transcribed, and the resulting cDNA was amplified by PCR using the Titan One Tube RT-PCR system (Roche Applied Science), as described previously (29). Briefly, total RNA (1 µg) was reverse-transcribed for 30 min at 55 °C in 0.2 mM dNTPs (Roche Applied Science), 5 units of RNase inhibitor (Promega, Milan, Italy), 1x RT-PCR buffer (Roche Applied Science), 0.6 µM upstream primer (Invitrogen), 0.6 µM downstream primer (Invitrogen), 1 µl of enzyme mix (avian myeloblastosis virus, Taq DNA polymerase, and a proofreading polymerase; Roche Applied Science). After cDNA synthesis, a cycle of denaturation at 94 °C for 2 min followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, and elongation at 72 °C for 60 s were run. Primer pairs from the 5'- and 3'-ends of the BRCA2 cDNA were used, as described by Wu et al. (30). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control, as described by Wu et al. (30). All the PCRs were performed using a PCR system (PerkinElmer Life Sciences). The PCR products were analyzed on a 2% agarose gel, stained with ethidium bromide.

Immunoblotting Analysis and Immunoprecipitation—PNT1A, PC-3, and MCF-7 cells were grown either on plastic (PL), polylysine (PLL) (10 µg/ml; Sigma, Milan, Italy), COL1 (10 µg/ml; Sigma), or the activating {beta}1 integrin antibody P4G11 (1 µg/ml; Chemicon International, Temecula, CA) and then lysed in PBS (pH 7.4) containing 1% Nonidet P-40, 2 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, 10 µg/ml leupeptin, 10 mM sodium fluoride, 1 mM sodium orthovanadate, 5 mM sodium pyrophosphate. In some experiments, cells were added with either the protein synthesis inhibitor cycloheximide (12.5 µM; Sigma) or the lysosomal inhibitors leupeptin (100 µM; Sigma) or pepstatin (100 µM; Sigma) or NH4Cl (50 mM), or the calpain inhibitor ALLN (10 µM; Calbiochem), or the proteasome inhibitor MG132 (10 µM; Calbiochem), or the vehicle alone (Me2SO). Where indicated, cells were pretreated either for 1 h on ice with the blocking {beta}1 integrin antibody P4C10 (ascites 1:200; Chemicon) or the monoclonal antibody 1C10 to a vascular endothelial surface protein (ascites 1:200; Invitrogen) as a negative control, or for 1 h at 37 °C with wortmannin (0.1 µM; Sigma) or LY294002 (10 µM; Calbiochem), two different PI 3-kinase inhibitors, or the solvent alone (Me2SO). The protein content of each lysate was quantified using the Bio-Rad Dc protein assay reagent (Bio-Rad) according to the manufacturer's protocol. Protein extracts (100 µg) were electrophoresed through 6 or 10% SDS-polyacrylamide gel under reducing conditions according to Laemmli (31) and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA) in 25 mM Tris and 192 mM glycine, pH 8.3, containing 20% methanol. Membranes were blotted with either 1 µg/ml polyclonal rabbit anti-BRCA2 antibody (H-300; Santa Cruz Biotechnology, Santa Cruz, CA), 10 µg/ml monoclonal antibody to {beta}-tubulin (Sigma), 1 µg/ml monoclonal antibody to {beta}1 integrin (BD Transduction Laboratory), 1 µg/ml polyclonal rabbit anti-phospho-AKT-Ser-473 antibody (Santa Cruz Biotechnology), 1 µg/ml polyclonal rabbit anti-AKT 1/2 antibody (H-136; Santa Cruz Biotechnology), 1:400 dilution of anti-p110 antibody (H-239; Santa Cruz Biotechnology), or 1:1000 dilution of anti-p85{alpha} rabbit antiserum (Sigma), for 16 h at 4 °C in Tris-buffered saline/Tween 20 (TBS-T) (20 mM Tris, pH 7.5, 150 mM NaCl, 0.1% Tween 20). The membranes were then washed three times in TBS-T and incubated with a 1:2500 dilution of horseradish peroxidase-conjugated goat affinity-purified antibody to either rabbit or mouse IgG (Amersham Biosciences), in TBS-T for 1 h at room temperature. After three washes in TBS-T, proteins were visualized using the enhanced chemiluminescent system (ECL, Amersham Biosciences) according to the manufacturer's instructions. Densitometric values for immunoreactive bands were quantified using a GS-700 Imaging densitometer (Bio-Rad).



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 2.
Cancer cells adhere more efficiently to COL1 than normal prostate cells. A, to analyze cell adhesion, 1.5 x 105 PNT1A or PC-3 cells were allowed to attach to BSA (10 µg/ml), PLL (10 µg/ml), or COL1 (10 µg/ml) at 37 °C for 1 h, washed, and stained with crystal violet. Data are expressed as mean ± S.E. of triplicate wells. A representative experiment of three is shown. B, immunoblotting analysis of {beta}1 integrin protein. Total cell lysates (100 µg) from PNT1A and PC-3 cells were processed for immunoblotting. Membranes were probed with anti-{beta}1 integrin monoclonal antibody. {beta}-Tubulin signals were used as loading controls. C, to analyze the involvement of {beta}1 integrin in cell adhesion, 1.5 x 105 PNT1A or PC-3 cells were incubated for 1 h on ice in the presence of the {beta}1 integrin blocking antibody P4C10 (ascites 1:200) or 1C10 monoclonal antibody (ascites 1:200) as control and allowed to adhere to BSA or COL1, in the presence of the antibodies, as described in A. Data are expressed as mean ± S.E. of triplicate wells. A representative experiment of three is shown.

 



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 3.
Adhesion of PC-3 cells to COL1 decreases BRCA2 protein levels in a {beta}1 integrin-dependent manner. A, PNT1A and PC-3 cells were allowed to attach to PLL or COL1 at 37 °C for 0–6 h, washed, lysed, and processed for immunoblotting. Membranes were probed with anti-BRCA2 antibody. {beta}-Tubulin signals were used as loading controls. The blots are representative of three independent experiments. At the bottom, a quantification of BRCA2 protein levels is reported as percentage of the protein levels at 0 h of cell adhesion to PLL or COL1 (control), set at 100. Data are expressed as mean ± S.E. of three independent experiments. B, PNT1A and PC-3 cells were incubated for 1 h on ice in the presence or absence of P4C10 (ascites 1:200) and then allowed to adhere to the {beta}1 integrin activating antibody P4G11 or to COL1 at 37 °C for the indicated times, washed, lysed, and processed for immunoblotting. Membranes were probed with anti-BRCA2 antibody. The blots are representative of three independent experiments.

 
To perform a coupled immunoprecipitation-immunoblotting assay, the whole cell extract (0.25–0.5 mg of protein) was first precleared and then incubated overnight at 4 °C with 1 µg of polyclonal antibody to BRCA2 (H-300). Immunocomplexes were recovered by binding to protein A-Sepharose (Sigma) and washed five times with PBS containing 1% Nonidet P-40, 2 mM phenylmethylsulfonyl fluoride, 10 mM sodium fluoride, 1 mM sodium orthovanadate, 5 mM sodium pyrophosphate. Immunocomplexes were analyzed by 6% SDS-PAGE under reducing conditions followed by transfer to polyvinylidene difluoride membrane. Filters were immunoblotted using a 1:500 dilution of monoclonal antibody to ubiquitin (Sigma) or 2 µg/ml monoclonal antibody to BRCA2 (clone 5.23; Chemicon) following the manufacturer's instructions.

Cell Adhesion—Cell adhesion assays were carried out using 96-well tissue culture plates. Plates were pre-coated with different concentrations of COL1 (0.1–10 µg/ml) or P4G11 (0.5–1 µg/ml) for 16 h at 4 °C. Coating with 10 µg/ml bovine serum albumin (BSA; Sigma) was performed as a negative control. Coating with 10 µg/ml PLL was performed as a positive control. Adventitious binding sites in the wells were blocked with 1 mg/ml BSA in PBS for 1 h at 37 °C. Cells (150,000 cells/well) were plated on coated wells for 1 h at 37 °C, washed twice with PBS to remove unattached cells, fixed with 3% paraformaldehyde in PBS for 30 min at 4 °C, and stained with 0.5% crystal violet in PBS. Cell adhesion was quantified by measuring the absorbance at 630 nm in an enzyme-linked immunosorbent assay reader. Inhibition assays were performed by incubating cells for 1 h on ice in the presence of either P4C10, the monoclonal antibody to human {beta}1 integrin (ascites 1:200), or 1C10 (ascites 1:200) as a negative control. Triplicate observations were performed in each experiment.

Plasmid Expression Vectors—Expression vectors for wild-type PI 3-kinase p85 regulatory subunit (wt-p85), {Delta}p85, a dominant negative form of PI 3-kinase, and p110*, a constitutively active form of PI 3-kinase, were generously provided by Dr. Robert Freeman (University of Rochester, Rochester, NY). The expression vector containing the wild-type BRCA2 cDNA was a kind gift of Dr. M. C. Hung (University of Texas M. D. Anderson Cancer Center, Houston). pCMV-{beta}-gal vector expressing {beta}-galactosidase was from Stratagene.

Transient Transfection—PNT1A and PC-3 cells were seeded into 6-well dishes at 4–5 x 105 cells/well. After 24 h, transient transfections were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. The DNA sequence against which small interfering RNA (siRNA) for BRCA2 was created is AACAACAAUUACGAACCAAACUU (32). Duplexed RNA oligomer for BRCA2 was synthesized by Qiagen (Milan, Italy). Double-stranded RNA was transfected into the cells as 0.3 µg of siRNA/well. pCMV-{beta}-gal (0.5 µg/well) was transfected along with 4.5 µg/well of either one of the PI 3-kinase variant cDNAs constructs or the empty vector (pcDNA3). Cells were harvested 36–96 h after transfection and used in immunoblotting, immunoprecipitation, and [3H]thymidine incorporation assays. Transfected cells were also plated in 48-well plates and stained for {beta}-galactosidase expression to determine transfection efficiency. The {beta}-galactosidase staining was performed as described by Manes et al. (33).

[3H]Thymidine Incorporation—Thymidine incorporation assay was used to measure the cell proliferative index. Cells were starved for 24 h, detached, plated in a 96-well plate (10,000 cells/well), and grown for 15 h either on PL-, PLL (10 µg/ml)-, COL1 (10 µg/ml)-, or P4G11 (1 µg/ml)-coated wells. Where indicated, cells were preincubated for 1 h on ice with P4C10 (ascites 1:200) or 1C10 (ascites 1:200) as a negative control, or added with MG132 (10 µM), or preincubated for 1 h at 37 °C with wortmannin (0.1 µM) or the solvent alone (Me2SO) before plating. During the last 3 h of the 15-h culture, cells were pulsed with 1 µCi/ml methyl-[3H]thymidine (Amersham Biosciences), washed three times with PBS at 0 °C, and dissolved with 10% SDS. Radioactivity was measured by using a scintillation counter (Beckman Instruments).

Statistical Analysis—Data are reported as the mean ± S.E. Statistical analysis was performed by the Student's t test. All experiments were repeated at least twice.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study a normal human cell line (PNT1A), established by immortalization of normal adult prostate epithelial cells, non-tumorigenic in mice (34), and the prostate cancer epithelial cell line PC-3, derived from a bone metastasis (35, 36), were used as the experimental model. Both PNT1A and PC-3 cells expressed comparable levels of BRCA2 mRNA and protein as measured by RT-PCR (Fig. 1A) and Western blot assays (Fig. 1B), respectively. MCF-7, a breast cancer cell line that expresses wild-type BRCA2 (37), was included as a positive control (Fig. 1, A and B).

Cancer Cells Adhere More Efficiently to COL1 than Normal Prostate Cells—We proceeded to investigate the adhesive properties of PNT1A and PC-3 cells to COL1. Adhesion to BSA and PLL, an integrin-independent adhesive substrate, served as negative and positive controls, respectively. Serial dilutions were performed with the coating substrates, and the concentration that supported maximal adhesion, reported in Fig. 2, was used for all subsequent experiments. Both cell lines displayed comparable adhesion to PLL (Fig. 2A). However, they differed significantly when interacting with COL1. Whereas PNT1A cells adhered to COL1 at about 23% of the levels of adhesion to PLL, PC-3 cells adhered very efficiently, at about 141% of PLL levels after 1 h of adhesion. Longer incubation periods did not result in higher cell adhesion (data not shown). Because cell adhesion to COL1 is mainly mediated through {beta}1 integrin receptors, we next confirmed that PNT1A and PC-3 cells expressed similar levels of {beta}1 integrin (Fig. 2B). Preincubation with P4C10, a blocking antibody to {beta}1 integrin, hindered PNT1A and PC-3 cell adhesion to COL1 by 92 ± 5% (p < 0.002) and 92 ± 6% (p < 0.001), respectively (Fig. 2C). Residual cell adhesion after P4C10 treatment was similar in both cell lines.

Adhesion of PC-3 Cells to COL1 Decreases BRCA2 Protein Levels in a {beta}1 Integrin-dependent Manner—We asked whether cell adhesion to COL1 had any effect on BRCA2 protein levels. PNT1A cells transiently increased BRCA2 protein both on integrin-dependent (COL1) and -independent (PLL) adhesive substrates (Fig. 3A). Levels surged 4.5 ± 0.2-fold on PLL (p < 0.001) and 3.6 ± 0.2-fold on COL1 (p < 0.001) after 2 h and returned to basal levels after 6 h. In PC-3 cells, adhesion to PLL did not affect BRCA2 levels. However, adhesion to COL1 reduced BRCA2 levels by 75 ± 4% (p < 0.0001) after 3 h and completely depleted them after 4 h. BRCA2 protein levels did not recover after 12–15 h of cell adhesion (data not shown). To investigate whether this effect was directly linked to the interaction between COL1 and {beta}1 integrin, we set up similar experiments in which PNT1A and PC-3 cells were either preincubated with the {beta}1 integrin blocking antibody P4C10 or allowed to adhere to P4G11, a {beta}1 integrin-activating antibody (Fig. 3B). Cell adhesion to P4G11 (1 µg/ml) was similar to cell adhesion to COL1 (10 µg/ml) for both cell types (data not shown). After PC-3 cell adhesion to P4G11, BRCA2 levels decreased by 42 ± 5% at 2.5 h (p < 0.001) and became undetectable at 4 and 6 h. However, BRCA2 protein depletion was partly prevented by pretreating the cells with P4C10 before adhesion to COL1. Indeed, after 4 h, BRCA2 levels were 39 ± 6% of the basal levels at 0 h (p < 0.001). In PNT1A cells, adhesion to P4G11 or pretreatment with P4C10 did not change the pattern of BRCA2 protein expression observed on COL1.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 4.
BRCA2 protein undergoes ubiquitination and degradation in the proteasome in PC-3 cells. A, PNT1A and PC-3 cells were allowed to adhere to PLL or COL1 at 37 °C for 0, 2.5, or 6 h, washed, and processed for BRCA2 mRNA semi-quantitative RT-PCR. GAPDH mRNA RT-PCR was used as internal control. Results are representative of two independent experiments. B, PC-3 cells were allowed to adhere to COL1 at 37 °C for the indicated times in the presence of the translation inhibitor cycloheximide (12.5 µg/ml), the lysosomal inhibitor leupeptin (100 µM), the calpain inhibitor ALLN (10 µM), the proteasome inhibitor MG132 (10 µM), or the vehicle alone (Me2SO). Cell lysates were analyzed for the levels of BRCA2 protein by immunoblotting. Similar results were obtained from two independent experiments. C, PC-3 cells were allowed to adhere to COL1 in the presence of MG132 (10 µM) or the vehicle alone (Me2SO) for the indicated times before being lysed. Cell lysates were first immunoprecipitated (IP) with an antibody to BRCA2 and then immunoblotted (IB) with an antibody to ubiquitin. Similar results were obtained from two independent experiments.

 
BRCA2 Protein Undergoes Ubiquitination and Degradation in the Proteasome in PC-3 Cells—Because variations at the transcriptional level could provide an explanation for the changes in BRCA2 protein levels, we evaluated the eventual changes in mRNA levels upon PNT1A and PC-3 cell adhesion to COL1 or PLL (Fig. 4A). In PNT1A cells, BRCA2 mRNA increased 1.4- and 1.5-fold 2.5 h after adhesion to PLL and COL1, respectively, and remained elevated at 6 h. In PC-3 cells, although adhesion to PLL did not affect BRCA2 mRNA levels, adhesion to COL1 transiently abated BRCA2 mRNA to ~10% after 2.5 h and then to later increase to ~65% of basal levels after 6 h. However, the increase in mRNA 6 h after adhesion (Fig. 4A) did not result in an increase in BRCA2 protein (Fig. 3A). These results suggested that post-transcriptional mechanisms might be mainly responsible for BRCA2 protein depletion by COL1 in PC-3 cells.

We next proceeded to investigate whether de novo protein synthesis and/or protein degradation contributed to the reduction of BRCA2 protein levels in PC-3 cells after adhesion to COL1. Cycloheximide treatment of PC-3 cells did not prevent BRCA2 loss within 12 h of adhesion to COL1, indicating that de novo protein synthesis was not necessary for BRCA2 depletion (Fig. 4B). The involvement of lysosomal-, calpain-, and ubiquitin-proteasome-mediated proteolysis was investigated by measuring BRCA2 protein levels after allowing PC-3 cells to adhere to COL1 in the presence of the lysosomal inhibitor leupeptin, the calpain inhibitor ALLN, or the proteasome inhibitor MG132 (Fig. 4B). MG132 prevented BRCA2 depletion almost completely, with levels that were 89 ± 7% after 12 h of adhesion. Treatment of PC-3 cells with leupeptin failed to prevent BRCA2 depletion. Likewise, pretreatment with the lysosomal inhibitor pepstatin or the lysosomotropic agent NH4Cl yielded similar results (data not shown). ALLN had a minor effect in preventing BRCA2 depletion, with levels of 18 ± 4% after 12 h. Cell viability, as judged by trypan blue exclusion, was >98% in all the experiments, and cell incubation with the solvent Me2SO did not affect BRCA2 protein levels.



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 5.
COL1 enhances the PI 3-kinase activity in cancer cells. A and B, PNT1A and PC-3 cells were allowed to attach to PLL or COL1 at 37 °C for 0–6 h, washed, and lysed. B, PC-3 cells were preincubated with the {beta}1 integrin blocking antibody P4C10 (ascites 1:200) or 1C10 (ascites 1:200) as a negative control, before plating on COL1. Cell protein extracts (100 µg) were electrophoresed on 10% SDS-polyacrylamide gel under reducing conditions, and membranes were probed with anti-phospho-Ser-473 AKT antibody (P-AKT) or anti-AKT 1/2 antibody (AKT 1/2) as control, after stripping of the membrane. The blots are representative of three independent experiments. At the bottom of A, a quantification of AKT phosphorylation is reported as percentage of phosphorylation at 0 h of cell adhesion to PLL or COL1 (control), set at 100. Data are expressed as mean ± S.E.

 
To investigate whether BRCA2 is targeted for proteasome degradation through ubiquitination, we allowed PC-3 cells to adhere to COL1 in the presence of MG132 or solvent alone, and cell extracts were immunoprecipitated with an antibody to BRCA2, followed by Western blotting with an antibody against ubiquitin (Fig. 4C). Before adhesion (0 h), PC-3 cells showed minimal BRCA2 ubiquitination. After 3 h of adhesion to COL1, BRCA2 ubiquitination increased steadily at a pace that mirrored the reduction in BRCA2 protein levels seen in Fig. 3A. Treatment with MG132 further increased the levels of ubiquitinated BRCA2.

PI 3-Kinase Activation after PC-3 Cell Adhesion to COL1 Promotes BRCA2 Ubiquitination—Integrin engagement has been shown to trigger the activation of the PI 3-kinase signaling pathway (27, 28), which can modulate gene expression (23). Thus, we asked whether PI 3-kinase/AKT mediated the down-regulation of BRCA2 after PC-3 cell adhesion to COL1. The PI 3-kinase activity was measured by Western blotting with anti-phospho-Ser-473 AKT antibody following adhesion of PNT1A and PC-3 cells to COL1 or PLL (Fig. 5A). Both PNT1A and PC-3 cells showed basal AKT phosphorylation. Whereas PNT1A cells showed a modest decrease in PI 3-kinase activity 3 h after adhesion to PLL and no significant change after adhesion to COL1, PC-3 cells exhibited a 3.8-fold increase in AKT phosphorylation at 2 h of adhesion to COL1. These high levels remained unchanged throughout the 6 h of cell adhesion (Fig. 5A) and after 12 h of adhesion (data not shown). On the contrary, there was no change in AKT phosphorylation after PC-3 cell adhesion to PLL. The increase in AKT phosphorylation upon PC-3 cell adhesion to COL1 was dependent on {beta}1 integrin, as P4C10 pretreatment resulted in ~80% inhibition as compared with 1C10-treated cells (Fig. 5B). To investigate whether activation of the PI 3-kinase/AKT was involved in the down-regulation of BRCA2 expression, we determined the effect of PI 3-kinase inhibitors on BRCA2 protein levels. In PC-3 cells, inhibition of the PI 3-kinase activity through wortmannin (Fig. 6A) or LY294002 (data not shown) caused a 3.8-fold increase of BRCA2 expression after 2.5 h of adhesion to COL1 but had no significant effect in PNT1A cells. After 6 h, BRCA2 levels were slightly higher (~23%) than those observed before cell attachment (0 h). Treatment with wortmannin did not affect BRCA2 protein levels in PC-3 cells adherent to PLL. As expected, wortmannin or LY294002 significantly inhibited AKT phosphorylation both in PNT1A and PC-3 cells (data not shown). These results were further validated by transiently transfecting PC-3 cells with either a dominant negative ({Delta}p85) or a constitutively active (p110*) form of the PI 3-kinase before adhesion to COL1. Transfection with {Delta}p85 completely prevented BRCA2 protein degradation, with 97 ± 5% of starting levels at 12 h (Fig. 6B). Transfections with p110* (Fig. 6B) or a wild-type form of the p85{alpha} subunit of the PI 3-kinase (data not shown) did not affect BRCA2 depletion by COL1. Overall, these results provided compelling evidence that {beta}1 integrin signaling through PI 3-kinase/AKT mediated the depletion of BRCA2 protein after PC-3 cell adhesion to COL1. Transfection efficiency in all experiments was about 80–85% as evaluated by {beta}-galactosidase staining, and overexpression of the p110 or p85 variant forms was confirmed by immunoblotting with anti-p110 or anti-p85 antibody, respectively (data not shown).



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 6.
PI 3-kinase activation after PC-3 cell adhesion to COL1 promotes BRCA2 ubiquitination. A, PNT1A and PC-3 cells were pre-treated for 1 h at 37 °C with 0.1 µM wortmannin (WM), a PI 3-kinase inhibitor, or the solvent alone (Me2SO), and then allowed to adhere to PLL or COL1 at 37 °C for 0, 2.5, or 6 h, washed, lysed, and processed for immunoblotting (IB). Membranes were probed with anti-BRCA2 antibody. B and C, PNT1A and PC-3 cells were transiently transfected with empty vector (pcDNA3), dominant negative PI 3-kinase p85 subunit ({Delta}p85), or constitutively active PI 3-kinase p110 subunit (p110*). Thirty-six hours after transfection, the cells were allowed to adhere to COL1 at 37 °C for the indicated times in the presence or absence of the proteasome inhibitor MG132 (10 µM) or the solvent alone (Me2SO) and then lysed. Cell lysates were processed for immunoblotting with an antibody to BRCA2 (B) or first immunoprecipitated (IP) with an antibody to BRCA2 and then immunoblotted with a monoclonal antibody to ubiquitin or to BRCA2 (C). The blots are representative of two independent experiments.

 
To investigate whether the activation of the PI 3-kinase/AKT pathway after PC-3 cell adhesion to COL1 was directly linked to the ubiquitin-proteasome-mediated degradation of BRCA2, PC-3 cells were transiently transfected with empty vector, {Delta}p85, or p110* and allowed to adhere to COL1 in presence of the proteasome inhibitor MG132. After 12 h, cell extracts were immunoprecipitated with an antibody against BRCA2, followed by immunoblotting analysis with an antibody against ubiquitin (Fig. 6C). Upon treatment with MG132, mock-transfected cells showed BRCA2 ubiquitination consistent with the results reported in Fig. 4C. Transfections with {Delta}p85 resulted in 86% decrease in ubiquitinated BRCA2, whereas the constitutively active p110* increased BRCA2 ubiquitination by 32% when compared with mock-transfected cells. {Delta}p85 transfectants treated with MG132 showed lower BRCA2 ubiquitination than untreated cells.

Down-regulation of BRCA2 Expression by COL1 Increases DNA Synthesis in Prostate Cancer Cells—To investigate whether the ECM had any effect on prostate cell proliferation, we measured [3H]thymidine incorporation into DNA in PNT1A and PC-3 cells growing onto different substrates (Fig. 7A). PNT1A cells exhibited similar DNA synthesis when growing onto COL1 or PL, i.e. their own matrix, whereas adhesion to PLL decreased DNA synthesis by 39 ± 5% of the levels seen on PL (p < 0.03). On the contrary, COL1 stimulated PC-3 cell proliferation when compared with PL or PLL. We immediately posed the question whether the differences in DNA synthesis on COL1 were related to BRCA2 depletion in PC-3 cells. This was first addressed by small RNA interference assays. We transfected PC-3 cells with BRCA2 double-stranded RNA, which determined protein knock-down over 4 days. Forty-eight hours after siRNA transfection, the expression of BRCA2 was lowered by ~60% (Fig. 7B, bottom panel). At this point, PC-3 cells were allowed to adhere to COL1, and [3H]thymidine incorporation was measured. As shown in Fig. 7B, the levels of DNA synthesis increased by 54% (p < 0.002). These results suggested that BRCA2 expression levels were inversely correlated with DNA synthesis in PC-3 cells. This hypothesis was further validated by transfecting wild-type BRCA2 cDNA into PC-3 cells and measuring 36 h after transfection the [3H]thymidine incorporation upon 12 h of cell adhesion to PL, PLL, or COL1 in the presence or absence of MG132 (Fig. 7C). Mock-transfected PC-3 cells served as a control. Thirty six hours after transfection, BRCA2 protein levels increased ~2.2-fold and remained constant upon adhesion to PL (data not shown) or PLL but decreased by 39 ± 8% after adhesion to COL1 (p < 0.02) (Fig. 7C, top panel). Treatment of BRCA2 overexpressing cells with MG132 did not affect BRCA2 protein levels upon adhesion to PLL (data not shown) but resulted in a 210 ± 16% increase upon adhesion to COL1 (p < 0.001) (Fig. 7C, top panel). The expression of recombinant BRCA2 protein did not affect [3H]thymidine incorporation in PC-3 cells adherent to PL or PLL but completely abrogated the increase in DNA synthesis in response to adhesion to COL1 (Fig. 7C, bottom panel). Consistently, treatment with MG132 did not affect DNA synthesis in BRCA2-transfected cells adherent to PLL but decreased [3H]thymidine incorporation in control and BRCA2 transfectants adherent to COL1 by 46 and 57%, respectively (p < 0.003).

Inhibition of PI 3-Kinase/AKT Abrogates COL1-{beta}1 Integrin Stimulatory Effect on DNA Synthesis in PC-3 Cells—In order to establish whether a link exists between {beta}1 integrin, PI 3-kinase/AKT activation, and the increase in DNA synthesis after PC-3 cell adhesion to COL1, we measured [3H]thymidine incorporation in PNT1A and PC-3 cells either preincubated with P4C10 before adhesion to COL1 or allowed to adhere to P4G11 (Fig. 8A) and in cells allowed to adhere to COL1 for 12 h in the presence or absence of wortmannin (Fig. 8B). Blocking of {beta}1 integrin by P4C10 decreased by 27% the incorporation of [3H]thymidine in PC-3 cells (p < 0.01). Conversely, PC-3 cell adhesion to a {beta}1 integrin activating antibody stimulated by ~40% [3H]thymidine incorporation (p < 0.0001). Neither inhibition nor activation of {beta}1 integrin affected the proliferative response of PNT1A cells as compared with untreated cells. Inhibition of PI 3-kinase with wortmannin decreased [3H]thymidine incorporation in PC-3 cells by 46% (p < 0.001) but had no effect in PNT1A cells. This was further confirmed by transfections with {Delta}p85 dominant negative PI 3-kinase form, which decreased DNA synthesis in PC-3 cells adherent to COL1 by 36% (p < 0.001; Fig. 8C). Transfection with wt-p85 or p110* did not affect DNA synthesis.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 7.
Down-regulation of BRCA2 expression by COL1 increases DNA synthesis in prostate cancer cells. A, PNT1A and PC-3 cells were allowed to adhere to PL, PLL, or COL1 for 15 h and pulsed with 1 µCi/well methyl-[3H]thymidine during the last 3 h of the 15-h culture. Thereafter, the "hot" medium was washed out, the cells were lysed with SDS, and cell remnants were collected into scintillation tubes to measure incorporated radioactivity. B, PC-3 cells either transfected to express an interfering RNA for BRCA2 or treated with the transfection reagent alone, 48 h after transfection, were allowed to adhere to COL1 for 15 h, and pulsed with methyl-[3H]thymidine as described in A. At the bottom, BRCA2 protein knock-down was determined by immunoblotting 48 h after transfection. {beta}-Tubulin signals were used as loading controls. C, PC-3 cells were transfected to express the wild-type BRCA2 cDNA or the empty vector (pcDNA3), and 36 h after transfection, BRCA2 protein expression was determined by immunoblotting before (Control) and after 12 h of adhesion to PLL or to COL1 in the presence or absence of the proteasome inhibitor MG132 (10 µM). {beta}-Tubulin signals were used as loading controls. At the bottom, PC-3 cells transfected to express the wild-type BRCA2 cDNA (BRCA2 cDNA) or the empty vector (pcDNA3) 36 h after transfection were allowed to adhere to COL1 for 15 h in presence of MG132 (10 µM) or the solvent alone (Me2SO), and pulsed with methyl-[3H]thymidine as described in A. Data are expressed as mean ± S.E. of triplicate wells. A representative experiment of three is shown.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
We have uncovered evidence suggesting that ECM proteins enriched at metastatic bone sites have a stimulatory effect on prostate cancer cell proliferation. This proliferative effect is linked to BRCA2 protein depletion via {beta}1 integrin-dependent activation of the PI 3-kinase pathway, which promotes BRCA2 ubiquitination and degradation in the proteasome.

Prostate carcinoma has an exquisite tendency to metastasize to the bone with as many as 90% of patients with advanced disease suffering from osseous metastasis (38). The selective nature of this process is suggestive of a unique microenvironment that provides prostate cancer cells with the factors necessary to sustain metastatic capabilities. The non-mineral osseous ECM consists mostly of COL1, a protein that serves as a cell adhesive substrate through interaction with {alpha}1{beta}1, {alpha}2{beta}1, and {alpha}3{beta}1 integrins. Prior work has suggested that PC-3 cells, which are derived from a human bone metastasis (35), adhere to the collagenous component of the osseous matrix to a great extent through the {alpha}2{beta}1 integrin (20). We observed that PC-3 cells exhibited an increased adhesion to COL1 compared with the normal prostate cell line PNT1A. This property hinged on the presence of {beta}1 integrin as it was entirely prevented by a {beta}1 integrin blocking antibody. It has been postulated that elevated cell adhesion to COL1 may partly explain the osteotropism displayed by metastatic prostate tumor cells (20, 39). Interestingly, both normal and cancer cells displayed comparable amounts of {beta}1 integrin protein. Thus, it is conceivable that the different adhesive properties of PNT1A and PC-3 cells to COL1 could be because of the differential expression of specific {alpha} integrin subunits between the two cell types (40).

In addition to providing osteotropic properties to prostate cancer cells, we show for the first time that {beta}1 integrin-mediated adhesion to an ECM protein has a negative effect on BRCA2 protein levels. Although in normal cells the adhesion to PLL and COL1 elicits a transient increase in BRCA2 protein, PC-3 cells exhibit a complete loss of BRCA2 after adhesion to COL1 but not to PLL. A few hours after adhesion, there is a sizable decrease in BRCA2 mRNA levels, which should contribute at least initially to lowering BRCA2 protein levels. However, although mRNA recovers after 4 h to ~60% of resting levels, BRCA2 protein levels remain undetectable. Thus, it is fair to assume that transcriptional regulation is likely to play a minor role in the sustained BRCA2 protein depletion after adhesion to COL1. The mechanisms involved in the initial transcriptional down-regulation are presently unknown. It has been shown that p53 mediates repression of the BRCA2 promoter causing reduction of BRCA2 mRNA and protein levels in response to DNA damage (30). However, because the p53 gene is mutated in PC-3 cells (41), down-regulation of BRCA2 mRNA expression is likely to occur through a p53-independent mechanism. Furthermore, the reduction in BRCA2 protein levels after cancer cell adhesion to the ECM is not mediated exclusively by a COL1-{beta}1 integrin interaction, as other ECM proteins may have an analogous effect.2 A similar finding has been reported for BRCA1, a tumor suppressor gene functionally related to BRCA2 (42), after adhesion of breast carcinoma cells to laminin-1 and collagen type IV (43). Thus, it is conceivable that BRCA1 and BRCA2 proteins are at the cross-roads of abnormal cancer cell response to signaling from the extracellular environment.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 8.
Inhibition of PI 3-kinase/AKT abrogates COL1-{beta}1 integrin stimulatory effect on DNA synthesis in PC-3 cells. A, PNT1A and PC-3 cells preincubated for 1 h on ice in the presence or absence of the {beta}1 integrin blocking antibody P4C10 (ascites 1:200) or 1C10 monoclonal antibody (ascites 1:200), as a negative control, were allowed to adhere to COL1 or P4G11 for 15 h, and pulsed with 1 µCi/well methyl-[3H]thymidine during the last 3 h of the 15-h culture. Thereafter, the hot medium was washed out; the cells were lysed with SDS, and cell remnants were collected into scintillation tubes to measure incorporated radioactivity. B, PNT1A and PC-3 cells, pretreated for 1 h at 37 °C with 0.1 µM wortmannin (WM), a PI 3-kinase inhibitor, were allowed to adhere to COL1 for 15 h and pulsed with methyl-[3H]thymidine as described in A. C, PC-3 cells were transiently transfected with empty vector (pcDNA3), wild-type PI 3-kinase p85 subunit (wt-p85), dominant negative PI 3-kinase p85 subunit ({Delta}p85), or constitutively active PI 3-kinase p110 subunit (p110*). Thirty six hours after transfection, the cells were allowed to adhere to PLL or COL1 at 37 °C for 15 h and pulsed with methyl-[3H]thymidine as described in A. Data are expressed as mean ± S.E. of triplicate wells. A representative experiment of three is shown.

 
We proceeded to dissect the biological mechanisms involved in BRCA2 disappearance in response to PC-3 cell adhesion to COL1. It had been reported previously that the BRCA2 protein depletion that occurs after ultraviolet irradiation requires new protein synthesis (44). However, adhesion experiments in the presence of the translational inhibitor cycloheximide failed to prevent BRCA2 degradation, implicating a more conventional proteolytic process. Two major proteolytic systems exist in mammalian cells, the lysosomal and the non-lysosomal systems (45); our experiments excluded any involvement of the former in the COL1-mediated depletion of BRCA2 protein. Among the latter, calpain- and ubiquitin-mediated proteolysis were good candidates as they had been shown to be involved in the degradation of many regulatory proteins (29, 4648). As in other cell types (49), resting PC-3 cells exhibited basal levels of BRCA2 protein ubiquitination. However, these levels increased dramatically upon cancer cell adhesion to COL1 and increased even further after proteasome inhibition, thus providing circumstantial evidence that BRCA2 depletion under these conditions is associated with ubiquitin-proteasome degradation. The proteasome system has been shown to play a role in down-regulation of BRCA2 expression in response to mitomycin C-induced DNA damage (49) but not in ultraviolet irradiation-induced BRCA2 depletion (44), suggesting that the mechanisms of regulation of BRCA2 expression are complex and can vary in different physiopathological conditions. Calpain-mediated proteolysis of BRCA2 protein was observed in our conditions but to a much lesser extent than proteolysis mediated by the ubiquitin-proteasome system.

Ligation of {beta}1 integrins can activate both the mitogen-activated protein kinase/extracellular signal-regulated kinase and the PI 3-kinase/AKT signaling pathway (50, 51). In normal cells, the transient increase in BRCA2 expression after attachment to an adhesive substrate is accompanied by a transient increase in extracellular signal-regulated kinase phosphorylation.3 In contrast, PC-3 cell adhesion to COL1 triggers a conspicuous increase in AKT phosphorylation along with the decrease in BRCA2 levels. These two events were proven to be linked to each other in experiments whereby chemical inhibition of AKT phosphorylation with wortmannin or LY294002 or by transfection of a dominant negative form of PI 3-kinase prevented any ensuing BRCA2 protein degradation from happening. Transfection of a constitutively active form of PI 3-kinase had the opposite effect and promoted BRCA2 ubiquitination and degradation upon PC-3 cell adhesion to COL1. These experiments provide compelling evidence that the PI 3-kinase pathway promotes ubiquitination of BRCA2 protein in cancer cells, thus targeting it to the proteasome for proteolysis. Recent studies have shown that the PI 3-kinase/AKT pathway can control the expression of proteins such as tuberin, FOXO, p53, the androgen receptor, and insulin receptor substrate-1 through ubiquitination (5255). AKT has been shown to activate the ubiquitin ligase activity of murine double minute-2 that has been implicated in AKT-stimulated increase in p53 and androgen receptor degradation (53, 54, 56). However, the mechanism whereby PI 3-kinase/AKT targets substrates such as BRCA2 for ubiquitination remains to be investigated.

In normal prostate cells we did not find any consistent correlation between cell proliferation and the transient increase in BRCA2 expression resulting from attachment to an adhesive substrate. Adhesion to PLL diminishes the proliferative index, which could be rather attributed to the absence of specific mitogenic signals derived from the ECM (57). On the contrary, in cancer cells we demonstrate that BRCA2 protein degradation after adhesion to the ECM results in a conspicuous increase in DNA synthesis, an index of increased cell proliferation. This was corroborated by demonstrating that BRCA2 protein depletion after transfection with small interfering RNA did enhance DNA synthesis on COL1, and this effect was reversed by the expression of recombinant wild-type BRCA2 or by incubating the cells with a proteasome inhibitor. An increase in cell proliferation after PC-3 cell adhesion to COL1 had been noted in a previous report that showed an increase in the number of PC-3 cells after attachment to COL1 (39). Moreover, our findings are in line with previous reports showing down-regulation of BRCA2 mRNA expression during the proliferative expansion of a nodal marginal zone B-cell lymphoma (58), and inhibition of the neoplastic phenotype of a pancreatic cancer cell line once expressing wild-type BRCA2 (15).

A number of studies have implicated {beta}1 integrin, i.e. ECM receptors, in having a regulatory effect upon cell proliferation (50, 59, 60). Others have demonstrated that inhibition of the PI 3-kinase signaling pathway curtails PC-3 cell proliferation (61). Finally, it has been suggested that in vivo prostate cancer invasiveness is associated with increased AKT phosphorylation (6264). The results presented here suggest that BRCA2 may play a central role in bringing together these observations. BRCA2 also becomes a member of the list of growth inhibitory molecules that are regulated in cancer cells by the PI 3-kinase signaling cascade (61, 65) through the ubiquitin-proteasome proteolytic system (29, 66), which are susceptible to pharmacological manipulation by PI 3-kinase or proteasome inhibitors in anticancer therapy (6567).

Overall, our findings supports the contention that COL1 not only serves as a major adhesive substrate for prostate cancer cells but also provides a permissive substrate for enhanced cancer cell proliferation at metastatic osseous sites, a paramount event in the natural history of prostate carcinoma. Further elucidation of the regulatory mechanisms involved in BRCA2 expression by environmental signals will provide a better understanding of the molecular pathways that contribute to prostate cancer progression and metastasis.


    FOOTNOTES
 
* This work was supported by the MURST-PPRST Cluster 03 Grant and the MIUR-Contributi Straordinari di Ricerca/Aree Obiettivo 1 Grant (to E. M.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

To whom correspondence should be addressed: Institute of Biomembranes and Bioenergetics, National Research Council (Consiglio Nazionale delle Ricerche), Via Amendola 165/A, 70126 Bari, Italy. Tel.: 39-080-544-2412; Fax: 39-080-544-3317; E-mail: l.moro{at}ibbe.cnr.it.

1 The abbreviations used are: ECM, extracellular matrix; COL1, collagen type I; PI 3-kinase, phosphatidylinositol 3-kinase; PBS, phosphate-buffered saline solution; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PL, plastic; PLL, polylysine; Me2SO, dimethyl sulfoxide; BSA, bovine serum albumin; siRNA, small interference RNA; RT, reverse transcription. Back

2 L. Moro, A. A. Arbini, E. Marra, and M. Greco, manuscript in preparation. Back

3 L. Moro, A. A. Arbini, E. Marra, and M. Greco, unpublished data. Back


    ACKNOWLEDGMENTS
 
We are grateful to Dr. M. C. Hung for the BRCA2 cDNA and Dr. R. Freeman for the PI 3-kinase constructs.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Venkitaraman, A. R. (2002) Cell 108, 171-182[CrossRef][Medline] [Order article via Infotrieve]
  2. Liede, A., Karlan, B. Y., and Narod, S. A. (2004) J. Clin. Oncol. 22, 735-742[Abstract/Free Full Text]
  3. Tavtigian, S. V., Simard, J., Rommens, J., Couch, F., Shattuck-Eidens, D., Neuhausen, S., Merajver, S., Thorlacius, S., Offit, K., Stoppa-Lyonnet, D., Belanger, C., Bell, R., Berry, S., Bogden, R., Chen, Q., Davis, T., Dumont, M., Frye, C., Hattier, T., Jammulapati, S., Janecki, T., Jiang, P., Kehrer, R., Leblanc, J. F., Mitchell, J. T., McArthur-Morrison, J., Nguyen, K., Peng, Y., Samson, C., Schroeder, M., Snyder, S. C., Steele, L., Stringfellow, M., Stroup, C., Swedlund, B., Swensen, J., Teng, D., Thomas, A., Tran, T., Tranchant, T., Weaver-Feldhaus, J., Wong, A. K. C., Shizuya, H., Eyfjord, J. E., Cannon-Albright, L., Labrie, F., Skolnick, M. H., Weber, B., Kamb, A., and Goldgar, D. E. (1996) Nat. Genet. 12, 333-337[CrossRef][Medline] [Order article via Infotrieve]
  4. Simard, J., Dumont, M., Labuda, D., Sinnett, D., Meloche, C., El-Alfy, M., Berger, L., Lees, E., Labrie, F., and Tavtigian, S. V. (2003) Endocr. Relat. Cancer 10, 225-259[Abstract]
  5. Collins, N., McManus, R., Wooster, R., Mangion, J., Seal, S., Lakhani, S. R., Ormiston, W., Daly, P. A., Ford, D., Easton, D. F., and Stratton, M. R. (1995) Oncogene 10, 1673-1675[Medline] [Order article via Infotrieve]
  6. Gudmundsson, J., Johannesdottir, G., Bergthorsson, J. T., Arason, A., Ingvarsson, S., Egilsson, V., and Barkardottir, R. B. (1995) Cancer Res. 55, 4830-4832[Abstract/Free Full Text]
  7. Moynahan, M. E., Pierce, A. J., and Jasin, M. (2001) Mol. Cell 7, 263-272[CrossRef][Medline] [Order article via Infotrieve]
  8. Ludwig, T., Chapman, D. L., Papaioannou, V. E., and Efstratiadis, A. (1997) Genes Dev. 11, 1226-1241[Abstract/Free Full Text]
  9. Suzuki, A., de la Pompa, J. L., Hakem, R., Elia, A., Yoshida, R., Mo, R., Nishina, H., Chuang, T., Wakeham, A., Itie, A., Koo, W., Billia, P., Ho, A., Fukumoto, M., Hui, C. C., and Mak, T. W. (1997) Genes Dev. 11, 1242-1252[Abstract/Free Full Text]
  10. Sharan, S. K., Morimatsu, M., Albrecht, U., Lim, D. S., Regel, E., Dinh, C., Sands, A., Eichele, G., Hasty, P., and Bradley, A. (1997) Nature 386, 804-810[CrossRef][Medline] [Order article via Infotrieve]
  11. Connor, F., Bertwistle, D., Mee, P. J., Ross, G. M., Swift, S., Grigorieva, E., Tybulewicz, V. L., and Ashworth, A. (1997) Nat. Genet. 17, 423-430[CrossRef][Medline] [Order article via Infotrieve]
  12. Patel, K. J., Yu, V. P., Lee, H., Corcoran, A., Thistlethwaite, F. C., Evans, M. J., Colledge, W. H., Friedman, L. S., Ponder, B. A., and Venkitaraman, A. R. (1998) Mol. Cell 1, 347-357[CrossRef][Medline] [Order article via Infotrieve]
  13. Yu, V. P., Koehler, M., Steinlein, C., Schmid, M., Hanakahi, L. A., van Gool, A. J., West, S. C., and Venkitaraman, A. R. (2000) Genes Dev. 14, 1400-1406[Abstract/Free Full Text]
  14. Daniels, M. J., Wang, Y., Lee, M., and Venkitaraman, A. R. (2004) Science 306, 876-879[Abstract/Free Full Text]
  15. Wang, S. C., Shao, R., Pao, A. Y., Zhang, S., Hung, M. C., and Su, L. K. (2002) Cancer Res. 62, 1311-1314[Abstract/Free Full Text]
  16. Turner, N., Tutt, A., and Ashworth, A. (2004) Nat. Rev. Cancer 4, 814-819[CrossRef][Medline] [Order article via Infotrieve]
  17. Brothman, A. R. (2002) Am. J. Med. Genet. 115, 150-156[CrossRef][Medline] [Order article via Infotrieve]
  18. Hughes-Davies, L., Huntsman, D., Ruas, M., Fuks, F., Bye, J., Chin, S. F., Milner, J., Brown, L. A., Hsu, F., Gilks, B., Nielsen, T., Schulzer, M., Chia, S., Ragaz, J., Cahn, A., Linger, L., Ozdag, H., Cattaneo, E., Jordanova, E. S., Schuuring, E., Yu, D. S., Venkitaraman, A., Ponder, B., Doherty, A., Aparicio, S., Bentley, D., Theillet, C., Ponting, C. P., Caldas, C., and Kouzarides, T. (2003) Cell 115, 523-535[CrossRef][Medline] [Order article via Infotrieve]
  19. Guo, W., and Giancotti, F. G. (2004) Nat. Rev. Mol. Cell. Biol. 5, 816-826[CrossRef][Medline] [Order article via Infotrieve]
  20. Kostenuik, P. J., Sanchez-Sweatman, O., Orr, F. W., and Singh, G. (1996) Clin. Exp. Metastasis 14, 19-26[CrossRef][Medline] [Order article via Infotrieve]
  21. Zetter, B. R. (1990) N. Engl. J. Med. 322, 605-612[Medline] [Order article via Infotrieve]
  22. Green, J. (1994) Miner. Electrolyte Metab. 20, 7-15[Medline] [Order article via Infotrieve]
  23. Hynes, R. O. (1999) Trends Cell Biol. 9, M33-37[CrossRef][Medline] [Order article via Infotrieve]
  24. Hynes, R. O. (1992) Cell 69, 11-25[CrossRef][Medline] [Order article via Infotrieve]
  25. Juliano, R. (1996) BioEssays 18, 911-917[CrossRef][Medline] [Order article via Infotrieve]
  26. Wei, J., Shaw, L. M., and Mercurio, A. M. (1998) J. Biol. Chem. 273, 5903-5907[Abstract/Free Full Text]
  27. Shaw, L. M., Rabinovitz, I., Wang, H. H., Toker, A., and Mercurio, A. M. (1997) Cell 91, 949-960[CrossRef][Medline] [Order article via Infotrieve]
  28. Downward, J. (1998) Curr. Opin. Cell Biol. 10, 262-267[CrossRef][Medline] [Order article via Infotrieve]
  29. Moro, L., Perlino, E., Marra, E., Languino, L. R., and Greco, M. (2004) J. Biol. Chem. 279, 1692-1702[Abstract/Free Full Text]
  30. Wu, K., Jiang, S. W., and Couch, F. J. (2003) J. Biol. Chem. 278, 15652-15660[Abstract/Free Full Text]
  31. Laemmli, U. K. (1970) Nature 227, 680-685[CrossRef][Medline] [Order article via Infotrieve]
  32. Bruun, D., Folias, A., Akkari, Y., Cox, Y., Olson, S., and Moses, R. (2003) DNA Repair (Amst.) 2, 1007-1013[Medline] [Order article via Infotrieve]
  33. Manes, T., Zheng, D. Q., Tognin, S., Woodard, A. S., Marchisio, P. C., and Languino, L. R. (2003) J. Cell Biol. 161, 817-826[Abstract/Free Full Text]
  34. Degeorges, A., Hoffschir, F., Cussenot, O., Gauville, C., Le Duc, A., Dutrillaux, B., and Calvo, F. (1995) Int. J. Cancer 62, 724-731[Medline] [Order article via Infotrieve]
  35. Kaighn, M. E., Narayan, K. S., Ohnuki, Y., Lechner, J. F., and Jones, L. W. (1979) Investig. Urol. 17, 16-23[Medline] [Order article via Infotrieve]
  36. Ohnuki, Y., Marnell, M. M., Babcock, M. S., Lechner, J. F., and Kaighn, M. E. (1980) Cancer Res. 40, 524-534[Abstract/Free Full Text]
  37. Su, L. K., Wang, S. C., Qi, Y., Luo, W., Hung, M. C., and Lin, S. H. (1998) Oncogene 17, 2377-2381[CrossRef][Medline] [Order article via Infotrieve]
  38. Rubin, M. A., Putzi, M., Mucci, N., Smith, D. C., Wojno, K., Korenchuk, S., and Pienta, K. J. (2000) Clin. Cancer Res. 6, 1038-1045[Abstract/Free Full Text]
  39. Kiefer, J. A., and Farach-Carson, M. C. (2001) Matrix Biol. 20, 429-437[CrossRef][Medline] [Order article via Infotrieve]
  40. Haywood-Reid, P. L., Zipf, D. R., and Springer, W. R. (1997) Prostate 31, 1-8[CrossRef][Medline] [Order article via Infotrieve]
  41. Spurgers, K. B., Coombes, K. R., Meyn, R. E., Gold, D. L., Logothetis, C. J., Johnson, T. J., and McDonnell, T. J. (2004) Oncogene 23, 1712-1723[CrossRef][Medline] [Order article via Infotrieve]
  42. Kerr, P., and Ashworth, A. (2001) Curr. Biol. 11, R668-R676[CrossRef][Medline] [Order article via Infotrieve]
  43. Miralem, T., and Avraham, H. K. (2003) Mol. Cell. Biol. 23, 579-593[Abstract/Free Full Text]
  44. Wang, S. C., Makino, K., Su, L. K., Pao, A. Y., Kim, J. S., and Hung, M. C. (2001) Cancer Res. 61, 2838-2842[Abstract/Free Full Text]
  45. Ciechanover, A. (1994) Cell 79, 13-21[CrossRef][Medline] [Order article via Infotrieve]
  46. Hershko, A. (1997) Curr. Opin. Cell Biol. 9, 788-799[CrossRef][Medline] [Order article via Infotrieve]
  47. Bashir, T., and Pagano, M. (2003) Adv. Cancer Res. 88, 101-144[CrossRef][Medline] [Order article via Infotrieve]
  48. Perrin, B. J., and Huttenlocher, A. (2002) Int. J. Biochem. Cell Biol. 34, 722-725[CrossRef][Medline] [Order article via Infotrieve]
  49. Schoenfeld, A. R., Apgar, S., Dolios, G., Wang, R., and Aaronson, S. A. (2004) Mol. Cell. Biol. 24, 7444-7455[Abstract/Free Full Text]
  50. Fornaro, M., Steger, C. A., Bennett, A. M., Wu, J. J., and Languino, L. R. (2000) Mol. Biol. Cell 11, 2235-2249[Abstract/Free Full Text]
  51. Benaud, C. M., and Dickson, R. B. (2001) Oncogene 20, 759-768[CrossRef][Medline] [Order article via Infotrieve]
  52. Plas, D. R., and Thompson, C. B. (2003) J. Biol. Chem. 278, 12361-12366[Abstract/Free Full Text]
  53. Gottlieb, T. M., Leal, J. F., Seger, R., Taya, Y., and Oren, M. (2002) Oncogene 21, 1299-1303[CrossRef][Medline] [Order article via Infotrieve]
  54. Lin, H. K., Wang, L., Hu, Y. C., Altuwaijri, S., and Chang, C. (2002) EMBO J. 21, 4037-4048[CrossRef][Medline] [Order article via Infotrieve]
  55. Zhande, R., Mitchell, J. J., Wu, J., and Sun, X. J. (2002) Mol. Cell. Biol. 22, 1016-1026[Abstract/Free Full Text]
  56. Zhou, B. P., Liao, Y., Xia, W., Zou, Y., Spohn, B., and Hung, M. C. (2001) Nat. Cell Biol. 3, 973-982[CrossRef][Medline] [Order article via Infotrieve]
  57. Lee, J. W., and Juliano, R. (2004) Mol. Cell 17, 188-202
  58. Shin, M. S., Fredrickson, T. N., Hartley, J. W., Suzuki, T., Agaki, K., and Morse, H. C., III (2004) Cancer Res. 64, 4419-4427[Abstract/Free Full Text]
  59. Blaess, S., Graus-Porta, D., Belvindrah, R., Radakovits, R., Pons, S., Littlewood-Evans, A., Senften, M., Guo, H., Li, Y., Miner, J. H., Reichardt, L. F., and Muller, U. (2004) J. Neurosci. 24, 3402-3412[Abstract/Free Full Text]
  60. Hirsch, E., Barberis, L., Brancaccio, M., Azzolino, O., Xu, D., Kyriakis, J. M., Silengo, L., Giancotti, F. G., Tarone, G., Fassler, R., and Altruda, F. (2002) J. Cell Biol. 157, 481-492[Abstract/Free Full Text]
  61. Gao, N., Zhang, Z., Jiang, B. H., and Shi, X. (2003) Biochem. Biophys. Res. Commun. 310, 1124-1132[CrossRef][Medline] [Order article via Infotrieve]
  62. Paweletz, C. P., Charboneau, L., Bichsel, V. E., Simone, N. L., Chen, T., Gillespie, J. W., Emmert-Buck, M. R., Roth, M. J., Petricoin, I. E., and Liotta, L. A. (2001) Oncogene 20, 1981-1989[CrossRef][Medline] [Order article via Infotrieve]
  63. Kreisberg, J. I., Malik, S. N., Prihoda, T. J., Bedolla, R. G., Troyer, D. A., Kreisberg, S., and Ghosh, P. M. (2004) Cancer Res. 64, 5232-5236[Abstract/Free Full Text]
  64. Malik, S. N., Brattain, M., Ghosh, P. M., Troyer, D. A., Prihoda, T., Bedolla, R., and Kreisberg, J. I. (2002) Clin. Cancer Res. 8, 1168-1171[Abstract/Free Full Text]
  65. Chang, F., Lee, J. T., Navolanic, P. M., Steelman, L. S., Shelton, J. G., Blalock, W. L., Franklin, R. A., and McCubrey, J. A. (2003) Leukemia 17, 590-603[CrossRef][Medline] [Order article via Infotrieve]
  66. Almond, J. B., and Cohen, G. M. (2002) Leukemia 16, 433-443[CrossRef][Medline] [Order article via Infotrieve]
  67. Fresno Vara, J. A., Casado, E., de Castro, J., Cejas, P., Belda-Iniesta, C., and Gonzalez-Baron, M. (2004) Cancer Treat. Rev. 30, 193-204[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
L. Moro, A. A. Arbini, E. Marra, and M. Greco
Up-regulation of Skp2 after Prostate Cancer Cell Adhesion to Basement Membranes Results in BRCA2 Degradation and Cell Proliferation
J. Biol. Chem., August 4, 2006; 281(31): 22100 - 22107.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/23/22482    most recent
M414091200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moro, L.
Right arrow Articles by Greco, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moro, L.
Right arrow Articles by Greco, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement