JBC PeproTech; Our Business is Cytokines!

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M411607200 on March 14, 2005

J. Biol. Chem., Vol. 280, Issue 25, 23490-23495, June 24, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/25/23490    most recent
M411607200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, K.
Right arrow Articles by Ding, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, K.
Right arrow Articles by Ding, J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Reversibility of Caspase Activation and Its Role during Glycochenodeoxycholate-induced Hepatocyte Apoptosis*

Kewei Wang{ddagger}, John J. Brems, Richard L. Gamelli, and Jinwen Ding§

From the Department of Surgery, Loyola University Medical Center, Maywood, Illinois 60153

Received for publication, October 12, 2004 , and in revised form, February 10, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The accumulation of glycochenodeoxycholate (GCDC) induced hepatocyte apoptosis in cholestasis. However, many hepatocytes still survived GCDC-induced apoptosis. The molecular mechanism for the survival of hepatocytes remains unclear. In the present study, isolated rat hepatocytes were cultured in William's E medium and treated with 50 µM GCDC. DNA, RNA, cell lysate, and nuclear proteins were collected at different intervals for DNA fragmentation assay, reverse transcription PCR, Western blotting, and gel mobility shift assay, respectively. GCDC-induced active caspases were detected as early as 2 h by Western blotting and kinetic caspase assay, whereas hepatocyte apoptosis was found at 4 h by DNA fragmentation and terminal deoxynucleotidyl transferase-mediated dUPT nick-end labeling assay. When GCDC was removed, the increased caspases as well as NF-{kappa}B could be restored to control level. A1/Bfl-1 and inducible nitric oxide synthase (iNOS) were up-regulated in 2 h of GCDC stimulation. After GCDC was removed, hepatocytes decreased expression of A1/Bfl-1, but not iNOS, to the control level. NF-{kappa}B activation coincided with the change of A1/Bfl-1. Survivin, cIAP1, cIAP2, XIAP, and A1/Bfl-1, but not iNOS, were down-regulated by pan-caspase inhibitor benzyloxycarbonyl-VAD-fluoromethyl ketone. In addition, benzyloxycarbonyl-VAD-fluoromethyl ketone inhibited release of cytochrome c and suppressed NF-{kappa}B activation. Our data suggested that caspase pathway is an important regulatory factor during hepatocyte apoptosis. GCDC-induced caspase response is reversible, which may activate anti-apoptotic genes to protect hepatocytes from apoptosis.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Bile acids are accumulated in cholestasis (1). The major bile acids include glycocholate and taurocholate, which are crucial for digestion and absorption of fat (2). Pathophysiologically, ursodeoxycholate and its taurine-conjugated form are protective to hepatocytes by directly suppressing disruption of mitochondrial membrane structure (3), whereas glycochenodeoxycholate (GCDC)1 is cytotoxic and contributes to hepatocellular injury (4). GCDC may cause hepatocyte damage by both acute necrosis and chronic apoptosis (5, 6). GCDC-induced hepatocyte apoptosis includes death receptor and mitochondrial pathways (7, 8). Moreover, two apoptotic pathways are mediated by caspase cascade activation (9). Caspases comprise a unique family of cysteine proteases involved in cytokine activation and in the execution of apoptosis (10).

Apoptosis, a cellular suicide program, is essential for correct development and homeostasis of multicellular organisms (11). Caspases are central initiators and executioners of apoptosis (10). Once activated, the caspases are responsible for cleavage of selective protein substrates that have been widely implicated in many models of apoptosis (11, 12). In particular, caspase 8 has been found to be a prominent signaling caspase involved in initiation of apoptosis by the Fas, tumor necrosis factor type I, and DR3 receptors (13, 14). Caspase 8 is abundant in the liver, allowing caspase to function as an initiator protease upstream of cathepsin B in bile salt-mediated hepatocyte apoptosis (15). Apoptosis is generally considered a fast process, because activation of caspases rapidly is followed by cell fragmentation and phagocytosis. However, different cells have distinct variances for caspase activation. Hepatocytes are sensitive to the activation of caspase to cause apoptosis, but neurons show a relative resistance that may allow a low level of caspase activity (16, 17). There are many anti-apoptotic genes, such as cIAP 1 and 2, TRAFs 1 and 2, IEX-1L, and A1/Bfl-1 (18–20). Some genes play the antiapoptotic role by direct activation, not by caspase pathway (21). The relationship between anti-apoptotic genes and caspase activation is not yet clearly understood.

We took advantage of the fact that caspases were activated by GCDC to examine the apoptotic mechanism of caspase cascade activation (7). The present study was designed to investigate the role of caspases in GCDC-induced hepatocyte apoptosis. Pan-caspase inhibitor Z-VAD-FMK was utilized to further elucidate the direct relationship between antiapoptotic genes and GCDC-induced caspase response. Our data suggest GCDC-induced hepatocyte apoptosis is modulated by caspase cascade activation. GCDC-induced caspase response is reversible, which may activate anti-apoptotic genes to protect hepatocytes from apoptosis.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—William's E medium and fetal calf serum were purchased from Invitrogen. Goat polyclonal antibody against Survivin, donkey anti-goat horseradish peroxidase, and mouse anti-{beta}-actin were obtained from Santa Cruz Biotechnology. Rabbit anti-mouse horseradish peroxidase was acquired from Cell Signaling Technology. All other chemicals were purchased from Sigma except as indicated.

Cell Culture—Primary hepatocytes were isolated from adult Sprague-Dawley rats by standard liver perfusion procedure (22). Dead cells were removed by Percoll (Sigma) and primary hepatocytes cultured in collagen-coated dishes (Falcon). Cells at a density of 5.5 x 105 were incubated in William's E medium containing 10% fetal bovine serum for varying intervals.

Caspase Assay—Cells were grown in 35-mm dishes and harvested with cell lysis buffer. Protein concentration of cell lysate was determined with the bicinchoninic acid assay method (Pierce). 100 µg of cell lysate was utilized to assay the activities of caspase-3 or caspase-8. The caspase assay kit was purchased from Calbiochem. The reaction system employed the colorimetric substrate IETD-pNA and calculated the activity as pmol/min.

Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) and Real-time Quantitative PCR—The RT-PCR kit was obtained from Qiagen. After reverse transcription, the cDNA product was amplified by PCR with Taq DNA polymerase using standard protocols. The amplified products (10 µl) were separated on 2% agarose gels, stained with ethidium bromide, and photographed using ultraviolet illumination. The 5' forward and 3' reverse complement PCR primers for amplification of Survivin were CTGATTTGGCCCAGTGTTTT and TCATCTGACGTCCAGTTTCG, respectively. For cIAP2, PCR primers were ACATTTCCCCAGCTGCCCATTC and CTCCTGCTCCGTCTGCTCCTCT. For cIAP1, PCR primers were CCAGCCTGCCCTCAAACCCTCT and GGGTCATCTCCGGGTTCCCAAC. For XIAP, PCR primers were CGCGAGCGGGGTTTCTCTACAC and ACCAGGCACGGTCACAGGGTTC. For A1/Bfl-1, PCR primers were ATCCACTCCCTGGCTGAGAACT and ACATCCAGGCCAATCTGCTCTT. For iNOS, PCR primers were CGAGGAGGCTGCCTGCAGACTGG and CTGGGAGGAGCTGATGGAGTAGTA. For glyceraldehyde-3-phosphate dehydrogenase, PCR primers were CCATCACCATCTTCCAGGAG and CCTGCTCACCACCTTCTTG. All PCR primers were synthesized from Integrated DNA Technology. The relative mRNA levels of Survivin were confirmed by real-time PCR. The data were normalized to the expression level of 18 S rRNA.

TUNEL Assay—The TdT-FragELTM DNA fragmentation detection kit was obtained from Oncogene Research Products, and instructions were followed for preparation of tissue slides. In this assay, terminal deoxynucleotidyl transferase (TdT) bound to exposed 3'-OH ends of DNA fragments generated in response to apoptotic signals and catalyzed the addition of biotin-labeled and unlabeled deoxynucleotides. Biotinylated nucleotides were detected using a streptavidin-horseradish peroxidase conjugate. Diaminobenzidine reacted with the labeled sample to generate an insoluble colored substrate at the site of DNA fragmentation. Counterstaining with methyl green aided in the morphological evaluation and characterization of normal and apoptotic cells.

Western Blotting—Samples were resolved by 10% SDS-polyacrylamide gel electrophoresis, transferred to Immobilon-P membrane (Millipore), and blotted with appropriate primary antibodies at a dilution of 1:1,000. Peroxidase-conjugated secondary antibodies were incubated at a dilution of 1:3,000. Bound antibody was visualized using chemiluminescent substrate (ECL; Amersham Biosciences) and exposed to Kodak X-Omat film. At least three independent experiments were performed.

Gel Mobility Shift Assay—Nuclear extract was prepared with the modified Dignam protocol. Concentration of nuclear protein was measured with the Bio-Rad protein assay. 4 µg of nuclear proteins and 2 µg of the nonspecific competitor poly(dI·dC) were incubated in binding buffer (100 mM Hepes, pH 7.6, 5 mM EDTA, 50 mM (NH4)2 S04, 5 mM dithiothreitol, Tween 20, 1% (w/v), 150 mM KCl) with 20 fmol/µl double-stranded DNA oligonucleotide. The NF-{kappa}B consensus binding sequence (5'-AGT TGA GGG GAC TTT CCC AGG C-3') was labeled with digoxin. Binding reactions were performed by incubating the samples for 15 min at 22 °C. Protein-DNA complexes were separated from the unbound DNA probe by electrophoresis through 6% native polyacrylamide gels containing 0.5x Tris borate/EDTA. The gel was transferred to Nytran membrane and exposed to Kodak films. At least three independent experiments were performed.

Statistical Analysis—All data represent at least three experiments using cells or extract from a minimum of three separate isolations and are expressed as means ± S.D. unless otherwise indicated. Differences between groups were compared using analysis of variance for repeated measures. All statistical analyses were performed with the software SPSS.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
GCDC-induced Hepatocyte Apoptosis—GCDC-induced hepatocyte apoptosis could be reflected by DNA fragmentation assay, caspase assay, and Western blotting (23–25). In the present study, rat hepatocytes were isolated and cultured in collagen-coated dishes with William's E medium containing 10% fetal bovine serum overnight. After stimulation with a concentration of 50 µM GCDC at different intervals, hepatocytes were harvested. DNA, RNA, and cell lysate protein were separately collected for further analysis. DNA fragmentation demonstrated hepatocyte apoptosis after treatment by 50 µM GCDC for 16 h (Fig. 1A). Caspases are divided into long prodomain caspases (caspase-2, -8, -9, and -10) and short prodomain caspases (caspase-3, -6, and -7) (26). In our study, caspase-8 and caspase-3 were selected as indicators to examine their involvement during GCDC-induced apoptosis. After 16 h, the activities of both caspase-3 and caspase-8 were increased. Moreover, the extent of activated caspase-3 was higher than that of activated caspase-8 (Fig. 1B). When the stimulation duration was decreased to 4 h in the presence of 50 µM GCDC, hepatocyte apoptosis was still found by DNA fragmentation assay (Fig. 2A). At 4 h, the anti-apoptotic gene Survivin was up-regulated (Fig. 2B). By Western blotting with crude cell lysate, the expression of caspase-3 and caspase-8 protein was initially increased at 2 h (Fig. 2C). Caspase activation was earlier than DNA fragmentation. The relative mRNA levels of Survivin were further confirmed by real-time PCR (Fig. 2D) and were identical to the level of Survivin protein by Western blotting (data not shown).



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 1.
Hepatocyte apoptosis induced by 50 µM GCDC for 16 h. A, genomic DNA fragmentation. 10 µg of DNA were run on each lane on 2% agarose gel. Lane 1, DNA marker; lane 2, control without GCDC treatment; lane 3, cells treated with 50 µM GCDC for 16 h. B, caspase activities in vitro. Protein concentration of cell lysate was determined with the bicinchoninic acid assay method (Pierce). 100 µg of cell lysates was utilized to assay the activity of caspase-3 or caspase-8. The reaction system employed the colorimetric substrate IETD-pNA and calculated the activity as pmol/min. The assay was set at 37 °C for 60 min. Cell lysate without GCDC treatment was used as control.

 
Reversibility of GCDC-induced Caspase Activation—With 50 µM GCDC, caspase was activated at 2 h but DNA fragmentation was enhanced at 4 h. These results suggested GCDC-induced hepatocyte apoptosis was duration-dependent. To address this issue, the cultured primary hepatocytes were stimulated with 50 µM GCDC for 2 h, followed by removal of medium containing GCDC; they were recultured with fresh medium (without GCDC) for another 4 h. Thereafter, hepatocytes were restimulated with the 50 µM GCDC for an additional 2 h. Caspase assays indicated that activities of caspase-3 and caspase-8 were increased in 2 h of incubation with the 50 µM GCDC, restored to control levels after removal of GCDC, and elevated again for an additional 2 h of restimulation with 50 µM GCDC (Fig. 3, A and B). After removal of GCDC, no apoptosis was detected by DNA fragmentation. The mechanism is unknown (Fig. 3C). TUNEL assay showed no difference in apoptotic rate among the four groups (Fig. 3D). However, apoptotic rate was increased significantly when GCDC was not removed (Fig. 4). NF-{kappa}B was activated after 2 h of GCDC stimulation, restored to control level after washing GCDC away, and reactivated by an additional 2 h of restimulation with 50 µM GCDC (Fig. 3E). Survivin expression was unchanged (Fig. 3F). The data suggested that caspase response and NF-{kappa}B activation were reversible in a short treatment (2 h) by 50 µM GCDC. Under low concentration GCDC (50 µM), the duration of GCDC treatment plays a crucial role in hepatocyte apoptosis.



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 2.
Hepatocyte apoptosis induced by 50 µM GCDC. A, DNA fragmentation. 10 µg of DNA was run on 2% agarose gel. B, activated Survivin gene was examined with RT-PCR. C, activated casepase-3 and 8 were examined by Western blotting. D, the relative mRNA levels of Survivin were determined by real-time PCR. The data were normalized to the expression level of 18 S rRNA (*, p < 0.01, n = 3).

 



View larger version (37K):
[in this window]
[in a new window]
  		FIG. 3.
Transient insults. The cultured primary hepatocytes were stimulated with 50 µM GCDC for 2 h, followed by removing the medium containing GCDC, washing with phosphate-buffered saline, and replacing with fresh medium (without GCDC) for another 4 h of culture. Thereafter, hepatocytes were restimulated with the 50 µM GCDC for an additional 2 h. A, caspase-3 activities. Values are mean ± S.D. (*, p < 0.01, n = 5). B, caspase-8 activities (*, p < 0.01; **, p < 0.05, n = 5). C, DNA fragmentation. 10 µg of DNA were run on 2% agarose gel. D, TUNEL assay for apoptotic rate (%). E, gel mobility shift assay was performed with 4 µg of nuclear proteins. F, RT-PCR of Survivin gene.

 



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 4.
TUNEL assay was utilized to identify apoptotic hepatocytes treated by 50 µM GCDC. A, floating cells (including dead and apoptotic cells) at 4 h. B, adherent cells at 4 h. C, TUNEL assay for apoptotic rate (*, p < 0.01, n = 4).

 



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 5.
Anti-apoptotic genes and hepatocyte apoptosis treated by 50 µM GCDC. A, RT-PCR analysis of cIAP1, cIAP2, XIAP, A1/Bfl-1, iNOS, Survivin, and glyceraldehyde-3-phosphate dehydrogenase. The amplified DNA was carried out on a 2% agarose gel and was visualized by ethidium bromide staining. B, NF-{kappa}B activation by gel mobility shift assay. C, the relative expression levels of Survivin were determined by real-time PCR. The data were normalized to the expression level of 18 S rRNA.

 
GCDC-induced Gene Expression—After 50 µM GCDC stimulation, some cells died of apoptosis and floated in supernatant (Fig. 4A) but others attached to the dish and were alive (Fig. 4B). It was unclear whether anti-apoptotic genes were up-regulated and accounted for cell survival. Therefore, RNA was isolated from cells and RT-PCR was performed to detect gene transcription. In the anti-apoptotic gene family we selected cIAP1, cIAP2, XIAP, A1/Bfl-1, iNOS, and Survivin. There were no changes among cIAP1, cIAP2, XIAP, and Survivin (Fig. 5A), but results were different for A1/Bfl-1 and iNOS. The A1/Bfl-1 gene was increased at 2 h and then decreased to the baseline level in another 4 h (without GCDC) of extended culture. iNOS showed higher amplification at 2 h but maintained at the same level in another 4 h (without GCDC) of culture. To demonstrate gene expression from bottom-attached cells, we washed away the top dead cells, isolated RNA from bottom cells, and then repeated RT-PCR. Expression of genes from dish-attached cells was completely identical (data not shown). NF-{kappa}B activation was also increased at 2 h and then restored to the baseline level in another 4 h (without GCDC) of culture (Fig. 5B). Survivin expression by Western blotting was unchanged (data not shown). The relative expression levels of Survivin were measured by real-time PCR (Fig. 5C).

Gene Expression Affected by Caspase Inhibitor—Caspases mediate the intracellular activation of other caspases and selectively cleave distinct intracellular substrates, leading to dismantling of the architecture, signaling apparatus, and repair mechanisms of a cell. Eventually, caspases induce the activation of endonucleases that complete cellular suicide by internucleosomal DNA fragmentation (27). Our study found that activities of caspase-3 and caspase-8 were increased at 2 h in the presence of 50 µM GCDC. However, when GCDC stimulation was removed at 2 h, activities of caspases could be decreased and restored to control level by an unknown mechanism. GCDC-induced caspase activation is reversible. Next we investigated the correlation of caspase activation and anti-apoptotic gene expression. Pan-caspase inhibitor (Alexis, Z-VAD-FMK, 260 020 M001) was utilized to treat hepatocytes. Caspase-3 and caspase-8 were significantly inhibited (Fig. 6). When 50 µM GCDC was added into medium to stimulate hepatocytes for 4 h, activity of caspase-3 was increased to 11.40 pmol/min at 4 h compared with 3.98 pmol/min of control (without GCDC), whereas activity of caspase-8 was increasingly elevated from baseline 3.27 pmol/min to 8.53 pmol/min at 4 h. 50 µM Z-VAD-FMK inhibited caspase-3 and caspase-8 60.26 and 65.88%, respectively. Expression of Survivin, cIAP1, cIAP2, XIAP, A1/Bfl-1, but not iNOS, was down-regulated (Fig. 7A). The protein level of Survivin was consistent with Survivin mRNA (Fig. 7B).



View larger version (9K):
[in this window]
[in a new window]
  		FIG. 6.
50 µM pan-caspase inhibitor (Alexis, Z-VAD-FMK, 260 020 M001) to treat hepatocytes. When 50 µM GCDC was added to medium for 4 h, caspase-3 and caspase-8 were inhibited significantly. Values are mean ± S.D. (*, p < 0.01, n = 4).

 



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 7.
Pan-caspase inhibitor and anti-apoptotic genes. A, 50 µM Z-VAD-FMK and expression of Survivin, XIAP, A1/Bfl-1, cIAP1, cIAP2, and iNOS. B, Z-VAD-FMK and Survivin expression by Western blotting.

 
Pathway for GCDC-induced Hepatocyte Apoptosis—GCDC induces hepatocyte apoptosis by death receptor or the mitochondrial pathway (28). GCDC causes direct activation of Fas, which stimulates FADD, caspase-8 activation, and subsequent apoptosis either through Bid cleavage and translocation to mitochondria or by direct activation of downstream effector caspases. In mitochondria there are actually two pathways. One directly stimulates generation of reactive oxygen species from the respiratory chain, which induces the permeability transition and cytochrome c release into cytosol. The other causes translocation of Bax to mitochondria, which function as channels for cytochrome release into cytosol and activation of downstream effector caspases (8). After stimulation with a concentration of 50 µM GCDC, cytochrome c was increased even at 4 h (Fig. 8A). When 50 µM Z-VAD-FMK was used, cytochrome c release was decreased. As hepatocytes were treated by 50 µM GCDC, caspase 9 was increased at 4 h as well. However, under co-treatment of GCDC plus Z-VAD-FMK, the activity of caspase 9 was reduced (Fig. 8B). In addition, Z-VAD-FMK inhibited NF-{kappa}B activation induced by 50 µM GCDC (Fig. 8C). The role of cytochrome c and caspase 9 is worth further investigation. GCDC-induced hepatocyte apoptosis was a useful model to study the mechanism of apoptosis and pathogenesis of cholestatic liver injury. Although the roles of anti-apoptotic genes and NF-{kappa}B activation has been incompletely understood, our study provides a clue to their protective function against GCDC-induced hepatocyte apoptosis.



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 8.
Pan-caspase inhibitor Z-VAD-FMK (50 µM) decreased activity of caspase-9, inhibited release of cytochrome c, and suppressed NF-{kappa}B activation during GCDC (50 µM)-induced hepatocyte apoptosis. A, cytochrome c was detected by Western blotting. B, expression of caspase 9. C, NF-{kappa}B activation.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Accumulation of bile acids induces hepatocyte apoptosis and necrosis (29). Our study demonstrated that low dosages (50 µM) of GCDC caused hepatocyte apoptosis, not necrosis. The increase of caspases could be restored to control level after the low dosage of GCDC was removed. The activities of caspases were reversible. GCDC also induced expression of anti-apoptotic genes, such as Survivin, A1/Bfl-1, and iNOS. Moreover, activities of caspases were correlated to those genes because the pan-caspase inhibitor Z-VAD-FMK may inhibit expression of Survivin, cIAP1, cIAP2, XIAP, A1/Bfl-1, but not iNOS. At present we cannot completely understand the role of those genes during GCDC-induced hepatocyte apoptosis.

In inflammatory conditions hepatocyte survival is dependent on the protective function of anti-apoptotic genes (30). The expression of anti-apoptotic genes is mediated by caspase response, which can be inhibited by Z-VAD-FMK (31). Many important anti-apoptotic genes such as the inhibitor of apoptosis proteins (IAP) family, A1/Bfl-1, and iNOS have been identified that have anti-apoptotic roles in mature hepatocytes by controlling the transcription of specific survival genes (32). Although our preliminary results did not indicate the altered levels of cIAP1, cIAP2, and XIAP in 2 h of stimulation, the potential role for Survivin, A1/Bfl-1, and iNOS had been investigated. Survivin inhibits apoptosis via a pathway independent of bcl-2 (33). Survivin modulates caspase activation as well as Fas-mediated hepatic apoptosis, which is regulated via the mitochondrial pathway (34). Mitochondrial A1/Bfl-1, a member of the Bcl-2 family, is expressed in various tissues during development and adult life as well as in cancer cell lines. A1/Bfl-1 was shown to protect cells from apoptosis (35). A1/Bfl-1 induced by cytokines suppresses the release of cytochrome c (20). Nitric oxide (NO) inhibits caspase-3 activity in hepatocytes (37). NO protects hepatocytes from tumor necrosis factor-{alpha}/ActD-induced apoptosis via the interruption of mitochondrial apoptotic signaling through S-nitrosylation of caspase-8 (38). NO production depends on the expression of iNOS in response to inflammatory cytokines (39, 40). It is known that iNOS gene transfer could suppress hepatocyte apoptosis (41). iNOS is heterogeneously distributed in liver (42, 43), which may represent a mechanism through which hepatocytes control the degree of apoptosis in the liver (44, 45).

NF-{kappa}B is the prototypic transcription factor in eukaryotic cells known to play a pivotal role in transactivation of promoters for genes involved in inflammation, immune responses, and anti-apoptotic mechanism (46). The anti-apoptotic molecules regulated by NF-{kappa}B include cIAP 1 and 2, TRAFs 1 and 2, IEX-1L, and A20 (32, 33). The IAP family has been suggested to act as direct inhibitors of caspases. NF-{kappa}B activation suppresses mitochondrial release of cytochrome c through the activation of a Bcl-2 homologue A1/Bfl-1 (20). The expression of iNOS can be regulated at the level of transcription, and NF-{kappa}B activation is essential for its expression (47). NF-{kappa}B activates endogenous iNOS via IKK{beta} and provides protection from apoptosis (36).

In summary, GCDC-induced hepatocyte apoptosis is mediated by caspase activation, which is a highly regulated process. Caspase cascade may activate anti-apoptotic genes to prevent hepatocytes from apoptosis. GCDC-induced caspase response is reversible, which may be a useful approach for blocking GCDC-induced hepatocyte apoptosis.


   FOOTNOTES
 
* This work was supported by a Falk Medical Research Foundation grant. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§ Present address: University of Illinois at Chicago, Chicago, IL 60612. Back

{ddagger} To whom correspondence should be addressed: Dept. of Cell Biology, Neurobiology, and Anatomy, Bldg. 101, Rm. 2726, Loyola University Medical Center, 2160 S. First Ave., Maywood, IL 60153. Tel.: 708-216-4561; Fax: 708-216-8523; E-mail: kwang1{at}lumc.edu.

1 The abbreviations used are: GCDC, glycochenodeoxycholate; Z-VAD-FMK, benzyloxycarbonyl-VAD-fluoromethyl ketone; RT, reverse transcription; TUNEL, terminal deoxynucleotidyl transferase-mediated dUPT nick-end labeling; iNOS, inducible nitric oxide synthase; IAP, inhibitor of apoptosis proteins. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Lauterburg, B. H., Dickson, E. R., Pineda, A. A., and Taswell, H. F. (1980) Int. J. Artif. Organs. 3, 281–285[Medline] [Order article via Infotrieve]
  2. Thompson, M. B. (1996) Toxicol. Pathol. 24, 62–71[Medline] [Order article via Infotrieve]
  3. Sola, S., Brito, M. A., Brites, D., Moura, J. J., and Rodrigues, C. M. (2002) Clin. Sci. (Lond.) 103, 475–485[Medline] [Order article via Infotrieve]
  4. Rust, C., Karnitz, L. M., Paya, C. V., Moscat, J., Simari, R. D., and Gores, G. J. (2000) J. Biol. Chem. 275, 20210–20216[Abstract/Free Full Text]
  5. Zeid, I. M., Bronk, S. F., Fesmier, P. J., and Gores, G. J. (1997) Hepatology 25, 81–86[Medline] [Order article via Infotrieve]
  6. Gonzalez, B., Fisher, C., and Rosser, B. G. (2000) Mol. Cell. Biochem. 207, 19–27[CrossRef][Medline] [Order article via Infotrieve]
  7. Sodeman, T., Bronk, S. F., Roberts, P. J., Miyoshi, H., and Gores, G. J. (2000) Am. J. Physiol. Gastrointest. Liver Physiol. 278, G992-G999[Abstract/Free Full Text]
  8. Lieser, M. J., Park, J., Natori, S., Jones, B. A., Bronk, S. F., and Gores, G. J. (1998) Gastroenterology 115, 693–701[CrossRef][Medline] [Order article via Infotrieve]
  9. Albright, C. D., Borgman, C., and Craciunescu, C. N. (2003) Exp. Mol. Pathol. 74, 256–261[CrossRef][Medline] [Order article via Infotrieve]
  10. Chandler, J. M., Cohen, G. M., and MacFarlane, M. (1998) J. Biol. Chem. 273, 10815–10818[Abstract/Free Full Text]
  11. Opferman, J. T., and Korsmeyer, S. J. (2003) Nat. Immunol. 4, 410–415[CrossRef][Medline] [Order article via Infotrieve]
  12. Contestabile, A. (2002) Cerebellum 1, 41–55[CrossRef][Medline] [Order article via Infotrieve]
  13. Newton, K., and Strasser, A. (2003) Genes Dev. 17, 819–825[Free Full Text]
  14. Muzio, M. (1998) Int. J. Clin. Lab. Res. 28, 141–147[CrossRef][Medline] [Order article via Infotrieve]
  15. Faubion, W. A., Guicciardi, M. E., Miyoshi, H., Bronk, S. F., Roberts, P. J., Svingen, P. A., Kaufmann, S. H., and Gores, G. J. (1999) J. Clin. Investig. 103, 137–145[Medline] [Order article via Infotrieve]
  16. Eldadah, B. A., and Faden, A. I. (2000) J. Neurotrauma 17, 811–829[Medline] [Order article via Infotrieve]
  17. Chan, S. L., Griffin, W. S., and Mattson, M. P. (1999) J. Neurosci. Res. 57, 315–323[CrossRef][Medline] [Order article via Infotrieve]
  18. Roy, N., Deveraux, Q. L., Takahashi, R., Salvesen, G. S., and Reed, J. C. (1997) EMBO J. 16, 6914–6925[CrossRef][Medline] [Order article via Infotrieve]
  19. Domachowske, J. B., Bonville, C. A., Mortelliti, A. J., Colella, C. B., Kim, U., and Rosenberg, H. F. (2000) J. Infect. Dis. 181, 824–830[CrossRef][Medline] [Order article via Infotrieve]
  20. Wang, C. Y., Guttridge, D. C., Mayo, M. W., and Baldwin, A. S., Jr. (1999) Mol. Cell. Biol. 19, 5923–5929[Abstract/Free Full Text]
  21. Tatton, W. G., and Chalmers-Redman, R. M. (1996) Neurology 47, (Suppl.) 171–183
  22. Ding, J. W., Ning, Q., Liu, M. F., Lai, A., Leibowitz, J., Peltekian, K. M., Cole, E. H., Fung, L. S., Holloway, C., Marsden, P. A., Yeger, H., Phillips, M. J., and Levy, G. A. (1997) J. Virol. 71, 9223–9230[Abstract]
  23. Zeisel, S. H., da Costa, K. A., Albright, C. D., and Shin, O. H. (1995) Adv. Exp. Med. Biol. 375, 65–74[Medline] [Order article via Infotrieve]
  24. Knight, T. R., and Jaeschke, H. (2002) Toxicol. Appl. Pharmacol. 181, 133–141[CrossRef][Medline] [Order article via Infotrieve]
  25. Kwon, Y. H., Jovanovic, A., Serfas, M. S., and Tyner, A. L. (2003) J. Biol. Chem. 278, 30348–30355[Abstract/Free Full Text]
  26. Denault, J. B., and Salvesen, G. S. (2003) J. Biol. Chem. 278, 34042–34050[Abstract/Free Full Text]
  27. Kim, P. K., Kwon, Y. G., Chung, H. T., and Kim, Y. M. (2002) Ann. N. Y. Acad. Sci. 962, 42–52[Abstract/Free Full Text]
  28. Green, D. R. (1998) Cell 94, 695–698[CrossRef][Medline] [Order article via Infotrieve]
  29. Hofmann, A. F. (2002) Liver 22, Suppl. 2, 14–19[CrossRef][Medline] [Order article via Infotrieve]
  30. Schoemaker, M. H., Ros, J. E., Homan, M., Trautwein, C., Liston, P., Poelstra, K., van Goor, H., Jansen, P. L., and Moshage, H. (2002) J. Hepatol. 36, 742–750[CrossRef][Medline] [Order article via Infotrieve]
  31. Qi, L., and Sit, K. H. (2000) Apoptosis 5, 379–388[Medline] [Order article via Infotrieve]
  32. LaCasse, E. C., Baird, S., Korneluk, R. G., and MacKenzie, A. E. (1998) Oncogene 17, 3247–3259[CrossRef][Medline] [Order article via Infotrieve]
  33. Chiou, S. K., Jones, M. K., and Tarnawski, A. S. (2003) Med. Sci. Monit. 9, PI25–129[Medline] [Order article via Infotrieve]
  34. Conway, E. M., Pollefeyt, S., Steiner-Mosonyi, M., Luo, W., Devriese, A., Lupu, F., Bono, F., Leducq, N., Dol, F., Schaeffer, P., Collen, D., and Herbert, J. M. (2002) Gastroenterology 123, 619–631[CrossRef][Medline] [Order article via Infotrieve]
  35. Park, I., Lee, S., Whang, D., Hong, W., Choi, S., Shin, H., Choe, T., and Hong, S. (1997) Anticancer Res. 17, 4619–4622[Medline] [Order article via Infotrieve]
  36. Hatano, E., Bennett, B. L., Manning, A. M., Qian, T., Lemasters, J. J., and Brenner, D. A. (2001) Gastroenterology 120, 1251–1262[CrossRef][Medline] [Order article via Infotrieve]
  37. Schoemaker, M. H., Gommans, W. M., de la Rosa, L. C., Homan, M., Klok, P., Trautwein, C., van Goor, H., Poelstra, K., Haisma, H. J., Jansen, P. L., and Moshage, H. (2003) J. Hepatol. 39, 153–161[CrossRef][Medline] [Order article via Infotrieve]
  38. Kim, Y. M., Kim, T. H., Chung, H. T., Talanian, R. V., Yin, X. M., and Billiar, T. R. (2000) Hepatology 32, 770–778[CrossRef][Medline] [Order article via Infotrieve]
  39. Kim, Y. M., de Vera, M. E., Watkins, S. C., and Billiar, T. R. (1997) J. Biol. Chem. 272, 1402–1411[Abstract/Free Full Text]
  40. Kim, Y. M., Son, K., Hong, S. J., Green, A., Chen, J. J., Tzeng, E., Hierholzer, C., and Billiar, T. R. (1998) Mol. Med 4, 179–190[Medline] [Order article via Infotrieve]
  41. Tzeng, E., Billiar, T. R., Williams, D. L., Li, J., Lizonova, A., Kovesdi, I., and Kim, Y. M. (1998) Surgery 124, 278–283[Medline] [Order article via Infotrieve]
  42. Geller, D. A., Lowenstein, C. J., Shapiro, R. A., Nussler, A. K., Di Silvio, M., Wang, S. C., Nakayama, D. K., Simmons, R. L., Snyder, S. H., and Billiar, T. R. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 3491–3495[Abstract/Free Full Text]
  43. McNaughton, L., Puttagunta, L., Martinez-Cuesta, M. A., Kneteman, N., Mayers, I., Moqbel, R., Hamid, Q., and Radomski, M. W. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 17161–17166[Abstract/Free Full Text]
  44. de Belder, A. J., and Radomski, M. W. (1994) J. Hypertens. 12, 617–624[Medline] [Order article via Infotrieve]
  45. Li, J., and Billiar, T. R. (1999) Am. J. Physiol. 276, G1069-G1073[Medline] [Order article via Infotrieve]
  46. Xiong, S., She, H., Takeuchi, H., Han, B., Engelhardt, J. F., Barton, C. H., Zandi, E., Giulivi, C., and Tsukamoto, H. (2003) J. Biol. Chem. 278, 17646–17654[Abstract/Free Full Text]
  47. Xie, Q. W., Kashiwabara, Y., and Nathan, C. (1994) J. Biol. Chem. 269, 4705–4708[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
R. Reinehr, A. Sommerfeld, V. Keitel, S. Grether-Beck, and D. Haussinger
Amplification of CD95 Activation by Caspase 8-induced Endosomal Acidification in Rat Hepatocytes
J. Biol. Chem., January 25, 2008; 283(4): 2211 - 2222.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
F. Li and M. G. Brattain
Role of the SurvivinGene in Pathophysiology
Am. J. Pathol., July 1, 2006; 169(1): 1 - 11.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/25/23490    most recent
M411607200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, K.
Right arrow Articles by Ding, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, K.
Right arrow Articles by Ding, J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.