Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M500130200 on April 15, 2005

J. Biol. Chem., Vol. 280, Issue 24, 22907-22916, June 17, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/24/22907    most recent
M500130200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tang, C.-H.
Right arrow Articles by Fu, W.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tang, C.-H.
Right arrow Articles by Fu, W.-M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Prostaglandin E2 Stimulates Fibronectin Expression through EP1 Receptor, Phospholipase C, Protein Kinase C{alpha}, and c-Src Pathway in Primary Cultured Rat Osteoblasts*

Chih-Hsin Tang{ddagger}, Rong-Sen Yang§, and Wen-Mei Fu{ddagger}||

From the Departments of {ddagger}Pharmacology and §Orthopaedics, College of Medicine, National Taiwan University, Taipei, Taiwan 100

Received for publication, January 5, 2005 , and in revised form, March 25, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Fibronectin (Fn) is involved in the early stages of bone formation, and prostaglandin E (PGE) is an important factor regulating osteogenesis. Here we found that PGE2 enhanced extracellular Fn assembly in rat primary osteoblasts, as shown by immunofluorescence staining and enzyme-linked immunosorbent assay. PGE2 also increased the protein levels of Fn by using Western blotting analysis. By using pharmacological inhibitors or activators or genetic inhibition by the EP receptor, antisense oligonucleotides revealed that the EP1 receptor but not other PGE receptors is involved in PGE2-mediated up-regulation of Fn. At the mechanistic level, Ca2+ chelator (1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid tetrakis(acetoxymethyl ester)), phosphatidylinositol-phospholipase C inhibitor (U73122 [GenBank] ), or Src inhibitor (PP2) attenuated the PGE2-induced Fn expression. Protein kinase C (PKC) inhibitor (GF109203X) also inhibited the potentiating action of PGE2. Furthermore, treatment with antisense oligonucleotides of various PKC isoforms, including {alpha}, {beta}, {epsilon}, and {delta}, demonstrated that {alpha} isozyme plays an important role in the enhancement action of PGE2 on Fn assembly. Flow cytometry and reverse transcription-PCR showed that PGE2 and 17-phenyl trinor PGE2 (EP1/EP3 agonist) increased the surface expression and mRNA level of {alpha}5 or {beta}1 integrins. Fn promoter activity was enhanced by PGE2 and 17-phenyl trinor PGE2 in cells transfected with pGL2F1900-Luc. Cotransfection with dominant negative mutants of PKC{alpha} or c-Src inhibited the potentiating action of PGE2 on Fn promoter activity. Local administration of PGE2 or 17-phenyl trinor PGE2 into the metaphysis of the tibia via the implantation of a needle cannula significantly increased the Fn and {alpha}5{beta}1 integrin immunostaining and bone volume of secondary spongiosa in tibia. Taken together, our results provided evidence that PGE2 increased Fn and promoted bone formation in rat osteoblasts via the EP1/phospholipase C/PKC{alpha}/c-Src signaling pathway.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The extracellular matrix (ECM)1 provides positional and environmental information that is essential for tissue function. The ECMs produced by osteoblasts are complex and consist of several different classes of molecules that may regulate the modeling and remodeling of bone. The ECMs also serve as a reservoir for growth factors, including members of the prostaglandins (PGEs) and fibroblast growth factor superfamily (1, 2). Acting either alone or together, these components of the ECM produced by osteoblasts may subsequently regulate the cell adhesion, migration, proliferation, differentiation, survival, as well as the rate of bone formation.

Fibronectin (Fn) is an extracellular matrix component that is also present as a soluble protein in plasma and other body fluids (3). The matrix form of Fn is believed to support cell adhesion and migration during embryogenesis, tumor growth, wound healing, angiogenesis, and inflammation (4). Assembly of soluble Fn into matrix is a multistep process under cellular control (5). Among the membrane components implicated in Fn matrix assembly, integrins have been demonstrated to have a central role (6). Integrins, composed of {alpha} and {beta} subunits, are a family of transmembrane receptors mediating adhesion to both ECM and cell surface molecules (7, 8). The specific adhesion depends on the interaction between the cell-binding domain of Fn and cell surface integrin receptors. However, the mechanisms regarding how integrins modulate Fn assembly are not well understood. Transfection of {alpha}5 integrin and expression of {alpha}5{beta}1 integrin by Chinese hamster ovary cells results in a large increase in Fn assembly, whereas {alpha}5-deficient Chinese hamster ovary B2 cells failed to assemble plasma Fn into the ECM (9, 10). Osteoblast differentiation is an essential part of bone formation, because active osteoblasts should be recruited at the site of osteoclastic bone resorption to compensate for the continuous loss of bone matrix and to maintain the structural integrity of the skeletal system. The biology of this process is also of considerable interest when applying therapies to promote bone repair after injury or during disease processes. Furthermore, integrins are involved in the signal transduction of translating the strain in the organic matrix to the biochemical signals in the bone cells (11). However, the role of cytokine in the cell-matrix interactions in osteoblasts has not been extensively studied.

PGEs are considered important local factors that modulate bone metabolism through their effects on osteoblastic cells and osteoclasts (12). PGE2 is a major eicosanoid produced by osteoblasts. To explain the diverse effects of PGE2, the presence of multiple receptors for PGE2 in osteoblasts was postulated. Recent cloning of four subtypes of PGE receptor has made it possible to analyze the PGE receptor subtypes (EP1–EP4) on osteoblasts (13, 14). EP1 is coupled to Ca2+ mobilization; EP2 and EP4 activate adenylate cyclase, and EP3 inhibits adenylate cyclase (15–17). An EP1 agonist stimulated cell growth, whereas an EP4 agonist reduced cell growth and increased alkaline phosphatase activity in MC3T3-E1 osteoblast-like cells (18). These studies indicate that osteoblasts express multiple subtypes of the PGE receptor and that each subtype might be linked to different actions of PGE2.

The distribution of Fn in areas of skeletogenesis suggests that it may be involved in early stages of bone formation (19). However, the effect of PGE2 on Fn fibrillogenesis in osteoblasts is mostly unknown. Here we found that PGE2 enhanced Fn fibrillogenesis of osteoblasts by increasing the synthesis and assembly of Fn. Furthermore, the increase of clustering of {alpha}5 and {beta}1 integrins is involved in the action mechanism of PGE2. EP1 receptor, PI-PLC, PKC{alpha}, and c-Src-dependent pathways may be involved in the increase of osteoblast Fn expression and bone formation by PGE2.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—Mouse monoclonal antibody for PKC{alpha} was purchased from BD Transduction Laboratories. Mouse monoclonal antibody for {alpha}-tubulin was purchased from Oncogene Science (Cambridge, MA). Protein-A/G beads, anti-mouse and anti-rabbit IgG-conjugated horseradish peroxidase, rabbit polyclonal antibodies specific for fibronectin, phosphotyrosine residues (PY20), and c-Src were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit polyclonal antibodies specific for {alpha}5, {beta}1, and {alpha}5{beta}1 integrin and type I collagen were purchased from Chemicon (Temecula, CA). PGE2, 17-phenyl trinor PGE2, butaprost, sulprostone, 11-deoxy-PGE1, and SC19220 were purchased from Cayman Chemical (Ann Arbor, MI). U73122 [GenBank] , U73343 [GenBank] , D609, and GF109203X were purchased from Calbiochem. Avidin-biotin-peroxidase detection system was purchased from Vector Laboratories. The fibronectin promoter construct (pGL2F1900-Luc) was a gift from Dr. I. S. Kim (Kyungpook National University, Korea). The PKC{alpha} dominant negative mutant was a gift from Dr. V. Martin (Louis Pasteur de Strasbourg University, France). The c-Src dominant negative mutant was a gift from Dr. S. Parsons (University of Virginia Health System, Charlottesville, VA). pSV-{beta}-galactosidase vector and luciferase assay kit were purchased from Promega (Madison, MA). All other chemicals were obtained from Sigma.

Primary Osteoblast Cultures—Primary osteoblastic cells were prepared by the method described previously (20). The calvaria of fetal rats were dissected from fetal rats, divided into small pieces, and then treated with 0.1% type I collagenase solution for 10 min at 37 °C. The next two 20-min sequential collagenase digestions were then pooled and filtered through 70-µm nylon filters (Falcon). The cells were grown on the plastic cell culture dishes in 95% air, 5% CO2 with {alpha}-minimum Eagle's medium (Invitrogen) that was supplemented with 20 mM HEPES and 10% heat-inactivated fetal calf serum, 2 mM-glutamine, penicillin (100 units/ml), and streptomycin (100 µg/ml) (pH adjusted to 7.6). The characteristics of osteoblasts were confirmed by morphology and the expression of alkaline phosphatase.

Immunocytochemistry—Osteoblasts were grown on glass coverslips. Cultures were rinsed once with phosphate-buffered saline (PBS) and fixed for 15 min at room temperature in phosphate buffer containing 4% paraformaldehyde. Cells were then rinsed three times with PBS. After blocking with 4% BSA for 15 min, cells were incubated with rabbit anti-rat Fn (1:1000) for 1 h at room temperature. Cells were then washed again and labeled with fluorescein isothiocyanate-conjugated goat anti-rabbit IgG (1:150, Leinco Technologies, St. Louis, MO) for 1 h. Finally, cells were washed, mounted, and examined with a Zeiss confocal microscope (LSM 410) as soon as possible. The mean fluorescence under 10–15 cells (3–5 fields per culture) was measured by using a Zeiss confocal microscope. The focus of the z axis was on the substratum of the monolayer cells. The value for contrast and offset adjustment of confocal microscope was fixed so that the variation of the relative fluorescence of control experiments was rather small.

Quantification of Extracellular Immobilized Fn by ELISA—The level of extracellular immobilized Fn was also determined by an enzymelinked immunosorbent assay (ELISA). After treatment with PGE2 at 37 °C, the cells were washed twice with PBS and fixed at room temperature with 1% paraformaldehyde for 30 min. After washing with PBS, the cultures were then blocked with 1% BSA in PBS for 15 min before being incubated sequentially with rabbit anti-rat Fn antibody (1:150) for 1 h and horseradish peroxidase-labeled anti-rabbit antibody (1: 1000) for 30 min. After each incubation, the cells were washed two times with PBS. o-Phenylenediamine dihydrochloride substrate (0.4 mg/ml in phosphate/citrate buffer, pH 5.0; 24.3 mM citric acid; 51.4 mM Na2HPO4·12 H2O; 12% H2O2 (v/v)) was then applied to the cells for 30 min, and 3 M sulfuric acid was added to stop the reaction. The absorbance was measured at 450 nm by an ELISA reader (Bio-Tek, Burlington, VA). Each assay was performed in triplicate.

Oligonucleotide (ODN) Transfection—Osteoblasts were cultured to confluence; the complete medium was replaced with Opti-MEM (Invitrogen) containing the antisense phosphorothioate oligonucleotides (5 µg/ml) that had been preincubated with Lipofectamine 2000 (10 µg/ml) (LF2000; Invitrogen) for 30 min. The cells were washed after 24 h of incubation at 37 °C and washed prior to the addition of medium containing PGE2. All antisense ODNs were synthesized and high pressure liquid chromatography-purified by MDBio (Taipei, Taiwan). The sequences used are as follows: EP1 AS-ODN, CTGCAGTTTCATTTCTCC, and MM-ODN, CGACAATTGAATTCATCT; EP2 AS-ODN, GCCTGGAGTCATTGA, and MM-ODN, CGCGTGAGTCTATGA; EP3 AS-ODN, ACACGCCGGCCATAGTGG, and MM-ODN, AGACCCCGCCGAGAGTGT; EP4 AS-ODN, GACTCCGGGGATGGA, and MM-ODN, GACCTCGGGAGTGAG (21, 22); PKC{alpha} AS-ODN, AAAACGTCAGCCATG; PKC{beta} AS-ODN, AAGATGGCTGACCCGGCTCGC; PKC{delta} AS-ODN, GTGCCATGATGGAGCCTTTT; and PKC{epsilon} AS-ODN, TTGAACACTACCATG (23).

mRNA Analysis by Reverse Transcription (RT)-PCR—Total RNA was extracted from osteoblasts using a TRIzol kit (MDBio Inc.). The reverse transcription reaction was performed using 2 µg of total RNA that was reverse-transcribed into cDNA using an oligo(dT) primer and then amplified for 33 cycles using two oligonucleotide primers as follows: EP1 (336 bp), CGCAGGGTTCACGCACACGA and CACTGTGCCGGGAACTACGC; EP2 (369 bp), CCGCGCGTGTACCTATTTCGC and GCTCCGAAGCTGCATGCGAA; EP3 (537 bp), GCCGGGAGAGCAAACGCAAAAA and ACACCAGGGCTTTGATGGTCGCCAGG; EP4 (423 bp), TTCCGCTCGTGGTGCGAGTGTTC and GAGGTGGTGTCTGCTTGGGTCAGGAPDH (452 bp) ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA (21, 22); {alpha}5 integrin (369 bp), GATGAGGAACAGTGAACCGAAGG and AGCAAAAGCAGGATAGAGGACAA; {beta}1 integrin (701 bp), GGAGGAATGTAACACGACTGC and CAGATGAACTGAAGGACCACC (24, 25). Each PCR cycle was carried out for 30 s at 94 °C, 30 s at 55 °C, and 1 min at 68 °C. PCR products were then separated electrophoretically in a 2% agarose DNA gel and stained with ethidium bromide.

Immunoprecipitation and Western Blot Analysis—The cellular lysates were prepared as described previously (20). Equal amounts of protein were incubated with specific antibody immobilized onto protein-A/G-Sepharose for 12 h at 4 °C with gentle rotation. Beads were washed extensively with lysis buffer, boiled, and microcentrifuged. Proteins were resolved on SDS-PAGE and transferred to Immobilon polyvinylidene difluoride membranes. The blots were blocked with 4% BSA for 1 h at room temperature and then probed with rabbit anti-rat antibodies against Fn (1:1500) or c-Src (1:1000) for 1 h at room temperature. After three washes, the blots were subsequently incubated with a donkey anti-rabbit peroxidase-conjugated secondary antibody (1:1000) for 1 h at room temperature. The blots were visualized by enhanced chemiluminescence using Kodak X-Omat LS film (Eastman Kodak Co.). For normalization purposes, the same blot was also probed with mouse anti-rat {alpha}-tubulin antibody (1:1000). Quantitative data were obtained by using a computing densitometer and ImageQuant software (Amersham Biosciences).

Determination of Cytosolic Ca2+ with Fluo-3-AM—Fluo-3-acetoxymethyl ester (fluo-3-AM) was used to measure cytosolic free Ca2+. Cells were incubated for 60 min in the dark at room temperature with fluo-3-AM (4 µM), and the cells were then washed, and cytosolic Ca2+ was measured by FACSCalibur (CellQuest software, BD Biosciences). Excitation and emission wavelengths were 488 and 530 nm, respectively.

Quantification of Integrin Expression—Osteoblasts were plated in 6-well (35-mm) dishes. The cells were then washed with PBS and detached with trypsin at 37 °C. Cells were fixed for 10 min in PBS containing 1% paraformaldehyde. After rinsing in PBS, the cells were incubated with rabbit anti-rat {alpha}5or {beta}1 integrin antibody (1:100) for 1 h at 4 °C. Cells were then washed again, incubated with fluorescein isothiocyanate-conjugated secondary IgG for 45 min, and analyzed by flow cytometry using FACSCalibur.

Transfection and Reporter Gene Assay—Osteoblasts were cotransfected with 1 µg of Fn promoter plasmid and 1 µg of {beta}-galactosidase expression vector. Osteoblasts were grown to 60% confluence in 12-well plates and were transfected the following day by LF2000, premixed DNA with OPTI-MEM, and LF2000 with OPTI-MEM, respectively, for 5 min. The mixture was then incubated for 25 min at room temperature and added to each well. After a 24-h incubation, transfection was complete, and the cells were incubated with the indicated agents. After 24 h of incubation, the media were removed, and cells were washed once with cold PBS. To prepare lysates, 100 µl of reporter lysis buffer (Promega, Madison, WI) was added to each well, and cells were scraped from dishes. The supernatant was collected after centrifugation at 13,000 rpm for 30 s. Aliquots of cell lysates (10 µl) containing equal amounts of protein (10–20 µg) were placed into wells of an opaque black 96-well microplate. An equal volume of luciferase substrate was added to all samples, and luminescence was measured in a microplate luminometer. The luciferase activity value was normalized to transfection efficiency monitored by the cotransfected {beta}-galactosidase expression vector. In experiments using dominant negative mutants, cells were cotransfected with reporter (0.5 µg) and {beta}-galactosidase (0.25 µg) and either the PKC{alpha} or c-Src mutant or the empty vector (1.0 µg).



View larger version (79K):
[in this window]
[in a new window]
  		FIG. 1.
Increase of Fn fibrillogenesis by PGE2 in cultured rat osteoblasts. Fn network, which was shown by immunofluorescence, formed underneath the cultured osteoblasts. Compared with control (A), treatment with PGE2 (3 µM) for 24 h increased Fn fibrillogenesis in cultured osteoblasts (B). Phase-contrast images are shown in the left panels. Bar = 10 µm. The mean fluorescence under 10–15 cells was measured using a Zeiss confocal microscope. Note that treatment with PGE2 (0.3–10 µM) for 24 h increased Fn fibrillogenesis. The quantitative data are shown in C (n = 18–25). Expression of extracellular Fn was also measured by ELISA. Treatment with PGE2 (0.3–10 µM) for 24 h increased Fn expression in a concentration-dependent manner (D). Osteoblast cultures were treated with different concentrations of PGE2 for 24 h. The cultures were then washed with cold PBS, and protein samples for Western blotting analysis were collected by the direct addition of lysis buffer to cultures without trypsin digestion. Compared with control (Con), PGE2 (3 µM) increased the protein levels of Fn in a concentration-(E) and time (F)-dependent manner. Data are presented as mean ± S.E. *, p ≤ 0.05 as compared with control (n = 3).

 



View larger version (46K):
[in this window]
[in a new window]
  		FIG. 2.
Up-regulation of Fn expression by PGE2 acting through EP1 receptor in primary rat osteoblast. Total RNA was extracted from primary rat osteoblastic cells, and subjected to RT-PCR for EP1, EP2, EP3, and EP4 mRNAs using the respective primers. Note that primary rat osteoblasts express EP1–EP4 receptor mRNA, and EP1 mRNA increased in response to PGE2 (3 µM) application for 6 h(A). Osteoblasts were transfected with EP receptor AS-ODN or MM-ODN for 24 h followed by incubation with PGE2 for 6 and 24 h to analyze the mRNA and protein expression, respectively. Total protein and RNA were isolated, and the expressions of Fn and EP receptors were analyzed by Western blotting (WB) and RT-PCR (RT) (B). Results are representative of at least three independent experiments. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

 
Measurement of Bone Mineral Density (BMD) and Bone Volume—The local injection of young rats was prepared by the method described previously (23). Male Sprague-Dawley rats weighing 73–88 g were used. Implantation of a cannula (22-gauge) was done from the posterolateral side into the proximal tibial metaphysis in both limbs of rats anesthetized with trichloroacetaldehyde. The cannula had its outer end in the subcutaneous tissue. PGE2 or 17-phenyl trinor PGE2 (30 µM, 10 µl) was percutaneously injected into the proximal tibia through the cannula (once/day) for 7 consecutive days. The same volume of vehicle was injected into the contralateral side for comparison. On day 14, the rats were sacrificed, and the tibiae were also removed and cleaned of soft tissue. BMD and BMC of the tibia were measured with a dual-energy x-ray absorptiometer (DEXA, XR-26; Norland, Fort Atkinson, WI). The mode adapted to the measurements of small subjects was adopted. A coefficient of variation of 0.7% was calculated from daily measurements of BMD on a lumbar phantom for more than 1 year. The whole tibiae were scanned, and BMD and BMC were measured by absorptiometer. At the end of the program, the tibia was fixed, decalcified, and embedded in paraffin. Serial sections (5 µm) were cut longitudinally, and endogenous peroxidase activity was inactivated by treatment with 3% H2O2 in methanol for 20 min. The sections were then treated with normal goat serum to block nonspecific binding, followed by incubation with rabbit anti-rat Fn, {alpha}5{beta}1 integrin, and type I collagen antibody (1:300) overnight at 4 °C. The sections were detected by avidin-biotin-peroxidase detection system and diaminobenzidine. For measurement of bone volume, the sections were stained with Mayer's hematoxylin and eosin solution. Images of the growth plate and proximal tibia were photographed by using an Olympus microscope IX70. Measurement of bone volume was performed on the secondary spongiosa, which is located 1.0–3.0 mm distal to epiphyseal growth plate and is characterized by a network of larger trabeculae. Bone volume was calculated using image analysis software (Image-Pro Plus 3.0) and expressed as percent of bone area. All measurements were done in a single-blind fashion. All protocols complied with institutional guidelines and were approved by Animal Care Committee of Medical College, National Taiwan University.



View larger version (48K):
[in this window]
[in a new window]
  		FIG. 3.
EP1 and Ca2+ are involved in PGE2-mediated increase of Fn expression. A, osteoblast cultures were treated with PGE2 (3 µM), 17-phenyl trinor PGE2 (3 µM), butaprost (10 µM), sulprostone (10 µM), 11-deoxy-PGE1 (10 µM), and SC 19220 (10 µM) for 24 h. Cells were lysed for the immunoblotting of Fn or {alpha}-tubulin. B, cells were transfected with AS-ODN for 24 h followed by incubation with sulprostone for 24 h to analyze the protein level of Fn by Western blotting. Note that sulprostone did not increase Fn expression unless at a higher concentration of 20 µM, which is inhibited by EP1 AS-ODN. C, cells were pretreated for 30 min with the intracellular free calcium chelator, BAPTA-AM (0.1–10 µM), and then stimulated with PGE2 (3 µM) for 24 h. Cells were then lysed, and the protein samples were obtained for Western blotting analysis. The quantitative data are shown in the lower panels (n = 3). D, cells were detached and labeled with Fluo-3-AM, and then the change of [Ca2+]i was analyzed on a flow cytometer. The arrow indicates the point at which drugs were applied to the cells. The data points represent the means ± S.E. of at least three independent experiments. E, treatment with PGE2 (3 µM) and 17-phenyl trinor PGE2 (0.3–3 µM) increased extracellular Fn expression. Osteoblasts were then transfected with AS-ODN and MM-ODN for 24 h or treated with SC19220 (10 µM) or BAPTA-AM (10 µM) for 30 min followed by incubation with PGE2 for 24 h to analyze the extracellular Fn by ELISA. Results are expressed as the mean ± S.E. of three independent experiments performed in triplicate. *, p ≤ 0.05 as compared with control; #, p < 0.05 as compared with PGE2-treated group.

 
Statistics—The values given are means ± S.E. The significance of difference between the experimental groups and controls was assessed by Student's t test. The difference is significant if the p value was <0.05.



View larger version (34K):
[in this window]
[in a new window]
  		FIG. 4.
Involvement of PI-PLC in the potentiating action of PGE2 on Fn expression. Osteoblasts were pretreated with U73122 [GenBank] (1 and 3 µM), U73343 [GenBank] (30 µM), and D609 (30 µM) for 30 min followed by stimulation with PGE2 for 24 h, and Fn expression was determined by immunoblotting with an antibody specific for Fn. The lower panel shows the results of three independent experiments (mean ± S.E.). *, p ≤ 0.05 as compared with control; #, p < 0.05 as compared with PGE2-treated group.

 

   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
PGE2 Enhanced Fn Fibrillogenesis in Cultured Osteoblasts— The fibrillogenesis from the endogenously released Fn by the primary cultured rat osteoblasts was studied using immunocytochemistry. Day 3–5 osteoblasts were changed to serum-free medium and incubated with PGE2 (3 µM) for 24 h. Immunostaining of Fn was examined in 4% paraformaldehyde-fixed and nonpermeabilized cells. The mean immunofluorescence intensity underneath a cell group of 10–15 cells was measured using a confocal microscope. As shown in Fig. 1A, osteoblasts are able to form Fn network underneath the cell using endogenously released Fn. Fn fibril formation increased in response to the treatment of PGE2 for 24 h (Fig. 1B). The quantitative data showed a dose-dependent increase of fluorescence intensity (Fig. 1C). We also used ELISA to detect extracellular immobilized Fn. PGE2 also increased Fn expression in a concentration-dependent manner (Fig. 1D). Western blotting was used to examine the effect of PGE2 on the protein levels of Fn. Day 3–5 osteoblasts were changed to serum-free culture medium and treated with PGE2 for 24 h. The cultures were then washed with cold PBS, and protein samples were collected by the addition of lysis buffer without trypsin digestion. The result from Western blotting may contain both soluble cytosolic Fn and extracellular immobilized Fn. As shown in Fig. 1, E and F (PGE2 at 3 µM), PGE2 increased protein levels of Fn in a concentration- and time-dependent manner.

Involvement of EP1 Receptors in PGE2-mediated Increase of Fn Formation—PGEs exert their effects through interaction with specific EP1–4 receptors (14). To investigate the role of EP1–4 subtype receptors in PGE2-mediated increase of Fn formation, we assessed the distribution of these EP subtype receptors in rat primary osteoblasts by RT-PCR analysis. The mRNAs of EP1, EP2, EP3, and EP4 subtype receptors could be detected in primary rat osteoblasts (Fig. 2A). After PGE2 treatment for 6 h, the mRNA level of EP1 subtype receptor was evidently increased, whereas other subtype EP receptor mRNAs remained unchanged (Fig. 2A). We next examined which EP subtype receptors were involved in the PGE2-mediated increase of Fn formation, and specific inhibition of EP1 receptor expression was accomplished with AS-ODN. It was found that EP1 receptor-specific AS-ODN but not other EP receptor AS-ODN or MM-ODN significantly blocked the PGE2-mediated increase of Fn formation in primary rat osteoblasts (Fig. 2B). To determine the role of EP1 receptor-dependent signaling in the regulation of Fn expression in osteoblasts, the cells were treated with EP1–4-specific agonists, and then the expression level of Fn was examined. Of the agonists tested, only the EP1/EP3-selective receptor agonist, 17-phenyl trinor PGE2 (3 µM), significantly increased the protein level of Fn (Fig. 3A). In contrast, butaprost (EP2 agonist; 10 µM), sulprostone (EP3 agonist; 10 µM), and 11-deoxy-PGE1 (EP2/EP4-selective agonist; 10 µM) failed to up-regulate Fn expression. In addition, treatment of EP1 receptor antagonist SC19220 (10 µM) effectively antagonized the potentiating effect of PGE2 on Fn expression (Fig. 3A). It has been reported that sulprostone also acts on the rat EP1 receptor (26). We then examined the concentration-dependent effect of sulprostone on the expression of Fn. Treatment of osteoblast with sulprostone did not increase the protein level of Fn unless at a higher concentration of 20 µM. Pretreatment of osteoblasts with EP1 AS-ODN but not EP3 AS-ODN antagonized the potentiating action of 20 µM sulprostone (Fig. 3B). The results shown above using pharmacological treatment or genetic inhibition clearly demonstrated a critical role for the EP1 receptor in the PGE2-mediated increase of Fn formation. It has been reported that activation of EP1 augments intracellular calcium mobilization, which is related to downstream signals (15). We then investigated the effect of chelating intracellular Ca2+ on the potentiating action of PGE2 on Fn expression. Pretreatment with BAPTA-AM (0.1–10 µM) for 30 min significantly abrogated PGE2-induced Fn formation (Fig. 3C). The quantitative data are shown in Fig. 3C, lower panels. Flow cytometry was used to investigate the effect of PGE2 on the change of intracellular Ca2+ concentration. As shown in Fig. 3D, incubation with PGE2 (3 µM), 17-phenyl trinor PGE2 (3 µM), and sulprostone (20 µM) enhanced the fluorescence intensity of fluo-3. However, sulprostone at 10 µM only slightly increased the intracellular Ca2+ concentration. ELISA detection also showed that pretreatment of osteoblasts with the EP1 AS-ODN, SC19220, and BAPTA-AM but not AS-ODN of EP2–EP4 or any MM-ODN antagonized the potentiating effect of PGE2 (Fig. 3E).



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 5.
PKC{alpha} isoform is involved in the potentiation of Fn expression by PGE2. A, osteoblasts were pretreated with the PKC inhibitor GF109203X (1–10 µM) for 30 min followed by stimulation with PGE2 for 24 h, and Fn expression was determined by immunoblotting with an antibody specific for Fn. The quantitative data are shown in the lower panel. B, osteoblasts were transfected with AS-ODN directed against different isoforms of PKC for 48 h followed by incubation with PGE2 for 24 h and then subjected to the analysis of the extracellular Fn by ELISA. C, treatment of osteoblasts cells with PGE2 (3 µM) for 10 or 15 min decreased cytosolic and increased membrane translocation of PKC{alpha}. Cells were incubated with SC19220 (10 µM) or U73122 [GenBank] (3 µM) for 30 min followed by stimulation with PGE2 for 15 min, and cell lysates were then immunoblotted with an antibody specific for PKC{alpha}. Results are expressed as the mean ± S.E. of three independent experiments. *, p ≤ 0.05 as compared with control; #, p < 0.05 as compared with PGE2-treated group.

 



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 6.
c-Src is involved in PGE2-induced Fn expression. A, osteoblasts were pretreated with Src inhibitor PP2 (1–10 µM) for 30 min followed by stimulation with PGE2 for 24 h, and Fn expression was determined by immunoblotting with an antibody specific for Fn. The quantitative data are shown in the lower panel. B, osteoblasts were incubated with SC19220 (10 µM), U73122 [GenBank] (3 µM), GF109203X (10 µM), and PP2 (10 µM) for 30 min followed by stimulation with PGE2 for 15 min, and cell lysates were then immunoprecipitated (IP) with an antibody specific for c-Src. Con, control. Immunoprecipitated proteins were separated by SDS-PAGE and immunoblotted (WB) with anti-phosphotyrosine (PY). C, osteoblasts were preincubated with SC19220 (10 µM), U73122 [GenBank] (3 µM), GF109203X (10 µM), and PP2 (10 µM) for 30 min followed by incubation with PGE2 for 24 h to analyze the extracellular Fn by ELISA. Results are expressed as the mean ± S.E. of three independent experiments. *, p ≤ 0.05 as compared with control; #, p < 0.05 as compared with PGE2-treated group.

 
The Signaling Pathways of PI-PLC, PKC, and c-Src Are Involved in the Potentiating Action of PGE2—To study the intracellular signaling pathway involved in PGE2-induced Fn expression, osteoblasts were pretreated for 30 min with the PI-PLC inhibitor U73122 [GenBank] (1 and 3 µM). It was found that U73122 [GenBank] but not the inactive analogue of U73122 [GenBank] , U73343 [GenBank] (30 µM), or PC-PLC inhibitor D609 (30 µM) antagonized the potentiating effect of PGE2. Furthermore, U73122 [GenBank] , U73343 [GenBank] , and D609 had no effect on the basal level of Fn expression (Fig. 4). The quantitative data are shown in Fig. 4, lower panels. Because PGE2-induced Fn expression was inhibited by U73122 [GenBank] , the involvement of the PI-PLC pathway, which increases diacylglycerol levels leading to the activation of PKC, was indicated. The PKC inhibitor GF109203X was thus used to examine whether PKC is involved in the action of PGE2. Pretreatment with GF109203X (1–10 µM) concentration-dependently inhibited the enhancement effect of PGE2 (Fig. 5A). PKC isozymes, including {alpha}, {beta}, {epsilon}, and {delta}, have been identified in osteoblasts (27). To examine which PKC isoforms are involved in the potentiation of Fn fibrillogenesis by PGE2, isoform-specific AS-ODN was used (23). It was demonstrated that treatment with AS-ODN of the PKC isoform {alpha} but not {beta}, {epsilon}, and {delta} antagonized the potentiating action of PGE2 using ELISA analysis (Fig. 5B). We also directly measured the PKC{alpha} translocation in response to PGE2. Incubation of osteoblasts with PGE2 (3 µM) for 10 or 15 min increased membrane translocation of PKC{alpha}. Pretreatment of osteoblasts for 30 min with SC19220 (10 µM) or U73122 [GenBank] (3 µM) markedly attenuated the PGE2-induced PKC{alpha} translocation (Fig. 5C). We then investigated the role of Src in mediating PGE2-induced Fn expression using the specific Src inhibitor PP2. As shown in Fig. 6A, PGE2-induced Fn expression was markedly attenuated by pretreatment of cells for 30 min with PP2 (1–10 µM) in a concentration-dependent manner. To confirm directly the crucial role of Src in Fn expression, we measured the level of Src phosphorylation in response to PGE2. As shown in Fig. 6B, treatment of osteoblasts with PGE2 (3 µM) for 15 min increased c-Src activity, as assessed by immunoblotting samples for phosphotyrosine immunoprecipitated from lysates using c-Src (Fig. 6B). To determine the relationship among the EP1 receptor, PLC, PKC, and Src in the PGE2-mediated signaling pathway, we found that pretreatment of cells for 30 min with SC19220 (10 µM), U73122 [GenBank] (3 µM), GF109203X (10 µM), and PP2 (10 µM) markedly inhibited the PGE2-induced c-Src activity (Fig. 6B). ELISA measurements also showed that pretreatment of osteoblasts with the U73122 [GenBank] (3 µM), GF109203X (10 µM), and PP2 (10 µM) but not U73343 [GenBank] (30 µM) or D609 (30 µM) antagonized the Fn up-regulation effect of PGE2 (Fig. 6C). Based on these results, it appears that PGE2 acts through EP1 receptor, PLC, PKC, and c-Src-dependent signaling pathway to enhance Fn fibrillogenesis in osteoblasts.



View larger version (45K):
[in this window]
[in a new window]
  		FIG. 7.
Increase of the cell surface expression of {alpha}5 and {beta}1 integrins by PGE2. Compared with control, treatment with PGE2 (3 µM) for 24 h significantly enhanced the fluorescence intensity of {alpha}5 and {beta}1 integrins using flow cytometric analysis (A). Osteoblasts were pretreated with SC19220 (10 µM), U73122 [GenBank] (3 µM), GF109203X (10 µM), and PP2 (10 µM) for 30 min followed by incubation with PGE2 for 24 h, and the cell surface expression of integrins was analyzed by flow cytometry. The quantitative data are shown in B. Data are presented as mean ± S.E. (n = 4). Osteoblasts were transfected with the EP receptor AS-ODN (C) for 24 h or treated with U73122 [GenBank] (3 µM), GF109203X (10 µM), and PP2 (10 µM) (D) for 30 min followed by incubation with PGE2 for 6 h, and the mRNA for {alpha}5 and {beta}1 integrins were analyzed by RT-PCR. Results are representative of at least three independent experiments. GAPDH, glyceraldehyde-3-phosphate dehydrogenase. *, p < 0.05 as compared with control; #, p < 0.05 as compared with PGE2-treated group.

 
Effect of PGE2 on the Distribution of Integrin—The assembly of extracellular Fn matrix underneath the cells may be related to integrins (9). Integrins are a family of heterodimeric transmembrane receptors containing {alpha} and {beta} subunits. The different combination of {alpha} and {beta} chains forms different receptors for various kinds of ECM molecules. {alpha}5{beta}1 integrin is a specific receptor for Fn. Flow cytometry was used to investigate the effect of PGE2 on the cell surface expression of integrins. As shown in Fig. 7A, incubation with PGE2 (3 µM) for 24 h significantly enhanced the fluorescence intensity of {alpha}5 and {beta}1 integrins. The increase of cell surface expression of integrins by PGE2 was antagonized by SC19220 (10 µM), U73122 [GenBank] (3 µM), GF109203X (10 µM), and PP2 (10 µM). We thus examined the effect of PGE2 on the mRNA levels of {alpha}5 and {beta}1 integrins. Cells treated with PGE2 (3 µM) for 6 h increased the mRNA expression of {alpha}5 and {beta}1 integrins, which was antagonized by pretreatment of EP1 AS-ODN but not by AS-ODN of EP2–EP4 (Fig. 7C). The increase of mRNA expression of integrins by PGE2 was also antagonized by SC19220 (10 µM), U73122 [GenBank] (3 µM), GF109203X (10 µM), and PP2 (10 µM) (Fig. 7D).

Increase of Fn Promoter Activity by PGE2—To study further the involvement of the EP1 receptor, PI-PLC, PKC, and c-Src-dependent pathway in the action of PGE2-induced Fn expression, transient transfection was performed using the rat Fn promoter-luciferase constructs, pGL2F1900-Luc, which contain the rat FN gene between positions –1908 and +136 fused to the luciferase reporter gene. Osteoblasts incubated with PGE2 (3 µM) led to a 3.8-fold increase in Fn promoter activity. The increase of Fn activity by PGE2 was antagonized by SC19220 (10 µM), U73122 [GenBank] (3 µM), GF109203X (10 µM), and PP2 (10 µM) (Fig. 8A). In cotransfection experiments, the increase of Fn promoter activity by PGE2 was inhibited by EP1 AS-ODN, but not by AS-ODN of EP2–EP4 (Fig. 8B). Increase of Fn promoter activity by PGE2 was also inhibited by the dominant negative mutants of PKC{alpha} and c-Src (Fig. 8C). Taken together, these data suggest that the activation of EP1/PI-PLC/PKC{alpha}/c-Src pathway is required for the increase of Fn by PGE2 in rat osteoblasts.



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 8.
PI-PLC-PKC-c-Src signaling pathway mediated the increase of Fn promoter activity by PGE2. The Fn promoter activity was evaluated by transfection with the pGL2F1900 luciferase expression vector as described under "Experimental Procedures." Osteoblasts were pretreated with vehicle, SC19220 (10 µM), U73122 [GenBank] (3 µM), GF109203X (10 µM), and PP2 (10 µM) for 30 min before incubation for 24 h with PGE2 (3 µM) (A). Cells were cotransfected with pGL2F1900 and AS-ODN of EP1 – EP4 (B), or the PKC{alpha}, c-Src mutant, or the respective empty vector (C), and then treated for 24 h with PGE2 (3 µM). Luciferase activity was then measured, and the results were normalized to the {beta}-galactosidase activity and expressed as the mean ± S.E. for three independent experiments performed in triplicate. *, p ≤ 0.05 as compared with control; #, p < 0.05 as compared with PGE2-treated group.

 
PGE2 Enhanced Fn Formation and Bone Volume of Tibia in Young Rat—Trabecular bone is composed of a lattice or network of branching bone spicules. The spaces between the bone spicules contain bone marrow. PGE2 and 17-phenyl trinor PGE2 (30 µM, 10 µl, once per day) were locally administered into tibia for 7 consecutive days via the implantation of a needle cannula (22-gauge) in young rats weighing 73–88 g, and the rats were sacrificed later on day 14. The vehicle was injected into the contralateral side for comparison. Compared with the vehicle-injected side (Fig. 9A, arrow, shows the hole of the injection site), PGE2 and 17-phenyl trinor PGE2 significantly increased the bone volume of the secondary spongiosa (Fig. 9A). Trabecular bone in the secondary spongiosa increased by 91.3 and 81.7% after local administration of PGE2 and 17-phenyl trinor PGE2. The immunohistochemistry also showed that Fn and {alpha}5{beta}1 integrin predominantly localized around the trabecular bone. Long term administration of PGE2 and 17-phenyl trinor PGE2 increased the staining of Fn, {alpha}5{beta}1 integrin, and type I collagen (Fig. 9, B–D). In addition, BMD and BMC increased after application of PGE2 and 17-phenyl trinor PGE2 (Table I).


View this table:
[in this window]
[in a new window]
  		TABLE I
Effect of PGE2 and 17-phenyl trinor PGE2 on the bone mineral density, bone mineral content and bone volume in tibia

PGE2 and 17-phenyl trinor PGE2 (30 µM, 10 µl, once/day) were locally administered into the tibia by a needle cannula in the proximal tibia for 1 week. Vehicle was injected into the contralateral side for comparison. Rats were sacrificed, and the tibiae were used for analysis 7 days after the last injection. The abbreviation used is as follows: BV/TV, bone volume/tissue volume.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
PGEs are among the most potent regulators of bone cell function (28). It is generally accepted that prostaglandins are mediators in bone metabolism. Among the various prostaglandins, PGE2 is the most important in bone formation and resorption. In a recent study, Mo et al. (29) demonstrated that PGE2 treatment increases trabecular bone mass in rats. Extensive studies have demonstrated that PGE2 has both anabolic and catabolic effects on osteoblasts. The results from this study provide evidence that PGE2 also regulates Fn fibrillogenesis in cultured rat osteoblasts. In the present study, immunocytochemistry, ELISA, and Western blotting analysis were used to investigate the effect of PGE2 on Fn assembly. The Fn network is an important factor for the differentiation, expression of physiological function, and survival of osteoblasts (30). Here we further identify Fn as a target protein for the PGE2 signaling pathway that regulates cell survival and differentiation. We also show that potentiation of Fn fibrillogenesis by PGE2 requires an activation of the EP1 receptor, PI-PLC, PKC{alpha}, and c-Src signaling pathway.

PGE2 stimulated Fn fibrillogenesis in a concentration-dependent manner as detected by immunocytochemistry and ELISA. Furthermore, PGE2 increased the protein levels of Fn as demonstrated by Western blotting analysis. PGEs, acting through different cell surface receptors on osteoblastic cells, stimulate bone remodeling by promoting both anabolic and catabolic responses, the relative responses being dependent on the target cell population and the concentration of PGE2. However, we demonstrate that the EP1 but not other EP receptors was required for PGE2-induced Fn formation. Treatment with butaprost (EP2 agonist), sulprostone (EP3 agonist), and 11-deoxy-PGE1 (EP2/EP4 selective agonist) failed to up-regulate Fn expression (Fig. 3A). Furthermore, we could not inhibit PGE2-induced Fn up-regulation by EP2, EP3, and EP4 receptor-specific antisense oligonucleotides (Fig. 2B). It has been reported that sulprostone also acts on the rat EP1 receptor (26). Here we found that sulprostone did not increase Fn expression unless at a high concentration of 20 µM. Pretreatment of osteoblasts with EP1 AS-ODN but not EP3 AS-ODN antagonized the increase of Fn by 20 µM sulprostone. These results indicate that sulprostone also activates the EP1 receptor at higher concentrations in osteoblasts, which is consistent with the result of vascular endothelial growth factor-C expression in lung cells (31). EP1 receptor antagonist significantly suppressed PGE2-induced Fn formation, suggesting that EP1 receptor-dependent pathway is involved in Fn up-regulation by PGE2.EP1 receptor is coupled to Ca2+ mobilization (15), and the intracellular free calcium chelator (BAPTA-AM) antagonized the up-regulation of Fn by PGE2. In addition, PGE2 and 17-phenyl trinor PGE2 also increase fluorescence intensity of fluo-3. The increase of [Ca2+]i may be attributable to the activation of PGE2 through the EP1 receptor.



View larger version (152K):
[in this window]
[in a new window]
  		FIG. 9.
PGE2 increased bone volume and immunostaining of Fn, {alpha}5{beta}1 integrin, and type I collagen in tibia metaphysis of rats. PGE2 or 17-phenyl trinor PGE2 (30 µM, 10 µl, once/day) was locally administered into the tibia through the needle cannula (arrow) in the proximal tibia for 1 week. Vehicle was injected into the contralateral side for comparison. Rats were sacrificed, and the tibiae were used for the analysis of bone volume 7 days after the last injection. Compared with vehicle-treated side, chronic treatment with PGE2 or 17-phenyl trinor PGE2 markedly increased bone volume (A). Immunostaining showed that Fn predominantly localized around the trabecular bone (arrowhead) and PGE2 or 17-phenyl trinor PGE2 increased the staining of Fn (B), {alpha}5{beta}1 integrin (C), and type I collagen (D). Bars = 0.5 mm (A) and 100 µm (B–D).

 
Several isoforms of PKC exist in primary cultured osteoblasts, including {alpha}, {beta}, {epsilon}, and {delta} (27). Treatment with antisense oligonucleotides directed against the PKC{alpha} isoform but not PKC{beta}, -{epsilon}, and -{delta} antagonized the potentiating action of PGE2 in Fn expression, indicating that the {alpha} isozyme is much more important to mediate the action of PGE2 in osteoblasts. We demonstrated that the PKC inhibitors GF109203X antagonized the PGE2-mediated potentiation of Fn expression in a dose-dependent manner, suggesting that PKC activation is an obligatory event in PGE2-induced Fn expression in these cells. This was further confirmed by the result that the dominant negative mutant of PKC{alpha} inhibited the enhancement of Fn promoter activity by PGE2. PKC is activated by the physiological activator, diacylglycerol, which can be generated either directly, by the action of PLC, or indirectly, by a pathway involving the production of phosphatidic acid by PLD, followed by a dephosphorylation reaction catalyzed by phosphatidate phosphohydrolase. The PLC involved in the production of diacylglycerol is PI-PLC or PC-PLC (32, 33). The PI-PLC inhibitor U73122 [GenBank] inhibited PGE2-induced Fn expression, whereas the PC-PLC inhibitor D609 and the inactive U73122 [GenBank] analogue U73343 [GenBank] did not affect the action of PGE2.

The cytoplasmic protein-tyrosine kinase c-Src was found to be activated by PGE2 in osteoblastic cells (34). These effects were inhibited by GF109203X, indicating the involvement of PKC-dependent c-Src activation in PGE2-mediated Fn induction. In addition to gene expression, a similar signal pathway has also been reported in the development of ischemic preconditioning in the conscious rabbit, which involved PKC{epsilon}-dependent Src and Lck activation (35), in the G protein-coupled receptors regulating N-methyl-D-aspartic acid receptor in CA1 pyramidal neurons, which involved PKC-dependent c-Src activation (36), and in the cellular response to oxidative stress, which involved PKC{delta}-dependent c-Abl activation (37). Taken together, our results provided evidence that PGE2 up-regulates Fn in rat osteoblasts via the EP1/PI-PLC/PKC{alpha}/c-Src signaling pathway.

Direct osteoblast interactions with the extracellular matrix are mediated by a selective group of integrin receptors including {alpha}5{beta}1, {alpha}3{beta}1, {alpha}v{beta}3, and {alpha}4{beta}1 (38, 39). {alpha}5{beta}1 integrin, a specific Fn receptor, mediates critical interactions between osteoblasts and Fn required for both bone morphogenesis and osteoblast differentiation (19). Interfering with interactions between Fn and integrin Fn receptors in immature fetal rat calvarial osteoblasts suppressed formation of mineralized nodules in vitro and delayed expression of tissue-specific genes, including osteocalcin (19). The finding that enhancement of surface expression of {alpha}5 and {beta}1 integrins by PGE2 correlated the increase of Fn assembly by PGE2. Increase of the surface expression of {alpha}5 and {beta}1 integrin by PGE2 was also antagonized by SC19220, U73122 [GenBank] , GF109203X, and PP2, suggesting that the regulation of {alpha}5 and {beta}1 integrin expression is parallel to the increase of Fn assembly.

PGEs are considered important local factors that modulate bone metabolism through their effects on osteoblastic cells and osteoclasts (12). The skeleton is an important target tissue for PGE2, which is involved in bone development, growth, remodeling, and repair (40). By using local injection of PGE2 and 17-phenyl trinor PGE2 into the tibia for 7 consecutive days, we demonstrate that local administration of PGE2 and 17-phenyl trinor PGE2 increased the bone volume and immunostaining of Fn, {alpha}5{beta}1 integrin, as well as type I collagen in young rats. The present results suggest that PGE2 plays an important role in the developing bone as well. The increase of bone formation may also be partially mediated by the increase of proliferation and survival of osteoblasts, because PGE2 also increased the differentiation marker of bone sialoprotein (41). Local injection of PGE2 and 17-phenyl trinor PGE2 also increased BMD and BMC in young rats, indicating that PGE2 plays an important role in the regulation of bone formation via the EP1 receptor. We injected high concentrations of drugs in small volumes in the in vivo studies. Therefore, the action of the EP1 agonist on the other EP receptors cannot be excluded.

In conclusion, the signaling pathway involved in PGE2-induced Fn expression in rat osteoblasts has been explored. PGE2 increases {alpha}5 and {beta}1 integrins and Fn expression by binding to the EP1 receptor and activation of phospholipase C, PKC{alpha}, and c-Src. Local administration of PGE2 and EP1 agonist increases Fn and promotes bone formation in rat.


   FOOTNOTES
 
* This work was supported by grants from National Science Council. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

To whom correspondence may be addressed: Dept. of Orthopaedics, National Taiwan University Hospital, No. 7, Chung-Shan South Rd., Taipei, Taiwan. E-mail: yang{at}ha.mc.ntu.edu.tw. || To whom correspondence may be addressed: Dept. of Pharmacology, College of Medicine, National Taiwan University, No. 1, Section 1, Jen-Ai Rd., Taipei, Taiwan. Tel.: 886-2-23123456 (ext. 8319); Fax: 886-2-23417930; E-mail: wenmei{at}ha.mc.ntu.edu.tw.

1 The abbreviations used are: ECM, extracellular matrix; PGE, prostaglandins; Fn, fibronectin; AS, antisense; MM, missense; ODN, oligonucleotide; BMD, bone mineral density; BMC, bone mineral content; PI-PLC, phosphatidylinositol-phospholipase C; PKC, protein kinase C; ELISA, enzyme-linked immunosorbent assay; BAPTA-AM, 1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid tetrakis(acetoxymethyl ester); RT, reverse transcription; PBS, phosphate-buffered saline; BSA, bovine serum albumin; fluo-3-AM, fluo-3-acetoxymethyl ester. Back


   ACKNOWLEDGMENTS
 
We thank Dr. I. S. Kim for providing pGL2F1900-Luc, Dr. V. Martin for providing PKC{alpha} dominant negative mutant, and Dr. S. Parsons for providing c-Src dominant negative mutant.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Canalis, E., Pash, J., and Varghese, S. (1993) Crit. Rev. Eukaryotic Gene Expression 3, 155–166[Medline] [Order article via Infotrieve]
  2. Erlebacher, A., Filvaroff, E. H., Gitelman, S. E., and Derynck, R. (1995) Cell 80, 371–378[CrossRef][Medline] [Order article via Infotrieve]
  3. Potts, J. R., and Campbell, I. D. (1994) Curr. Opin. Biol. 6, 648–655
  4. Wierzbicka-Patynowski, I., and Schwarzbauer, J. E. (2003) J. Cell Sci. 116, 3269–3276[Abstract/Free Full Text]
  5. Mosher, D. F., Sottile, J., Wu, C., and McDonald, J. A. (1992) Curr. Opin. Cell Biol. 4, 810–818[CrossRef][Medline] [Order article via Infotrieve]
  6. Yamaguchi, K., Shirakabe, K., Shibuya, H., Irie, K., Oishi, I., Ueno, N., Taniguchi, T., Nishida, E., and Matsumoto, K. (1995) Science 270, 2008–2011[Abstract/Free Full Text]
  7. Heino, J. (1993) Ann. Med. 25, 335–342[Medline] [Order article via Infotrieve]
  8. Hynes, R. O. (1992) Cell 69, 11–25[CrossRef][Medline] [Order article via Infotrieve]
  9. Wu, C., Bauer, J. S., Juliano, R. L., and McDonald, J. A. (1993) J. Biol. Chem. 268, 21883–21888[Abstract/Free Full Text]
  10. Giancotti, F. G., and Ruoslahti, E. (1990) Cell 60, 849–859[CrossRef][Medline] [Order article via Infotrieve]
  11. Juliano, R. L., and Varner, J. A. (1993) Curr. Opin. Cell Biol. 5, 812–818[CrossRef][Medline] [Order article via Infotrieve]
  12. Kaneki, H., Takasugi, I., Fujieda, M., Kiriu, M., Mizuoch, S., and Ide, H. (1999) J. Cell. Biochem. 73, 36–48[CrossRef][Medline] [Order article via Infotrieve]
  13. Suzawa, T., Miyaura, C., Inada, M., Maruyama, T., Sugimoto, Y., Ushikubo, F., Ichikaw, A., Narumiya, S., and Suda, T. (2000) Endocrinology 141, 1554–1559[Abstract/Free Full Text]
  14. Weinreb, M., Machwate, M., Shir, N., Abramovitz, M., Rodan, G. A., and Harada, S. (2001) Bone 28, 275–281[Medline] [Order article via Infotrieve]
  15. Watabe, A., Sugimoto, Y., Honda, A., Irie, A., Namba, T., Negishi, M., Ito, S., Narumiya, S., and Ichikawa, A. (1993) J. Biol. Chem. 268, 20175–20178[Abstract/Free Full Text]
  16. Katsuyama, M., Nishigaki, N., Sugimoto, Y., Morimoto, K., Negishi, M., Narumiya, S., and Ichikawa, A. (1995) FEBS Lett. 372, 151–156[CrossRef][Medline] [Order article via Infotrieve]
  17. Sugimoto, Y., Namba, T., Honda, A., Hayashi, Y., Negishi, M., Ichikawa, A., and Narumiya, S. (1992) J. Biol. Chem. 267, 6463–6466[Abstract/Free Full Text]
  18. Suda, M., Tanaka, K., Natsui, K., Usui, T., Tanaka, I., Fukushima, M., Shigeno, C., Konishi, J., Narumiya, S., Chikawa, A., and Nakao, K. (1996) Endocrinology 137, 1698–1705[Abstract]
  19. Moursi, A. M., Globus, R. K., and Damsky, C. H. (1997) J. Cell Sci. 110, 2187–2196[Abstract]
  20. Tang, C. H., Yang, R. S., Liou, H. C., and Fu, W. M. (2003) J. Bone Miner. Res. 18, 502–511[CrossRef][Medline] [Order article via Infotrieve]
  21. Yamaguchi, T., Kubota, T., Watanabe, S., and Yamamoto, T. (2004) J. Neurochem. 88, 148–154[Medline] [Order article via Infotrieve]
  22. Southall, M. D., and Vasko, M. R. (2001) J. Biol. Chem. 276, 16083–16091[Abstract/Free Full Text]
  23. Tang, C. H., Yang, R. S., Huang, T. H., Liu, S. H., and Fu, W. M. (2004) Mol. Pharmacol. 66, 440–449[Abstract/Free Full Text]
  24. Kaiser, E., Sato, M., Onyia, J. E., and Chandrasekhar, S. (2001) J. Cell. Biochem. 83, 617–630[CrossRef][Medline] [Order article via Infotrieve]
  25. Zent, R., Bush, K. T., Pohl, M. L., Quaranta, V., Koshikawa, N., Wang, Z., Kreidberg, J. A., Sakurai, H., Stuart, R. O., and Nigam, S. K. (2001) Dev. Biol. 238, 289–302[CrossRef][Medline] [Order article via Infotrieve]
  26. Boie, Y., Stocco, R., Sawyer, N., Slipetz, D. M., Ungrin, M. D., Neuschafer-Rube, F., Puschel, G. P., Metters, K. M., and Abramovitz, M. (1997) Eur. J. Pharmacol. 340, 227–241[CrossRef][Medline] [Order article via Infotrieve]
  27. Yang, R. S., Tang, C. H., Ling, Q. D., Liu, S. H., and Fu, W. M. (2002) Mol. Pharmacol. 61, 1163–1173[Abstract/Free Full Text]
  28. Akatsu, T., Takahashi, N., Debari, K., Morita, I., Murota, S., Nagata, N., Takatani, O., and Suda, T. (1989) J. Bone Miner. Res. 4, 29–35[Medline] [Order article via Infotrieve]
  29. Mo, A., Yao, W., Li, C., Tian, X., Su, M., Ling, Y., Zhang, Q., Setterberg, R. B., and Jee, W. S. S. (2002) Bone 31, 402–406[Medline] [Order article via Infotrieve]
  30. Globus, R. K., Doty, S. B., Lull, J. C., Holmuhamedov, E., Humphries, M. J., and Damsky, C. H. (1998) J. Cell Sci. 111, 1385–1393[Abstract]
  31. Su, J. L., Shih, J. Y., Yen, M. L., Jeng, Y. M., Chang, C. C., Hsieh, C. Y., Wei, L. H., Yang, P. C., and Kuo, M. L. (2004) Cancer Res. 64, 554–564[Abstract/Free Full Text]
  32. Nishizuka, Y. (1995) FASEB J. 9, 484–496[Abstract]
  33. Exton, J. H. (1994) Biochim. Biophys. Acta 1212, 26–42[Medline] [Order article via Infotrieve]
  34. Park, Y. G., Kang, S. K., Kim, W. J., Lee, Y. C., and Kim, C. H. (2004) Int. J. Biochem. Cell Biol. 36, 2270–2280[CrossRef][Medline] [Order article via Infotrieve]
  35. Ping, P., Zhang, Y. T., Li, R. C., Dawn, B., Tang, X. L., Takano, H., Balafanova, Z., and Bolli, R. (1999) Circ. Res. 85, 542–550[Abstract/Free Full Text]
  36. Lu, W. Y., Xiong, Z. G., Lei, S., Orser, B. A., Dudek, E., Browning, M. D., and MacDonald, J. F. (1999) Nat. Neurosci. 2, 331–338[CrossRef][Medline] [Order article via Infotrieve]
  37. Sun, X., Wu, F., Datta, R., Kharbanda, S., and Kufe, D. (2000) J. Biol. Chem. 275, 7470–7473[Abstract/Free Full Text]
  38. Clover, J., Dodds, R. A., and Gowen, M. (1992) J. Cell Sci. 103, 267–271[Abstract/Free Full Text]
  39. Grzesik, W. J., and Robey, P. G. (1994) J. Bone Miner. Res. 9, 487–496[Medline] [Order article via Infotrieve]
  40. Burke, A., and Weiler, H. (2002) Prostaglandins Leukotrienes Essent. Fatty Acids 67, 229–235[Medline] [Order article via Infotrieve]
  41. Samoto, H., Shimizu, E., Matsuda-Honjyo, Y., Saito, R., Nakao, S., Yamazaki, M., Furuyama, S., Sugiya, H., Sodek, J., and Ogata, Y. (2003) J. Biol. Chem. 278, 28659–28667[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 JBJSHome page
Z. Schwartz, P. Raz, G. Zhao, Y. Barak, M. Tauber, H. Yao, and B. D. Boyan
Effect of Micrometer-Scale Roughness of the Surface of Ti6Al4V Pedicle Screws in Vitro and in Vivo
J. Bone Joint Surg. Am., November 1, 2008; 90(11): 2485 - 2498.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. Jain, G. Chakraborty, R. Raja, S. Kale, and G. C. Kundu
Prostaglandin E2 Regulates Tumor Angiogenesis in Prostate Cancer
Cancer Res., October 1, 2008; 68(19): 7750 - 7759.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
C.-H. Tang, J.-Y. Chuang, Y.-C. Fong, M.-C. Maa, T.-D. Way, and C.-H. Hung
Bone-derived SDF-1 stimulates IL-6 release via CXCR4, ERK and NF-{kappa}B pathways and promotes osteoclastogenesis in human oral cancer cells
Carcinogenesis, August 1, 2008; 29(8): 1483 - 1492.
[Abstract] [Full Text] [PDF]

Home page
 Stem CellsHome page
Y. H. Kim and H. J. Han
High-Glucose-Induced Prostaglandin E2 and Peroxisome Proliferator-Activated Receptor {delta} Promote Mouse Embryonic Stem Cell Proliferation
Stem Cells, March 1, 2008; 26(3): 745 - 755.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
C.-H. Tang, T.-W. Tan, W.-M. Fu, and R.-S. Yang
Involvement of matrix metalloproteinase-9 in stromal cell-derived factor-1/CXCR4 pathway of lung cancer metastasis
Carcinogenesis, January 1, 2008; 29(1): 35 - 43.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C.-H. Tang, Y.-C. Chiu, T.-W. Tan, R.-S. Yang, and W.-M. Fu
Adiponectin Enhances IL-6 Production in Human Synovial Fibroblast via an AdipoR1 Receptor, AMPK, p38, and NF-{kappa}B Pathway
J. Immunol., October 15, 2007; 179(8): 5483 - 5492.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
Y.-C. Chiu, R.-S. Yang, K.-H. Hsieh, Y.-C. Fong, T.-D. Way, T.-S. Lee, H.-C. Wu, W.-M. Fu, and C.-H. Tang
Stromal Cell-Derived Factor-1 Induces Matrix Metalloprotease-13 Expression in Human Chondrocytes
Mol. Pharmacol., September 1, 2007; 72(3): 695 - 703.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C.-H. Tang, D.-Y. Lu, T.-W. Tan, W.-M. Fu, and R.-S. Yang
Ultrasound Induces Hypoxia-inducible Factor-1 Activation and Inducible Nitric-oxide Synthase Expression through the Integrin/Integrin-linked Kinase/Akt/Mammalian Target of Rapamycin Pathway in Osteoblasts
J. Biol. Chem., August 31, 2007; 282(35): 25406 - 25415.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C.-H. Tang, D.-Y. Lu, R.-S. Yang, H.-Y. Tsai, M.-C. Kao, W.-M. Fu, and Y.-F. Chen
Leptin-Induced IL-6 Production Is Mediated by Leptin Receptor, Insulin Receptor Substrate-1, Phosphatidylinositol 3-Kinase, Akt, NF-{kappa}B, and p300 Pathway in Microglia
J. Immunol., July 15, 2007; 179(2): 1292 - 1302.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C.-H. Tang, T.-L. Hsu, W.-W. Lin, M.-Z. Lai, R.-S. Yang, S.-L. Hsieh, and W.-M. Fu
Attenuation of Bone Mass and Increase of Osteoclast Formation in Decoy Receptor 3 Transgenic Mice
J. Biol. Chem., January 26, 2007; 282(4): 2346 - 2354.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
C.-H. Tang, R.-S. Yang, T.-H. Huang, D.-Y. Lu, W.-J. Chuang, T.-F. Huang, and W.-M. Fu
Ultrasound Stimulates Cyclooxygenase-2 Expression and Increases Bone Formation through Integrin, Focal Adhesion Kinase, Phosphatidylinositol 3-Kinase, and Akt Pathway in Osteoblasts
Mol. Pharmacol., June 1, 2006; 69(6): 2047 - 2057.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
N. Kanda, S. Koike, and S. Watanabe
Prostaglandin E2 Enhances Neurotrophin-4 Production via EP3 Receptor in Human Keratinocytes
J. Pharmacol. Exp. Ther., November 1, 2005; 315(2): 796 - 804.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/24/22907    most recent
M500130200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tang, C.-H.
Right arrow Articles by Fu, W.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tang, C.-H.
Right arrow Articles by Fu, W.-M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement