Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M503083200 on April 14, 2005

J. Biol. Chem., Vol. 280, Issue 24, 23363-23370, June 17, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/24/23363    most recent
M503083200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pruitt, K.
Right arrow Articles by Shields, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pruitt, K.
Right arrow Articles by Shields, J. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Ras-mediated Loss of the Pro-apoptotic Response Protein Par-4 Is Mediated by DNA Hypermethylation through Raf-independent and Raf-dependent Signaling Cascades in Epithelial Cells*

Kevin Pruitt§, Aylin S. Ülkü{ddagger}, Karen Frantz{ddagger}, Rafael J. Rojas{ddagger}, Vanessa M. Muniz-Medina{ddagger}, Vivek M. Rangnekar¶, Channing J. Der{ddagger}, and Janiel M. Shields{ddagger}||

From the {ddagger}Department of Pharmacology, Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill, North Carolina 27599-7295, §Division of Tumor Biology, The Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University, Baltimore, Maryland 21231, Departments of Radiation Medicine, Division of Urology, Microbiology and Immunology, and Markey Cancer Center, University of Kentucky, Lexington, Kentucky 40536

Received for publication, March 21, 2005 , and in revised form, April 8, 2005.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The apoptosis-promoting protein Par-4 has been shown to be down-regulated in Ras-transformed NIH 3T3 fibroblasts through the Raf/MEK/ERK MAPK pathway. Because mutations of the ras gene are most often found in tumors of epithelial origin, we explored the signaling pathways utilized by oncogenic Ras to down-regulate Par-4 in RIE-1 and rat ovarian surface epithelial (ROSE) cells. We determined that constitutive activation of the Raf, phosphatidylinositol 3-kinase, or Ral guanine nucleotide exchange factor effector pathway alone was not sufficient to down-regulate Par-4 in RIE-1 or ROSE cells. However, treatment of Ras-transformed RIE-1 or ROSE cells with the MEK inhibitors U0126 and PD98059 increased Par-4 protein expression. Thus, although oncogenic Ras utilizes the Raf/MEK/ERK pathway to down-regulate Par-4 in both fibroblasts and epithelial cells, Ras activation of an additional signaling pathway(s) is required to achieve the same outcome in epithelial cells. Methylation-specific PCR showed that the par-4 promoter is methylated in Ras-transformed cells through a MEK-dependent pathway and that treatment with the DNA methyltransferase inhibitor azadeoxycytidine restored Par-4 mRNA transcript and protein levels, suggesting that the mechanism for Ras-mediated down-regulation of Par-4 is by promoter methylation. Support for this possibility is provided by our observation that Ras transformation was associated with up-regulation of Dnmt1 and Dnmt3 DNA methyltransferase expression. Finally, ectopic Par-4 expression significantly reduced Ras-mediated growth in soft agar, but not morphological transformation, highlighting the importance of Par-4 down-regulation in specific aspects of Ras-mediated transformation of epithelial cells.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Proper development and tissue homeostasis are regulated in part through a complex balance between cell proliferation and cell death. Any disruption in the processes that control this balance can lead to disease states such as autoimmunity, neurodegenerative disorders, and cancer (13). Therefore, an understanding of the molecules involved in regulating cell death is crucial for prevention and treatment of these diseases.

The par-4 (prostate apoptosis response-4) gene was identified originally in a cDNA screen for genes up-regulated in prostate cancer cells that were induced to undergo apoptosis (4). Par-4 is expressed ubiquitously in a variety of cell lines and rat organs, suggesting a physiologically common function for Par-4 in most cells (5). However, although staining of Par-4 has been observed in terminally differentiated cells, consistent with its role in apoptosis, Par-4 staining has also been seen in areas enriched in stem cell populations, suggesting that Par-4 may possess additional functions that remain to be defined (5).

par-4 gene and protein expression has been found to be down-regulated in Ras-transformed NIH 3T3 mouse fibroblasts and by transient expression of activated H-Ras in human fibroblasts and HeLa cervical carcinoma cells (68). The ras gene family encodes small GTPases involved in regulation of cytoplasmic signaling pathways in response to diverse extracellular signals. ras gene point mutations of codons 12, 13, and 61 are found frequently in human cancers and result in persistent activation of Ras due to impaired GTPase activity (9, 10). A consequence of constitutive Ras activation is downstream changes in gene expression, which in turn act to modulate a variety of processes, including proliferation, differentiation, angiogenesis, and apoptosis (11). Understanding how Ras subverts death is critical to understanding the role of Ras in cancer. Ras is known to cause a shift in the growth/apoptosis balance to favor growth over death and in doing so promotes cell proliferation (12). Ras achieves growth-favoring conditions in part by altering the expression of pro-apoptotic genes to promote tumorigenesis. Thus, oncogenic Ras protects cells from apoptosis by modulation of a variety of apoptosis-related proteins, including down-regulation of Par-4 expression (6, 7). Consistent with this possibility, transient Par-4 expression causes an apoptotic response in Ras-transformed NIH 3T3 cells (7).

Ras mediates its actions by interaction with multiple downstream effectors, with the best characterized being the Raf serine/threonine kinases (11, 13). Ras binds to and activates Raf, which in turn phosphorylates and activates MEK11 and MEK2, which then activate the ERK1 and ERK2 MAPKs. The downstream consequences of this signaling pathway that are important in regulating cell survival are not clearly defined (14). The second best characterized effector of Ras is phosphatidylinositol 3-kinase (PI3K), a lipid kinase that facilitates the conversion of phosphatidylinositol 4,5-bisphosphate to phosphatidylinositol 3,4,5-triphosphate (15, 16). In turn, phosphatidylinositol 3,4,5-triphosphate promotes activation of the Akt/protein kinase B serine/threonine kinase pathway and a cell survival pathway (17). Phosphatidylinositol 3,4,5-triphosphate can also activate guanine nucleotide exchange factors (e.g. Sos and Vav) that activate the Rac small GTPase (18, 19), and a prosurvival function for Rac has been described (20). Rac can activate the JNK and p38 MAPKs, which are also activated by apoptosis-inducing stimuli (21, 22). Although Raf and PI3K represent the most studied effectors of Ras, other less well understood effectors such as the guanine nucleotide exchange factors (GEFs) for the Ral small GTPases (23) and the proapoptotic NORE1/RASSF1 family proteins (24) may also facilitate the ability of Ras to regulate cell survival and apoptosis.

Previous analyses of Ras-transformed NIH 3T3 cells have provided some indication of the mechanism of Par-4 down-regulation by Ras (68). Activated H-Ras was shown to down-regulate Par-4 through the ERK MAPK pathway based in part on studies demonstrating that stable expression of activated Raf-1, MEK1, or ERK2 in NIH 3T3 cells causes down-regulation of Par-4 expression, whereas treatment with the MEK inhibitor PD98059 blocks Ras-mediated loss of Par-4. In contrast, activated PI3K alone does not cause down-regulation of Par-4 expression, and inhibition of PI3K does not restore Par-4 expression in Ras-transformed NIH 3T3 cells. In addition, ectopic expression of Par-4 was shown to block Ras-mediated growth transformation, to inhibit tumor development, and to induce apoptosis in transient assays by inhibiting NF-{kappa}B (68). Thus, these observations support an important contribution of loss of Par-4 expression in Ras-mediated transformation and that Raf is the key effector utilized by Ras to mediate Par-4 down-regulation in rodent fibroblasts.

Although rodent fibroblast cell lines are transformed readily by activated Ras or Raf, we (25, 26) and others (2729) have shown that a variety of epithelial cell types (RIE-1, IEC-6, MCF-10A, and human embryonic kidney (HEK)) are transformed by Ras, but not by Raf. Instead, activation of Ral GEF alone is sufficient to mediate Ras transformation of human fibroblasts and epithelial cells (25). Thus, the signaling cascades that promote Ras transformation exhibit important cell type differences (11). Therefore, we initiated studies to determine the mechanism by which Ras causes down-regulation of Par-4 and to assess the importance of Par-4 in Ras-mediated transformation of epithelial cells. We found that, although activation of the Raf/MEK/ERK pathway is necessary for par-4 down-regulation, activated Raf alone is not sufficient to mediate this process. We also show that the decrease in Par-4 transcript levels is due to promoter silencing through DNA hypermethylation. Importantly, Ras-mediated soft agar growth (but not morphological transformation) was significantly impaired upon ectopic Par-4 expression, demonstrating that down-regulation of Par-4 is a necessary prerequisite for specific aspects of Ras-mediated transformation of epithelial cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines and Constructs—pBabe-puro and pZIP-NeoSV(x)1 retrovirus expression vectors for activated Ras, Raf-1, the p110 catalytic subunit (p110-CAAX), and Ral GEF (Rlf-CAAX) have been described previously (26, 30). A mammalian expression vector containing the cDNA sequence encoding Par-4 was generated by subcloning a 1.4-kb EcoRI fragment from pCB6+/Par-4 into pBabe-puro (pBabe-Par-4). NIH 3T3 mouse fibroblasts stably transfected with the pZIP-NeoSV(x)1 empty expression vector or pZIP-H-ras(61L) were maintained in Dulbecco's modified Eagle's medium supplemented with 10% calf serum as described previously (26). 208F rat fibroblasts stably transfected with the pBabe-puro empty expression vector or pBabe-H-ras(12V) were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum (FCS) as described (4). RIE-1 (rat intestinal epithelial) cells stably transfected with the pZIP-NeoSV(x)1 empty vector or pZIP-K-ras(12V) were maintained in Dulbecco's modified Eagle's medium supplemented with 5% FCS as described previously (26). Rat ovarian stromal epithelial (ROSE) cell lines stably transfected with the pBabe-puro empty vector, pZIP-H-ras(12V), or pZIP-K-ras(12V) were maintained in Dulbecco's modified Eagle's medium containing 10% FCS (31). HEK and human mammary epithelial cell lines stably infected with the pBabe-puro empty vector or encoding FLAG epitope-tagged H-ras(12V) were maintained in {alpha}-minimal essential medium supplemented with 10% FCS or in MEM{alpha} medium (Cambrex), respectively (25, 32). The DLD-1 human colon adenocarcinoma cell line, which harbors one endogenous mutant K-ras(13D) allele, and a derivative cell line of DLD-1 lacking the mutant K-ras allele (DKO-3) were maintained in RPMI 1640 medium supplemented with 10% FCS. The reduced ability of the DKO-3 variant to form colonies in soft agar and tumors in athymic nude mice has been described previously (33, 34).

Western Blot Analysis—Subconfluent exponentially growing cell cultures were harvested in buffer containing 0.5x phosphate-buffered saline, 0.5% Nonidet P-40, 50 mM sodium fluoride, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, and 25 µg/ml each aprotinin and leupeptin. Protein concentrations were measured by the Lowry assay (Bio-Rad). Unless noted otherwise, all blots were analyzed with 30 µgof soluble lysate separated on 12% SDS-polyacrylamide gels, transferred to Immobilon-P membranes (Millipore Corp.), immunoblotted with rabbit anti-Par-4 polyclonal antibody (R-334, Santa Cruz Biotechnology, Inc.) or mouse {beta}-actin monoclonal antibody (clone AC-15, Sigma), and detected with horseradish peroxidase-conjugated anti-rabbit or anti-mouse secondary antibody (Amersham Biosciences), respectively, by enhanced chemiluminescence (ECL, Amersham Biosciences).

Pharmacological Inhibitors—The chemical inhibitors used in this study were as follows: MEK1/2 inhibitors PD98059 (Calbiochem) and U0126 (Promega Corp.), PI3K inhibitor LY294004 (Promega Corp.), p38 MAPK inhibitor SB203580 (Calbiochem), and JNK MAPK inhibitor SP600125 (provided by J. K. Westwick, Celgene Corp.) (35).

RNA Isolation and Northern Blot Analysis—Total RNA from cultured cells was isolated by the guanidine thiocyanate/acid/phenol method (36). For Northern blot analyses, 25 µg of total RNA was size-fractionated on 1.4% formaldehyde gels, transferred to Hybond-N nylon membrane (Amersham Biosciences), and hybridized to 32P-labeled DNA probes. The par-4 cDNA probe used was a fragment corresponding to the 1.4-kb EcoRI insert from pCB6+ (described above). Rat plasmid cDNA clones for dnmt1, dnmt3a, and dnmt3b used for generating probes were kindly provided by Dr. E. Li (Harvard University). Verification of equivalent loading of RNA was done by hybridization with an oligonucleotide corresponding to the 28 S rRNA (Clontech). Hybridization was carried out by incubation with 1 x 106 cpm/ml in PerfectHyb Plus hybridization buffer (Sigma) at 68 °C for par-4 and dnmt1 and at 40 °C for the 28 S rRNA oligonucleotide according to the manufacturer's recommendations.

DNA Methylation Analysis—To assess the role of DNA methylation in Ras-mediated down-regulation of Par-4, cells were incubated in growth medium supplemented with 2 µM 5-aza-2'-deoxycytidine (Sigma) or Me2SO for 6 days. Azadeoxycytidine is an inhibitor of cytosine methyltransferase that methylates CpG islands in genomic DNA (37). Methylation patterns in the CpG island of par-4 were assessed by chemical bisulfite modification as described previously (3). In this procedure, unmethylated (but not methylated) cytosines are converted to uracil. Methylation-specific PCR was performed with primers specific for either methylated or bisulfite-modified unmethylated DNA. DNA methylation patterns in the CpG island of the par-4 gene were determined using multiple sets of primers. The primers specific for methylated DNA, which were designed based on DNA sequence information (GenBankTM accession number AF503628 [GenBank] ) to target a CpG-rich region -4466 bp upstream of the transcription start site (5), were as follows: GTTGGCGTAGGGTAGGTTGTAGC (forward) and GAAACACGAACGAAAAAAACCGA (reverse). Those specific for unmethylated DNA were as follows: GGTTGGTGTAGGGTAGGTTGTAGTG (foward) and CCAAAACACAAACAAAAAAAACCAAA (reverse). PCR was optimized for each primer pair. DNA treated in vitro with SssI methyltransferase (New England Biolabs Inc.) was used as positive control for methylated DNA and that from normal lymphocytes was used as a negative control for unmethylated DNA in PCR with the methylation-specific par-4 primers.

For sample preparation, 1 µg of DNA isolated from HEK cells stably expressing vector or activated Ras was denatured by NaOH and modified by sodium bisulfite. DNA samples were then purified using Wizard DNA purification resin (Promega Corp.), again treated with NaOH, precipitated with ethanol, and resuspended in water. PCRs without DNA were performed as a control. Each PCR product (10–12 µl) was directly loaded onto nondenaturing 6% polyacrylamide gels or 4% agarose gels consisting of 2% ultrapure agarose (Invitrogen) plus 2% Sea-Plaque low melting agarose (BMA Products), stained with ethidium bromide, and visualized under UV illumination.

Focus Formation and Soft Agar Colony Formation Assays—The ability of Par-4 to inhibit K-Ras(12V)-mediated focus formation was determined by cotransfection using Lipofectamine Plus (Invitrogen) and 50 ng of pZIP-K-ras(12V) with 0.5 ng of pBabe-Par-4 or empty vector, and the appearance of transformed foci was quantified after 21 days in culture. For photomicrographs, cells were fixed in 10% acetic acid and 10% methanol and stained in 0.4% crystal violet in 20% ethanol.

For soft agar analyses, mass populations of RIE-1 cells stably expressing K-Ras(12V) and Par-4 were established by cotransfection with pZIP-K-ras(12V)(neor) and pBabe-Par-4(puror), followed by co-selection in growth medium supplemented with 500 µg/ml G418 and 1 µg/ml puromycin. To assess colony formation in soft agar, cells were seeded at 2 x 104/60-mm dish in growth medium containing 0.3% agar. Verification that colonies were alive at the time of quantification was done by staining with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (thiazolyl blue; Sigma) after 21 days in culture. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide is enzymatically converted from a yellow soluble salt to an insoluble purple product in viable (but not dead) cells (38). Briefly, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide was dissolved at 2 mg/ml in phosphate-buffered saline, and 0.5 ml was washed gently over colonies on the dishes. Colonies were counted and photographed after incubation at 37 °C for 15 min.

PCR Analyses—Reverse transcription was carried out with oligo(dT) primers using Superscript II reverse transcriptase (Invitrogen) and 11 µg of total RNA as recommended by the manufacturer. Subsequent PCR amplification for each transcript was with 200 µM dNTPs, 1.5 mM MgCl2, 1 unit of AmpliTaq DNA polymerase (Roche Applied Science), 1x buffer (supplied by the manufacturer), and 0.2 µM each primer. Primer sequences were as follows: dnmt1, 5'-CCAGATACCTACCGGTTATTCG-3' (sense) and 5'-TCCTTTAACTGCAGCTGAGGC-3' (antisense); dnmt3a, 5'-FCTGAAATGGAAAGGGTGTTTGGC-3' (sense) and 5'-CCATGTCCCTTACACACAAGC-3' (antisense); dnmt3b, 5'-GTACTTCTGGGGTAACCTACC-3' (sense) and 5'-GCAAACAGGTGTCTGATGACC-3' (antisense); and {beta}-actin, 5'-GACCCAGATCATGTTTGAGACC-3' (sense) and 5'-AGTCCATCACAATGCCAGTGGT-3' (antisense). Amplification conditions were as follows: one cycle at 94 °C for 3 min; 30 cycles at 94 °C for 30 s, 55 °C (for dnmt1 and {beta}-actin) or 65 °C (for dnmt3a and dnmt3b) for 30 s, and 72 °C for 1.5 min; and one cycle at 72 °C for 6 min.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Previous studies of the relationship between oncogenic Ras transformation and Par-4 expression have focused primarily on analyses in mouse fibroblasts. In these studies, expression of oncogenic Ras resulted in nearly complete loss of detectable Par-4 protein expression (68). To assess the relationship between Ras and Par-4 in epithelial cells, we examined Par-4 protein levels in several Ras-transformed epithelial cell lines. As described previously for NIH 3T3 mouse fibroblasts (68), we observed that 208F rat fibroblasts expressing constitutively active K-Ras(12V) also showed down-regulated Par-4 protein levels (Fig. 1). Similarly, RIE-1, ROSE, HEK, and human mammary epithelial cells expressing either activated H-Ras(12V) or K-Ras(12V) exhibited a decrease in Par-4 protein expression (Fig. 1). Thus, Ras-mediated transformation of a variety of epithelial cell types as well as fibroblasts resulted in down-regulation of Par-4. Interestingly, fibroblasts expressed less endogenous Par-4 compared with the epithelial cells, suggesting that endogenous levels of Par-4 expression are cell type-dependent.

The reduced expression of Par-4 observed in response to the forced expression of mutant Ras led us to investigate whether a similar loss of Par-4 would occur in tumor cell systems with endogenous aberrant Ras activity and thus more closely reveal in vivo physiological oncogenic Ras conditions. To address this question, we evaluated Par-4 protein levels in a human colon tumor cell system in which oncogenic Ras was shown previously to be critical for tumorigenic transformation. Shirasawa et al. (34) used homologous recombination to knock out the single mutant K-ras(13D) allele present in DLD-1 human colon carcinoma cells and determined that loss of oncogenic Ras function results in a drastic impairment of their transformed phenotype both in vitro and in vivo. As shown in Fig. 1B, the DLD-1 colon tumor cell line, which harbors a naturally occurring mutation in K-ras(13D), showed lower levels of Par-4 compared with its genetic variant (DKO-3) in which the mutant K-ras allele was deleted. Thus, these data demonstrate that decreased levels of Par-4 are associated with naturally occurring aberrant Ras activity, suggesting that loss of Par-4 is an important event in the tumorigenesis of cells that display abnormal Ras function.



View larger version (47K):
[in this window]
[in a new window]
 
FIG. 1.
Par-4 expression is reduced in epithelial cells expressing oncogenic Ras. A, Par-4 protein expression is down-regulated in Ras-transformed epithelial cells. Equal amounts of total protein lysate from fibroblasts (NIH 3T3 and Rat-1) and epithelial cells (RIE-1, ROSE, HEK, and human mammary (HMEC)) expressing constitutively active Ras (+) or vector only (-) were analyzed for Par-4 expression by Western blot analysis with anti-Par-4 antiserum. B, loss of mutant K-Ras is associated with elevation of Par-4 expression. Equal amounts of total protein cell lysate from the human colon tumor cell lines DLD-1 (containing an activated K-ras(13D) allele) and DKO-3 (derivative of DLD-1 with the mutant K-ras allele deleted) were analyzed for Par-4 expression by Western blot analysis with anti-Par-4 antiserum. To control for loading, the membrane was stripped of the anti-Par-4 antibody and reblotted with anti-actin serum.

 
Because we observed that down-regulation of Par-4 protein levels is correlated with Ras transformation of multiple cell types, we next investigated whether this reduction is biologically important to Ras-mediated transformation. Loss of anchorage and density dependence growth is a key growth characteristic of tumor cells that distinguishes them from normal cells. The ability of tumor cells to continue to proliferate under conditions of confluency (density dependence) and in the absence of substratum attachment (soft agar growth) distinguishes tumor cells from normal cells (39). First, we examined the ability of Par-4 to inhibit Ras-mediated focus forming (density dependence) activity. In these experiments, we transfected RIE-1 cells with an expression vector encoding activated K-Ras(12V) either alone or together with Par-4 and evaluated the consequences of Par-4 expression on Ras focus forming activity. As shown in Fig. 2 (A and B), coexpression of Par-4 caused a 40% reduction in Ras transforming activity compared with the activity caused by cotransfection of the empty vector. These data suggest that the elevated expression of Par-4 inhibits Ras-mediated transformation and that down-regulation of Par-4 is a necessary prerequisite for Ras-induced transformation.



View larger version (46K):
[in this window]
[in a new window]
 
FIG. 2.
Par-4 coexpression inhibits Ras-mediated focus formation. The ability of Par-4 to inhibit K-Ras(12V)-mediated focus formation was determined by cotransfection of 50 ng of pZIP-K-ras(12V) and 0.5 µg of either pBabe-puro empty vector or pBabe-Par-4, and the appearance of transformed cells as foci was quantified after 21 days in culture. A, photomicrographs of transformed foci after staining with crystal violet; B, quantitation of the average number of total foci from triplicate plates. Data shown are representative of three independent experiments and are expressed as the mean ± S.D. of foci per plate.

 
To further evaluate how Par-4 antagonizes Ras transformation, we generated stable cell lines that ectopically express Par-4 to determine whether re-expression of Par-4 could inhibit or reverse Ras-mediated transformation. As shown in Fig. 3A, forced ectopic Par-4 protein expression was restored to levels similar to those seen in the control empty vector-transfected cells, but there was no change or reversion in the morphological transformation (Fig. 3B) compared with cells transfected with the empty vector. However, when we compared their ability to grow under anchorage-independent conditions, we found that restoration of Par-4 expression reduced the ability of Ras-transformed RIE-1 cells to grow in semisolid agar by 55% (Fig. 3, C and D). In addition, re-expression of Par-4 reduced not only the number of colonies, but also the size of the colonies (Fig. 3E). Because Ras (but not Raf) results in down-regulation of Par-4, we also examined whether forced expression of dominant-negative Par-4 (40) in the Raf-expressing cells would render these cells transformed. However, we observed no change in morphology or ability to grow in soft agar (data not shown). Thus, because forced re-expression of Par-4 inhibited the soft agar growth of the Ras-transformed cells, we conclude that the reduced expression of Par-4 observed in Ras-transformed cells is biologically relevant and represents an important mechanism by which Ras mediates transformation.

To investigate the mechanism by which Ras down-regulates Par-4 in epithelial cells, we next evaluated the potential involvement of several signaling pathways commonly activated by Ras. Although the Raf/MEK/ERK MAPK pathway represents the most widely studied Ras effector pathway, other pathways such as the PI3K/Akt and Ral GEF effector pathways have also been shown to be important for Ras transformation (11, 13). To determine whether activation of a specific effector pathway alone is sufficient to down-regulate Par-4 expression, we previously established ROSE cells stably expressing constitutively active forms of Raf-1 (membrane-targeted Raf-CAAX and N-terminally truncated Raf-22W), PI3K (p110-CAAX), and Ral GEF (Rlf-CAAX) and verified that they cause activation of ERK, Akt, and Ral-GTP, respectively (31). Activated Raf alone is sufficient to cause partial growth transformation of ROSE cells. In contrast to the reduced levels of Par-4 protein seen in H-Ras(12V)-expressing ROSE cells (Fig. 4A), there were no detectable reductions in Par-4 expression in ROSE cells expressing any one activated effector alone. Finally, similar to our results in ROSE cells, activated Raf alone was insufficient to cause loss of Par-4 expression in RIE-1 cells (Fig. 4A). Therefore, our results in ROSE and RIE-1 cells are in contrast to those described in fibroblasts, where Raf activation alone is sufficient to down-regulate Par-4 expression (68). Thus, the mechanism by which Ras down-regulates Par-4 in epithelial cells requires activation of Raf-independent effector pathways.



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 3.
Ectopic expression of Par-4 inhibits Ras-mediated growth, but not morphological transformation. Mass populations of RIE-1 cells stably co-transfected with pZIP-K-ras(12V) and pBabe-Par-4 or the pBabe-puro empty vector alone were compared with control cells transfected with each empty vector. A, Par-4 expression is restored in Ras-transformed RIE-1 cells to levels seen in control RIE-1 cells. Equal amounts of total protein cell lysate were analyzed for Par-4 expression by Western blot analysis with anti-Par-4 antiserum. To control for loading, the anti-Par-4 antibody was stripped, and the membrane was reblotted with anti-actin serum. B, increased Par-4 expression does not reverse the morphological transformation of K-Ras(12V)-transformed RIE-1 cells (magnification x40). C, ectopic expression of Par-4 inhibits Ras-mediated anchorage-independent growth of RIE-1 cells in soft agar. Ras-transformed RIE-1 cells stably overexpressing ectopic Par-4 were assayed for their ability to proliferate in growth medium containing 0.3% agar and the formation of multicellular colonies (magnification x40) after staining with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide. D, quantification of transformed cells as foci after 21 days in culture from triplicate plates. Data shown are representative of three independent experiments and are expressed as the mean ± S.D. of the colony number per plate. E, x400 magnification of the colonies formed in the dishes shown in C.

 



View larger version (48K):
[in this window]
[in a new window]
 
FIG. 4.
Ras activation of the Raf/ERK effector is necessary but not sufficient to down-regulate Par-4 expression. A, activation of the Raf, PI3K, or Ral GEF effector pathway alone is not sufficient to cause down-regulation of Par-4. Equal amounts of total protein cell lysate prepared from ROSE and RIE-1 cells stably expressing the indicated proteins were analyzed for Par-4 expression by Western blot analysis with anti-Par-4 antiserum. To control for loading, the anti-Par-4 antibody was stripped, and the membrane was reblotted with anti-actin serum. Lysates denoted as "-1," "-2," and "-3" represent duplicate stable cell lines generated at different times. B, inhibition of MEK signaling restores Par-4 expression in Ras-transformed RIE-1 and ROSE cells. RIE-1 and ROSE cells stably expressing activated Ras were maintained for 48 h in growth medium supplemented with 50 µM PD98059 (MEK1/2), 30 µM U0126 (MEK1/2), 10 µM SB203580 (p38), 10 µM LY294002 (PI3K), or 20 µM SP600125 (JNK). Equal amounts of total protein cell lysate were analyzed for Par-4 expression by Western blot analysis with anti-Par-4 antiserum. To control for loading, the anti-Par-4 antibody was stripped, and the membrane was reblotted with anti-actin serum. DMSO, dimethyl sulfoxide.

 
To determine whether activation of a particular effector pathway is necessary to cause down-regulation of Par-4, we utilized several pharmacological inhibitors of MEK and PI3K to assess the importance of these pathways in Ras down-regulation of Par-4. Interestingly, we found that inhibition of ERK activation in both Ras-expressing RIE-1 and ROSE cells by treatment with the MEK inhibitors PD98059 and U0126 restored the level of Par-4 expression to that seen in control untransformed RIE-1 and ROSE cells (Fig. 4B). Inhibition of MEK also reverses Ras-induced growth transformation of RIE-1 (41) and ROSE (31) cells. In contrast, we found that the p38 MAPK inhibitor SB203580, the PI3K inhibitor LY294002, and the JNK inhibitor SP600125 had no effect on Par-4 expression. Thus, we conclude that, although activation of the ERK pathway alone is not sufficient to recapitulate the signaling cascade mediated by Ras to down-regulate Par-4, activation of ERK by Ras does appear to be a necessary component.

Other signaling pathways utilized by Ras include those activated by the Rho family of small GTPases, such as Rac1, RhoA, and Cdc42, which can be activated by Ras. Ras-mediated transformation of rodent fibroblasts has been shown to require the function of these GTPases (42). Because Rho family GTPases can either trigger cell death or promote cell survival depending on the cellular context (43) and because Par-4 is a known pro-apoptotic response protein, we sought to determine whether Rac1 or other small GTPases such as RhoA and Cdc42 could also down-regulate Par-4. For these analyses, we utilized mass populations of RIE-1 cells stably expressing constitutively active Rac1(61L) or RhoA(63L) or activated forms of the Dbl family proteins Vav and Dbl, which are GEFs and activators of Rho family GTPases (44). Vav is an activator of RhoA, Rac1, and Cdc42, whereas Dbl is an activator of RhoA and Cdc42 (45, 46). Although activated Ras down-regulated Par-4, no change in Par-4 levels was observed with RhoA, Rac1, Vav, or Dbl (data not shown), suggesting that Ras does not mediate down-regulation of Par-4 through RhoA, Rac1, or Cdc42 in RIE-1 cells.

We recently demonstrated that Ras-mediated transformation causes down-regulation of {alpha}-tropomyosin gene expression and that the mechanism is through promoter methylation (44). Promoter methylation represents one common mechanism of epigenetic gene silencing in human carcinomas (47). For example, the expression of various tumor suppressor genes, including BRCA1, E-cadherin, MLH1, p16, VHL, and RB1, is inactivated by hypermethylation in many human cancers (48). Therefore, we assessed the possibility that promoter methylation is involved in oncogenic Ras suppression of Par-4 expression.

To determine whether loss of Par-4 expression is due to DNA methylation, we first treated Ras-transformed RIE-1 cells with the azadeoxycytidine demethylating agent and determined whether Par-4 expression was restored. Azadeoxycytidine is a specific inhibitor of DNA methyltransferase (49, 50) and has been used widely to assess the role of methylation in promoter silencing. As shown in Fig. 5A, Par-4 mRNA and protein expression was increased after treatment with azadeoxycytidine compared with that in untreated Ras-expressing RIE-1 cells. To extend these analyses, we also examined DNA methylation of Par-4 in azadeoxycytidine-treated ROSE cells overexpressing mutant Ras and in DLD-1 cells, which harbor an endogenous mutant ras allele. As shown in Fig. 5B, azadeoxycytidine treatment also caused an increase in Par-4 expression in both ROSE and DLD-1 cells. Thus, these results demonstrate that promoter methylation may be a general mechanism of Ras-mediated down-regulation of Par-4.

Interestingly, azadeoxycytidine treatment also causes a partial reversion of the morphological transformation of both Ras-transformed RIE-1 (44) and ROSE (data not shown) cells, supporting the importance of DNA methylation in Ras-mediated transformation. To directly determine the methylation status of the par-4 promoter, we analyzed DNA obtained from Ras-expressing or vector only-transfected HEK cells by methylation-specific PCR (Fig. 5C). HEK cells were chosen because more promoter DNA sequence is available for the human gene. The region chosen for methylation-specific PCR analysis spans an area of high CpG density -4466 bp upstream of the transcription start site (5). As shown in Fig. 5C, par-4 DNA was present in the unmethylated form in both vector only- and Ras-expressing HEK cells. Importantly, the methylated form of par-4 DNA was observed only in the Ras-expressing cells. These data are consistent with our observed partial but not complete down-regulation of Par-4 protein expression in the Ras-expressing HEK cells (Figs. 1 and 4A). Because treatment of the Ras-expressing HEK cells with MEK inhibitors restored Par-4 protein expression, we next investigated whether the mechanism for restored Par-4 expression is through a MEK-dependent pathway, resulting in loss of DNA methylation of the par-4 DNA promoter. As shown in Fig. 5C, the methylated form of par-4 DNA was abolished in the Ras-expressing HEK cells treated with U0126 compared with control vehicle-treated cells. Taken together, these data show directly that expression of mutant Ras results in MEK-dependent down-regulation of Par-4 through CpG methylation of the par-4 DNA promoter.



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 5.
Par-4 expression is decreased through promoter methylation by Ras. A, azadeoxycytidine treatment reverses Ras-induced down-regulation of Par-4. RIE-1 cells stably expressing K-Ras(12V) were maintained in growth medium supplemented with 2 µM azadeoxycytidine for 6 days. Total RNA (25 µg) from treated cells was size-fractionated on formaldehyde-agarose gels and analyzed by Northern blot analysis with 32P-labeled DNA probes for Par-4 or the 28 S ribosomal RNA as a loading control. Cell lysates from companion treated cultures were used for Western blot analysis with anti-Par-4 antiserum. To control for loading, the anti-Par-4 antibody was stripped, and the membrane was reblotted with anti-actin serum. In parallel with the restoration of Par-4 mRNA expression (upper panels), Par-4 protein expression was restored after azadeoxycytidine treatment to levels comparable to those seen in control vector only-expressing cells (lower panels). B, azadeoxycytidine treatment of Ras-expressing ROSE and DLD-1 cells enhances Par-4 expression. ROSE cells stably expressing K-Ras(12V) and DLD-1 human colon tumor cells (which harbor an endogenous mutant ras allele, K-ras(13D)) were treated with 2 µM azadeoxycytidine for 6 days, and protein lysates were used for Western blot analysis with anti-Par-4 antiserum. To control for loading, the anti-Par-4 antibody was stripped, and the membrane was reblotted with anti-actin serum. C, par-4 promoter DNA is methylated in Ras-transformed HEK cells. Primers specific for unmethylated (U) or methylated (M) DNA were used to amplify DNA from HEK cells expressing the empty vector or H-Ras(12V) (left panel) or from Ras-expressing HEK cells treated with vehicle alone (dimethyl sulfoxide (DMSO)) or U0126 (30 µM) for 6 days (right panel).

 
Because Par-4 transcript levels were restored upon treatment with azadeoxycytidine, we assessed whether Ras causes a change in expression of three DNA methyltransferases involved in CpG hypermethylation. Dnmt1 methylates hemimethylated DNA and is therefore believed to be responsible for maintenance of methylation patterns. On the other hand, Dnmt3a and Dnmt3b are thought to be responsible for de novo methylation of previously unmethylated DNA. Thus, Dnmt3a and Dnmt3b may function as initiators of changes in DNA methylation patterns (51), although the exact function of these enzymes is presently not clear. To determine whether Ras up-regulates the methyltransferases, we performed semiquantitative reverse transcription-PCR on mRNA isolated from RIE-1 cells expressing Ras or the vector only. As shown in Fig. 6A, Ras-transformed RIE-1 cells showed an increase in both dnmt1 and dnmt3a, but not dnmt3b. To further support this finding, we performed Northern blot analyses and found that dnmt1 was indeed increased in Ras-expressing cells (Fig. 6B). We also tried to detect dnmt3a and dnmt3b; however, these genes were below the level of detection. These results suggest that Ras activation alone is sufficient to cause an increase in the enzymes responsible for genomic DNA hypermethylation, resulting in gene silencing of many genes, including par-4.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Emerging complexities of Ras signaling include the involvement of Raf-independent effectors in mediating Ras transformation, cell type differences in Ras signaling, and the complexity of genes deregulated in Ras-transformed cells (11). par-4 has been identified as a gene down-regulated by activation of the Raf/ERK MAPK cascade in Ras-transformed fibroblasts (68). In light of differences in the signaling pathways involved in Ras transformation of fibroblasts versus epithelial cells, we evaluated the mechanism and role of Par-4 down-regulation in Ras transformation of epithelial cells. We found that Ras transformation of a variety of epithelial cells was associated with down-regulated Par-4 protein expression; that the Raf/ERK pathway was necessary but not sufficient for Ras down-regulation of Par-4 in rodent epithelial cells; that loss of Par-4 contributed to soft agar growth, but not morphological transformation by Ras; and finally, that CpG DNA methylation through a MEK-dependent pathway, possibly via up-regulation of the Dnmt1 and Dnmt3a DNA methyltransferases, was involved in suppression of par-4 gene expression.

Activated Ras and Raf show equivalent abilities to cause transformation of NIH 3T3 and other rodent fibroblast cell lines (26). In contrast, activated Ras (but not Raf) causes transformation of RIE-1 rat intestinal and other epithelial cells (2529), thus demonstrating that the signaling cascades in fibroblasts and epithelial cells, while similar, exhibit important differences in signaling strategies and biological outcome (11). Recent reports utilizing NIH 3T3 cells demonstrated that the mechanism by which activated Ras causes down-regulation of Par-4 is by signaling through the Raf/MEK/ERK MAPK pathway (68). Therefore, we assessed the contribution of the ERK MAPK and other signaling pathways to mediating Par-4 down-regulation in Ras-transformed epithelial cells. We found that the expression alone of constitutively active forms of three Ras effectors (Raf, Ral GEF, and PI3K) was not sufficient to mimic Ras-mediated down-regulation of Par-4 in epithelial cells. These data suggest that, unlike in Ras-transformed rodent fibroblasts, in which Par-4 is down-regulated via the Raf/ERK pathway, in epithelial cells, activation of this pathway is not sufficient to down-regulate Par-4. We recently found that two other genes deregulated in Ras-transformed RIE-1 cells are aberrantly expressed as a result of the combined concomitant effects of two pathways. Expression of the actin-binding protein tropomyosin is down-regulated in Ras-transformed RIE-1 cells through a mechanism requiring activation of the Raf/MAPK pathway along with inhibition of the p38 MAPK pathway (44). Similarly, we also showed that the cell cycle regulatory protein cyclin D1 is up-regulated in Ras-transformed cells through a mechanism requiring activation of the Raf/ERK pathway together with inhibition of the p38 MAPK pathway (52). Thus, it appears that, in epithelial cells, it is not uncommon to find Ras utilizing a multiple-pathway approach to elicit a change in gene expression.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 6.
Dnmt1 and Dnmt3a DNA methyltransferase mRNA expression is up-regulated in Ras-transformed RIE-1 cells. Total RNA from RIE-1 cells stably expressing K-Ras(12V) or the vector only (A) along with cells expressing Raf-22W (B) was used for reverse transcription-PCR analyses of Dnmt1, Dnmt3a, Dnmt3b, and {beta}-actin mRNA levels (A) or for Northern blot analysis with 32P-labeled DNA probes for Dnmt1 and the 18 S ribosomal RNA as a loading control (B). In A, control PCRs (Mock) were performed without template cDNA to show specificity of PCR products.

 
Interestingly, however, although activation of the Raf/MAPK pathway alone was not sufficient to down-regulate Par-4, inhibition of MEK with the pharmacological inhibitors restored Par-4 expression in Ras-transformed RIE-1 and ROSE cells. This suggests that the Raf/ERK pathway represents one branch in the pathway that Ras utilizes to down-regulate Par-4 and that inactivation of this branch alone is sufficient to disrupt Ras-mediated down-regulation of Par-4. Thus, the clinical utility of pharmacological drugs that target the Raf/MEK/ERK pathway may inhibit tumor growth in part by restoring Par-4 expression and inhibition of transformation.

We determined that ectopic restoration of Par-4 expression to levels found in untransformed cells caused a partial reversion of Ras-mediated focus formation and soft agar growth of RIE-1 cells. This observation is consistent with the previous observation that Par-4 down-regulation contributes to growth transformation of Ras-transformed NIH 3T3 rodent fibroblasts (68). Similar to data observed in fibroblasts (6), we found that restoration of Par-4 expression did not reverse the morphological transformation of Ras-transformed RIE-1 cells. That Par-4 affects anchorage dependence and loss of density-dependent growth (but not morphological transformation) is not unexpected and is consistent with the role of Par-4 as a regulator of cell survival rather than a regulator of actin organization or cell adhesion.

Promoter methylation represents a common mechanism utilized by cancer cells to silence the expression of a variety of genes (47). We showed recently that Ras down-regulates tropomyosin through cytosine methylation of the promoter (44). In addition, other studies have shown that oncogenic Ras-mediated down-regulation of the genes encoding lysyl oxidase and the Fas ligand is mediated by DNA methylation (53, 54). Similarly, we have shown here that treatment of Ras-transformed RIE-1, ROSE, and DLD-1 cells with azadeoxycytidine, a known inhibitor of CpG methylation (37), restored Par-4 expression. Interestingly, Barradas et al. (6) showed that, in NIH 3T3 cells, Par-4 protein expression is not restored after treatment with azadeoxycytidine. This discrepancy may be explained in part by cell type differences. Barradas et al. used NIH 3T3 fibroblasts, whereas in this study, we utilized epithelial cells. In addition, Barradas et al. treated the cells for only 2 days, whereas we used a more extensive treatment time of 6 days. In combination with our direct demonstration of promoter methylation using methylation-specific PCR, our data show that the long-term mechanism for Ras-mediated loss of Par-4 expression involves CpG DNA hypermethylation, resulting in gene silencing through aberrant cytosine methylation in epithelial cells. In addition, the loss of methylation upon U0126 treatment suggests that Ras utilizes a MEK-dependent pathway leading to par-4 methylation. Finally, we observed that DNA demethylation also caused a partial reversion of the morphological transformation in both Ras-expressing RIE-1 and ROSE cells. Thus, promoter methylation and gene silencing of a variety of tumor cell growth inhibitory genes, including par-4, may be an important mechanism of Ras-mediated transformation for RIE-1, ROSE, and other epithelial cells.

The association of Ras and DNA methylation is highly inter-twined. The DNA repair enzyme 6-O-methylguanine-DNA methyltransferase functions to remove mutagenic and cytotoxic adducts from the position of guanine. If adducts such as 6-O-methylguanine are not removed, mispairing between the 6-O-methylguanine and thymine can occur during replication, resulting in G-to-A mutations (55). In both colorectal and pancreatic carcinomas, the most prevalent ras mutations involve G-to-A mutations at codons 12 and 13 (56). Esteller et al. (55) showed that 71% of colorectal tumors exhibiting G-to-A mutations in K-ras show loss of 6-O-methylguanine-DNA methyltransferase expression. In addition, their study found that loss of 6-O-methylguanine-DNA methyltransferase occurs in small adenomas that do not yet harbor K-ras mutations, further supporting the idea that loss of the DNA repair function of 6-O-methylguanine-DNA methyltransferase results in the accumulation of K-ras mutations. In turn, Ras activation has been shown in several studies to cause up-regulation of the DNA methyltransferase Dnmt1. In one study, Ras-transformed IEC-18 rat intestinal epithelial cells showed increased DNA methyltransferase activity and methylation of the p16 tumor suppressor gene, and treatment with azadeoxycytidine resulted in the restoration of p16 expression (57). In another study, inhibition of Ras activity in the Y1 mouse adrenocortical tumor cell line, which overexpresses wild-type K-Ras by 30-fold, resulted in a 50-fold decrease in DNA methyltransferase enzyme activity and mRNA expression (58). In addition, injection of dnmt1 antisense oligodeoxynucleotides into Y1 mouse tumors inhibits tumor growth (49). Our studies now show that, in addition to up-regulating the Dnmt1 DNA methylation maintenance enzyme, Ras also up-regulates the Dnmt3a de novo DNA methylation enzyme. Taken together, these studies suggest a dependence of Ras-mediated tumor formation on gene silencing through DNA methylation by a mechanism that involves up-regulation of Dnmt1 and Dnmt3a. Additional studies to determine the mechanism by which Ras initiates up-regulation of Dnmt1 and Dnmt3a will further our understanding of how Ras causes down-regulation of certain genes (such as par-4) that function to inhibit tumor growth.

In summary, our analyses of Ras-mediated down-regulation of Par-4 support a model in which, in epithelial cells, oncogenic Ras activation of ERK along with a yet unidentified pathway(s) results in down-regulation of Par-4 by causing an increase in the expression of CpG methyltransferases. The methylation of promoters of key genes such as par-4 may then result in down-regulation of their expression and thus contribute to the process of transformation. The altered expression of many genes is observed in Ras-transformed cells, and an important goal of future studies will be to identify those that facilitate, rather than simply correlate with, Ras transformation and those that are mediated by changes in DNA methylation.


    FOOTNOTES
 
* This work was supported by National Institutes of Health Grants CA63071 (to C. J. D.) and CA84511 (to V. M. R.) and by the Department of Defense Grant DAMD17-00-1-0552 (to J. M. S.).The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

|| To whom correspondence should be addressed: University of North Carolina at Chapel Hill, Lineberger Comprehensive Cancer Center, CB 7295, Chapel Hill, NC 27599-7295. Tel.: 919-966-5634; Fax: 919-966-0162; E-mail: shieldsj{at}med.unc.edu.

1 The abbreviations used are: MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase; ERK, extracellular signal-regulated kinase; MAPK, mitogen-activated protein kinase; PI3K, phosphatidylinositol 3-kinase; JNK, c-Jun N-terminal kinase; GEF, guanine nucleotide exchange factor; HEK, human embryonic kidney; A, aliphatic amino acid; FCS, fetal calf serum; ROSE, rat ovarian stromal epithelial. Back



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Tamm, I., Schriever, F., and Dorken, B. (2001) Lancet Oncol. 2, 33-42[Medline] [Order article via Infotrieve]
  2. Olson, M., and Kornbluth, S. (2001) Curr. Mol. Med. 1, 91-122[CrossRef][Medline] [Order article via Infotrieve]
  3. Zhang, J., and Xu, M. (2002) Trends Cell Biol. 12, 84-89[CrossRef][Medline] [Order article via Infotrieve]
  4. Sells, S. F., Wood, D. P., Jr., Joshi-Barve, S. S., Muthukumar, S., Jacob, R. J., Crist, S. A., Humphreys, S., and Rangnekar, V. M. (1994) Cell Growth & Differ. 5, 457-466[Abstract]
  5. Boghaert, E. R., Sells, S. F., Walid, A. J., Malone, P., Williams, N. M., Weinstein, M. H., Strange, R., and Rangnekar, V. M. (1997) Cell Growth & Differ. 8, 881-890[Abstract]
  6. Barradas, M., Monjas, A., Diaz-Meco, M. T., Serrano, M., and Moscat, J. (1999) EMBO J. 18, 6362-6369[CrossRef][Medline] [Order article via Infotrieve]
  7. Nalca, A., Qiu, S. G., El Guendy, N., Krishnan, S., and Rangnekar, V. M. (1999) J. Biol. Chem. 274, 29976-29983[Abstract/Free Full Text]
  8. Qiu, S. G., Krishpar-4nan, S., El Guendy, N., and Rangnekar, V. M. (1999) Oncogene 18, 7115-7123[CrossRef][Medline] [Order article via Infotrieve]
  9. Bos, J. L. (1989) Cancer Res. 49, 4682-4689[Abstract/Free Full Text]
  10. Bourne, H. R., Sanders, D. A., and McCormick, F. (1990) Nature 348, 125-132[CrossRef][Medline] [Order article via Infotrieve]
  11. Shields, J. M., Pruitt, K., McFall, A., Shaub, A., and Der, C. J. (2000) Trends Cell Biol. 10, 147-154[CrossRef][Medline] [Order article via Infotrieve]
  12. Downward, J. (1998) Curr. Opin. Genet. Dev. 8, 49-54[CrossRef][Medline] [Order article via Infotrieve]
  13. Marshall, C. J. (1996) Curr. Opin. Cell Biol. 8, 197-204[CrossRef][Medline] [Order article via Infotrieve]
  14. Cox, A. D., and Der, C. J. (2003) Oncogene 22, 8999-9006[CrossRef][Medline] [Order article via Infotrieve]
  15. Rodriguez-Viciana, P., Warne, P. H., Khwaja, A., Marte, B. M., Pappin, D., Das, P., Waterfield, M. D., Ridley, A., and Downward, J. (1997) Cell 89, 457-467[CrossRef][Medline] [Order article via Infotrieve]
  16. Rodriguez-Viciana, P., Warne, P. H., Vanhaesebroeck, B., Waterfield, M. D., and Downward, J. (1996) EMBO J. 15, 2442-2451[Medline] [Order article via Infotrieve]
  17. Marte, B. M., and Downward, J. (1997) Trends Biochem. Sci. 22, 355-358[CrossRef][Medline] [Order article via Infotrieve]
  18. Han, J., Luby-Phelps, K., Das, B., Shu, X., Xia, Y., Mosteller, R. D., Krishna, U. M., Falck, J. R., White, M. A., and Broek, D. (1998) Science 279, 558-560[Abstract/Free Full Text]
  19. Nimnual, A. S., Yatsula, B. A., and Bar-Sagi, D. (1998) Science 279, 560-563[Abstract/Free Full Text]
  20. Joneson, T., and Bar-Sagi, D. (1999) Mol. Cell. Biol. 19, 5892-5901[Abstract/Free Full Text]
  21. Coso, O. A., Chiariello, M., Yu, J. C., Teramoto, H., Crespo, P., Xu, N., Miki, T., and Gutkind, J. S. (1995) Cell 81, 1137-1146[CrossRef][Medline] [Order article via Infotrieve]
  22. Minden, A., Lin, A., Claret, F. X., Abo, A., and Karin, M. (1995) Cell 81, 1147-1157[CrossRef][Medline] [Order article via Infotrieve]
  23. Feig, L. A. (2003) Trends Cell Biol. 13, 419-425[CrossRef][Medline] [Order article via Infotrieve]
  24. Feig, L. A., and Buchsbaum, R. J. (2002) Curr. Biol. 12, R259-R261[CrossRef][Medline] [Order article via Infotrieve]
  25. Hamad, N. M., Elconin, J. H., Karnoub, A. E., Bai, W., Rich, J. N., Abraham, R. T., Der, C. J., and Counter, C. M. (2002) Genes Dev. 16, 2045-2057[Abstract/Free Full Text]
  26. Oldham, S. M., Clark, G. J., Gangarosa, L. M., Coffey, R. J., Jr., and Der, C. J. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 6924-6928[Abstract/Free Full Text]
  27. Gire, V., Marshall, C. J., and Wynford-Thomas, D. (1999) Oncogene 18, 4819-4832[CrossRef][Medline] [Order article via Infotrieve]
  28. Schulze, A., Lehmann, K., Jefferies, H. B., McMahon, M., and Downward, J. (2001) Genes Dev. 15, 981-994[Abstract/Free Full Text]
  29. Rangarajan, A., Hong, S. J., Gifford, A., and Weinberg, R. A. (2004) Cancer Cells 6, 171-183
  30. McFall, A., Ülkü, A., Lambert, Q. T., Kusa, A., Rogers-Graham, K., and Der, C. J. (2001) Mol. Cell. Biol. 21, 5488-5499[Abstract/Free Full Text]
  31. Ülkü, A. S., Schafer, R., and Der, C. J. (2003) Mol. Cancer Res. 1, 1077-1088[Abstract/Free Full Text]
  32. Elenbaas, B., Spirio, L., Koerner, F., Fleming, M. D., Zimonjic, D. B., Donaher, J. L., Popescu, N. C., Hahn, W. C., and Weinberg, R. A. (2001) Genes Dev. 15, 50-65[Abstract/Free Full Text]
  33. Plattner, R., Anderson, M. J., Sato, K. Y., Fasching, C. L., Der, C. J., and Stanbridge, E. J. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 6665-6670[Abstract/Free Full Text]
  34. Shirasawa, S., Furuse, M., Yokoyama, N., and Sasazuki, T. (1993) Science 260, 85-88[Abstract/Free Full Text]
  35. Han, Z., Boyle, D. L., Chang, L., Bennett, B., Karin, M., Yang, L., Manning, A. M., and Firestein, G. S. (2001) J. Clin. Investig. 108, 73-81[CrossRef][Medline] [Order article via Infotrieve]
  36. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979) Biochemistry 18, 5294-5299[CrossRef][Medline] [Order article via Infotrieve]
  37. Jones, P. A. (1985) Cell 40, 485-486[CrossRef][Medline] [Order article via Infotrieve]
  38. Carmichael, J., DeGraff, W. G., Gazdar, A. F., Minna, J. D., and Mitchell, J. B. (1987) Cancer Res. 47, 936-942[Abstract/Free Full Text]
  39. Hanahan, D., and Weinberg, R. A. (2000) Cell 100, 57-70[CrossRef][Medline] [Order article via Infotrieve]
  40. Downward, J. (2003) Nat. Rev. Cancer 3, 11-22[CrossRef][Medline] [Order article via Infotrieve]
  41. Oldham, S. M., Cox, A. D., Reynolds, E. R., Sizemore, N. S., Coffey, R. J., Jr., and Der, C. J. (1998) Oncogene 16, 2565-2573[CrossRef][Medline] [Order article via Infotrieve]
  42. Zohn, I. M., Campbell, S. L., Khosravi-Far, R., Rossman, K. L., and Der, C. J. (1998) Oncogene 17, 1415-1438[CrossRef][Medline] [Order article via Infotrieve]
  43. Murga, C., Zohar, M., Teramoto, H., and Gutkind, J. S. (2002) Oncogene 21, 207-216[CrossRef][Medline] [Order article via Infotrieve]
  44. Shields, J. M., Mehta, H., Pruitt, K., and Der, C. J. (2002) Mol. Cell. Biol. 22, 2304-2317[Abstract/Free Full Text]
  45. Abe, K., Rossman, K. L., Liu, B., Ritola, K. D., Chiang, D., Campbell, S. L., Burridge, K., and Der, C. J. (2000) J. Biol. Chem. 275, 10141-10149[Abstract/Free Full Text]
  46. Whitehead, I. P., Campbell, S., Rossman, K. L., and Der, C. J. (1997) Biochim. Biophys. Acta 1332, F1-F23[Medline] [Order article via Infotrieve]
  47. Rountree, M. R., Bachman, K. E., Herman, J. G., and Baylin, S. B. (2001) Oncogene 20, 3156-3165[CrossRef][Medline] [Order article via Infotrieve]
  48. Vertino, P. M., Yen, R. W., Gao, J., and Baylin, S. B. (1996) Mol. Cell. Biol. 16, 4555-4565[Abstract]
  49. Ramchandani, S., MacLeod, A. R., Pinard, M., von Hofe, E., and Szyf, M. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 684-689[Abstract/Free Full Text]
  50. Yoder, J. A., Yen, R. W. C., Vertino, P. M., Bestor, T. H., and Baylin, S. B. (1996) J. Biol. Chem. 271, 31092-31097[Abstract/Free Full Text]
  51. Bonfils, C., Beaulieu, N., Chan, E., Cotton-Montpetit, J., and MacLeod, A. R. (2000) J. Biol. Chem. 275, 10754-10760[Abstract/Free Full Text]
  52. Pruitt, K., Pruitt, W. M., Bilter, G. K., Westwick, J. K., and Der, C. J. (2002) J. Biol. Chem. 277, 31808-31817[Abstract/Free Full Text]
  53. Contente, S., Kenyon, K., Sriraman, P., Subramanyan, S., and Friedman, R. M. (1999) Mol. Cell. Biochem. 194, 79-91[CrossRef][Medline] [Order article via Infotrieve]
  54. Peli, J., Schroter, M., Rudaz, C., Hahne, M., Meyer, C., Reichmann, E., and Tschopp, J. (1999) EMBO J. 18, 1824-1831[CrossRef][Medline] [Order article via Infotrieve]
  55. Esteller, M., Toyota, M., Sanchez-Cespedes, M., Capella, G., Peinado, M. A., Watkins, D. N., Issa, J. P., Sidransky, D., Baylin, S. B., and Herman, J. G. (2000) Cancer Res. 60, 2368-2371[Abstract/Free Full Text]
  56. Capella, G., Cronauer-Mitra, S., Pienado, M. A., and Perucho, M. (1991) Environ. Health Perspect. 93, 125-131[Medline] [Order article via Infotrieve]
  57. Guan, R. J., Fu, Y., Holt, P. R., and Pardee, A. B. (1999) Gastroenterology 116, 1063-1071[CrossRef][Medline] [Order article via Infotrieve]
  58. MacLeod, A. R., Rouleau, J., and Szyf, M. (1995) J. Biol. Chem. 270, 11327-11337[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
T. Sebastian and P. F. Johnson
RasV12-Mediated Down-regulation of CCAAT/Enhancer Binding Protein {beta} in Immortalized Fibroblasts Requires Loss of p19Arf and Facilitates Bypass of Oncogene-Induced Senescence
Cancer Res., March 15, 2009; 69(6): 2588 - 2598.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Goswami, S. Qiu, T. S. Dexheimer, P. Ranganathan, R. Burikhanov, Y. Pommier, and V. M. Rangnekar
Par-4 Binds to Topoisomerase 1 and Attenuates Its DNA Relaxation Activity
Cancer Res., August 1, 2008; 68(15): 6190 - 6198.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
X. Cheng
Silent Assassin: Oncogenic Ras Directs Epigenetic Inactivation of Target Genes
Sci. Signal., April 1, 2008; 1(13): pe14 - pe14.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. P. Kovacheva, T. J. Mellott, J. M. Davison, N. Wagner, I. Lopez-Coviella, A. C. Schnitzler, and J. K. Blusztajn
Gestational Choline Deficiency Causes Global and Igf2 Gene DNA Hypermethylation by Up-regulation of Dnmt1 Expression
J. Biol. Chem., October 26, 2007; 282(43): 31777 - 31788.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
O. M. Tsygankova, G. V. Prendergast, K. Puttaswamy, Y. Wang, M. D. Feldman, H. Wang, M. S. Brose, and J. L. Meinkoth
Downregulation of Rap1GAP Contributes to Ras Transformation
Mol. Cell. Biol., October 1, 2007; 27(19): 6647 - 6658.
[Abstract] [Full Text] [PDF]


Home page
Ann. Surg. Oncol.Home page
E. H. Jensen, J. M. Lewis, J. M. McLoughlin, M. D. Alvarado, A. Daud, J. Messina, S. Enkemann, T. J. Yeatman, V. K. Sondak, and A. I. Riker
Down-Regulation of Pro-Apoptotic Genes is an Early Event in the Progression of Malignant Melanoma
Ann. Surg. Oncol., April 1, 2007; 14(4): 1416 - 1423.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Moreno-Bueno, P. J. Fernandez-Marcos, M. Collado, M. J. Tendero, S. M. Rodriguez-Pinilla, I. Garcia-Cao, D. Hardisson, M. T. Diaz-Meco, J. Moscat, M. Serrano, et al.
Inactivation of the Candidate Tumor Suppressor Par-4 in Endometrial Cancer
Cancer Res., March 1, 2007; 67(5): 1927 - 1934.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. Liu, S. Hu, P. Hou, D. Jiang, S. Condouris, and M. Xing
Suppression of BRAF/MEK/MAP Kinase Pathway Restores Expression of Iodide-Metabolizing Genes in Thyroid Cells Expressing the V600E BRAF Mutant
Clin. Cancer Res., February 15, 2007; 13(4): 1341 - 1349.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H.-C. Chang, C.-Y. Cho, and W.-C. Hung
Silencing of the Metastasis Suppressor RECK by RAS Oncogene Is Mediated by DNA Methyltransferase 3b-Induced Promoter Methylation.
Cancer Res., September 1, 2006; 66(17): 8413 - 8420.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Levenson, T. L. Roth, F. D. Lubin, C. A. Miller, I-C. Huang, P. Desai, L. M. Malone, and J. D. Sweatt
Evidence That DNA (Cytosine-5) Methyltransferase Regulates Synaptic Plasticity in the Hippocampus
J. Biol. Chem., June 9, 2006; 281(23): 15763 - 15773.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/24/23363    most recent
M503083200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pruitt, K.
Right arrow Articles by Shields, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pruitt, K.
Right arrow Articles by Shields, J. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement