HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 280, Issue 25, 23643-23652, June 24, 2005

This Article Abstract Full Text (PDF) All Versions of this Article: 280/25/23643    most recent M501374200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Okhrimenko, H. Articles by Brodie, C. Search for Related Content PubMed PubMed Citation Articles by Okhrimenko, H. Articles by Brodie, C. Social Bookmarking                      What's this?

Roles of Tyrosine Phosphorylation and Cleavage of Protein Kinase C in Its Protective Effect Against Tumor Necrosis Factor-related Apoptosis Inducing Ligand-induced Apoptosis^*

Hana Okhrimenko, Wei Lu, Cunli Xiang, Donghong Ju, Peter M. Blumberg¶, Ruth Gomel, Gila Kazimirsky, and Chaya Brodie||

From the Gonda (Goldschmied) Medical Diagnosis Research Center, Faculty of Life-Sciences, Bar-Ilan University, Ramat-Gan, Israel 52900, the Department of Neurosurgery, Hermelin Brain Tumor Center, Henry Ford Hospital, Detroit, Michigan 48202, and the ^¶Laboratory of Cellular Carcinogenesis and Tumor Promotion, NCI, National Institutes of Health, Bethesda, Maryland 20892

Received for publication, February 7, 2005 , and in revised form, March 15, 2005.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Protein kinase C (PKC) regulates cell apoptosis in a cell- and stimulus-specific manner. Here, we studied the role of PKC in the apoptotic effect of TRAIL in glioma cells. We found that transfection of the cells with a PKC kinase-dead mutant (K376R) or with a small interfering RNA targeting the PKC mRNA increased the apoptotic effect of tumor necrosis factor-related apoptosis inducing ligand (TRAIL), whereas overexpression of PKC decreased it. PKC acted downstream of caspase 8 and upstream of cytochrome c release from the mitochondria. TRAIL induced cleavage of PKC within 2–3 h of treatment, which was abolished by caspase 3, 8, and 9 inhibitors. The cleavage of PKC was essential for its protective effect because overexpression of a caspase-resistant mutant (PKCD327A) did not protect glioma cells from TRAIL-induced apoptosis but rather increased it. TRAIL induced translocation of PKC to the perinuclear region and the endoplasmic reticulum and phosphorylation of PKC on tyrosine 155. Using a PKCY155F mutant, we found that the phosphorylation of PKC on tyrosine 155 was essential for the cleavage of PKC in response to TRAIL and for its translocation to the endoplasmic reticulum. In addition, phosphorylation of PKC on tyrosine 155 was necessary for the activation of AKT in response to TRAIL. Our results indicate that PKC protects glioma cells from the apoptosis induced by TRAIL and implicate the phosphorylation of PKC on tyrosine 155 and its cleavage as essential factors in the anti-apoptotic effect of PKC.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Apoptosis is a genetically controlled process of selective cell deletion involved in normal cell development and turnover (1). Apoptosis is triggered by genotoxic reagents, stress responses, or ligation of membrane death receptors (2). The apoptotic response is characterized by extrinsic and intrinsic pathways (3) that can converge at the mitochondria leading to the release of cytochrome c and activation of caspase 9 and downstream effector caspases (4). Proteins that play a role in this process include the Bcl2 family (5) and the caspases, which are cysteine-dependent aspartate-specific proteases (6, 7). In addition, the apoptotic response is also regulated by various kinases (8), among the best characterized being phosphoinositide 3-kinase/Akt (9), members of the mitogen-activated protein kinase family (10), and various PKC isoforms (11).

PKC,¹ a ubiquitously expressed isoform of the novel PKC subfamily (12), has been shown to regulate cell apoptosis in various cellular systems (13). Its function and regulation are clearly complex, however, because PKC can be either proapoptotic or anti-apoptotic, depending on the specific cellular system and the specific ligand. PKC acts in a pro-apoptotic fashion in response to etoposide (14, 15), cytosine arabinoside (16), and in response to UV (17) and -radiation (18). The pro-apoptotic function of PKC in these systems is typically associated with its cleavage by caspase 3 in the hinge region, which results in a phospholipid-independent activation of the enzyme (19–22). It is noteworthy, that PKC can induce apoptosis in a cleavage-independent (23) or a kinase-independent manner (24) in some instances, emphasizing the complex role of PKC in the regulation of cell apoptosis.

In other systems, in contrast to the above examples, PKC has been clearly shown to function in an anti-apoptotic fashion. Thus, PKC played a role in the anti-apoptotic effect of fibroblast-like growth factor in granulosa cells (25) and in serum-deprived PC12 cells (26) and protected macrophages from nitric oxide-induced apoptosis (27). Factors that are associated with the effects of PKC on cell apoptosis are its phosphorylation on tyrosine residues and its subcellular localization. Tyrosine phosphorylation of PKC occurs in response to many apoptotic stimuli and it has been associated with the apoptotic function of PKC (15, 28–31). Similarly, PKC translocates to the mitochondria (32), Golgi (31), and nucleus (15, 33) in response to various stimuli and specific apoptosis-related PKC substrates have been identified in the mitochondria (34) and nucleus (21, 35).

Tumor necrosis factor-related apoptosis inducing ligand (TRAIL; Apo2 ligand) belongs to the tumor necrosis factor superfamily and induces apoptosis in many transformed cells including some glioma cell lines and primary cultures (36, 37). TRAIL acts by formation of the death-inducing signaling complex that is also common to other members of the death receptors (38). Caspase 8 is then activated at the death-inducing signaling complex and leads to two different apoptotic pathways: a mitochondrial-independent pathway via the effector caspases 3 and 7 and a mitochondrial-dependent pathway via activation of caspase 9 (39). The signal transduction pathways that are involved in the TRAIL apoptotic effect are not fully understood. Recent studies reported that TRAIL activates the transcriptional factor NF-B and c-Jun N-terminal kinase in various cellular systems (40) and that NF-B (41) and phosphatidylinositol 3-kinase/AKT (42) are involved in the resistance of some transformed cells to the apoptotic effect of TRAIL. In addition, PKC signaling, mainly in response to PMA activation, has been implicated in the attenuation of the apoptotic signal induced by TRAIL (43, 44); however, the involvement of the PKC isoform in response to TRAIL has not been described.

In the present study, we examined the role of PKC in the apoptotic effect of TRAIL in glioma cells and analyzed the molecular mechanisms underlying its effects. We found that PKC protected glioma cells from the apoptosis induced by TRAIL and that this effect was dependent on the phosphorylation of PKC on tyrosine 155 and on its caspase-dependent cleavage.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Materials—Polyclonal anti-PKC antibodies (C-20 and C-17) and anti-phospho-PKC Tyr⁵², Tyr¹⁵⁵, and Tyr¹⁸⁷ were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). TRAIL was from Peprotech (Rocky Hill, NJ), anti-calnexin antibody was purchased from BD Biosciences (San Diego, CA), and anti-active caspase 3 antibody, anti-phospho-AKT (Ser⁴⁷³), and anti-AKT were obtained from Cell Signaling (Beverly, MA). The caspase inhibitors DEVD-fmk, Z-VAD-fmk, Z-IETD, and Z-LEHD were obtained from Calbiochem (La Jolla, CA). Leupeptin, aprotinin, phenylmethylsulfonyl fluoride, and sodium vanadate were obtained from Sigma.

Site-directed Mutagenesis of PKC—PKC cloned into the pEGFP plasmid served as a template vector for the site-directed mutagenesis using the QuikChange Site-directed Mutagenesis Kit (Stratagene, La Jolla, CA). Conversion of tyrosine residues at sites 52, 155, and 187 into phenylalanine was performed as previously described (45). A PKC K376R dominant mutant was generated as previously described (15). The caspase cleavage site of PKC, aspartate 327, was mutated to alanine using the following primers: sense, 5'-GTGACATCCTAGCCAACAACGGGACC-3' and antisense, 5'-GGTCCCGTTGTTGGCTAGGATGTCAC-3'. The mutation was confirmed by DNA sequencing. PKC and the PKC mutants were subcloned into the pCMV-Tag 2b expression vector (Stratagene) generating PKC or PKC mutants with a N-terminal FLAG tag. The activities and translocations of the PKC tyrosine mutants and the PKCK376R were already characterized (15, 28, 45). The activity of the PKCD327A mutant was similar to that of PKC WT using the immune complex kinase assay. Similarly, PKCD327A translocated to the plasma and perinuclear membranes in response to PMA, similar to the translocation of PKC (data not shown).

Construction of PKC-GFP and PKC155 Fusion Proteins—cDNAs encoding the murine PKC and the PKCY155F mutant were fused into the N-terminal enhanced GFP vector pEGFP-N1 (Clontech Laboratories, Palo Alto, CA) as previously described (45). Briefly, the original pEGFP-N1 vector was modified by the insertion of a MluI site in the plasmid polylinker and the clones containing the GFP-PKC or GFP-PKCY155F were constructed by the excision of PKC or PKCY155F from pCMV tag 2b PKC plasmids by digestion with XhoI and MluI. The inserts were then ligated into the modified GFP vector using the same restriction sites. DNA sequencing of the GFP-PKC constructs confirmed the intended reading frame. The expression and activities of these plasmids were already described (15, 28, 45).

Construction of the PKC Catalytic and Regulatory Domains—The construction of the PKC regulatory and catalytic domains was performed using the following primers: PKC-reg sense, GATGCTCGAGGCCACCATGGCACCCTTCCTTCGCATTT; PKC-reg, ASGATGACGCGTGTCTAGGATGTCACTCCCAGAGAC; PKC-cat sense, GATGCTCGAGGCCACCATGAACAACGGGACCTATGGCAAG, and PKC-cat, ASGGACGCGTAATGTCCAGGAATTGCT. The PKC regulatory and catalytic fragments were subcloned into the EGFP and the pCMV tag 2b expression vectors.

Generation of PKC Chimeras—The PKC chimeras were generated by exchanging the regulatory and catalytic domains of PKC and - as previously described (15). PKC/ refers to the chimera with the PKC regulatory domain and the PKC catalytic domain, and PKC/ refers to the reciprocal chimera. The PKC cDNAs were subcloned into the pCMV tag 2b (Stratagene) generating PKC chimeras with an N-terminal FLAG tag. The expression of these chimeras and their activities were recently described (15, 45).

A172 Glioma Cultures and Cell Transfection—A172 cells were grown in medium consisting of Dulbecco's modified Eagle's medium containing 10% heat-inactivated fetal calf serum, 2 mM glutamine, penicillin (50 units/ml), and streptomycin (0.05 mg/ml). The cells were transfected by electroporation using the Nucleofector device (Amaxa Inc., Gaithersburg, MD) either with the empty vector or with expression vectors for the PKC and PKC mutants. Transfection efficiency using nucleofection was about 80–90%.

siRNA Transfections—siRNA duplexes (siRNAs) were obtained from Dharmacon (Lafayette, CO) and consisted of a pool of 4 PKC siRNA duplexes. Transfection of siRNAs was performed using 50 nM PKC or scrambled siRNAs and Oligofectamine (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. PKC protein levels were determined using Western blot analysis.

Adenovirus Preparation and Infection—The AdEasy system was kindly provided by Dr. Vogelstein (The Johns Hopkins University School of Medicine, Baltimore, MD) (46). PKC and the different PKC mutants were first cloned into the pShuttle-CMV vector as previously described (47). The plasmids were then linearized by digestion with PmeI and were transformed into Escherichia coli BJ5183-AD-1 competent cells (Stratagene) carrying the pAdEasy-1 plasmid that encodes the adenovirus-5 backbone. Recombination was confirmed by restriction and PCR analyses. The linearized recombinant plasmids were transfected into HEK293 cells. Viruses were collected after 7–10 days and were further amplified. An adenovirus expressing the LacZ gene was used as a control.

Cells were incubated with 5 multiplicity of infection of the appropriate recombinant adenovirus vectors for 1 h. The medium was then replaced with fresh medium and the cells were used 24–48 h post-infection.

Measurements of Cell Apoptosis—Cell apoptosis was measured using propidium iodide staining and analysis by flow cytometry (15) and ELISA (Cell Death Detection ELISA Kit) using anti-histone antibodies. Cells (1 x 10⁶/ml) were plated in 6-well plates and subjected to the indicated treatments. Detached cells and trypsinized, adherent cells were pooled, fixed in 70% ethanol for 1 h on ice, washed with PBS, and treated for 15 min with RNase (50 µM) at room temperature. Cells were then stained with propidium iodide (5 µg/ml) and analyzed on a BD Biosciences cell sorter.

For anti-histone ELISA (Cell Death Detection ELISA kit), cellular extracts containing histone-associated DNA fragments were incubated in 96-well plates coated with anti-histone antibodies for 2 h. Plates were then washed and incubated with anti-DNA antibodies conjugated to peroxidase for an additional 2 h. Substrate solution was added and absorbance was measured at 405 nm.

Measurement of Caspase 8 Activity—Caspase 8 activity was measured using the caspase fluorescent substrate/inhibitor QuantiPak assay kit obtained from BIOMOL (Plymouth Meeting, PA) using the fluorescent substrate Ac-IETD-AMC according to the manufacturer's recommendations.

Cytochrome c Release—Cytochrome c release from the mitochondria was determined in the cytosolic fraction. Mitochondrial and cytosolic fractions were isolated using the ApoAlert Cell Fractionation Kit (Clontech, BD Biosciences) according to the manufacturer's instructions. Briefly, control and TRAIL-treated cells were centrifuged at 600 x g for 5 min at 4 °C. Cell pellets were resuspended with 0.8 ml of ice-cold fractionation buffer and incubated on ice for 10 min. Cells were then homogenized with an ice-cold Dounce homogenizer and centrifuged at 700 x g for 10 min. The supernatants were then centrifuged at 10,000 x g for 25 min at 4 °C and the supernatants (cytosolic fraction) and pellets (mitochondrial fraction) were collected. Cytochrome c was identified in the cytosolic fraction by using a rabbit anti-cytochrome c antibody.

Preparation of Cell Homogenates—Cell pellets were resuspended in 100 µl of lysis buffer (25 mM Tris-HCl, pH 7.4, 50 mM NaCl, 0.5% sodium deoxycholate, 2% Nonidet P-40, 0.2% SDS, 1 mM phenylmethylsulfonyl fluoride, 50 µg/ml aprotinin, 50 µM leupeptin, 0.5 mM Na₃VO₄) on ice for 15 min followed by addition of 2x sample buffer.

Immunoblot Analysis—Lysates were resolved by SDS-PAGE and transferred to nitrocellulose membranes. The membranes were blocked with 5% dry milk in phosphate-buffered saline and subsequently stained with primary antibody. Specific reactive bands were detected using a goat anti-rabbit or goat anti-mouse IgG conjugated to horseradish peroxidase (Bio-Rad) and the immunoreactive bands were visualized by the ECL Western blotting detection kit (Amersham Biosciences).

View larger version (45K): [in this window] [in a new window]   FIG. 1. Role of PKC in TRAIL-induced apoptosis of glioma cells. A172 cells were infected with adenovirus vectors expressing LacZ (CV), PKC, or PKC KD mutant. Twenty-four hours thereafter, the expression of PKC was determined using Western blot analysis (A), the cells were treated with TRAIL (100 ng/ml) for 5 h, and cell apoptosis was determined using PI staining and FACS analysis (B and C). In another set of experiments, cells were transfected with control (scrambled) or PKC siRNAs using Oligofectamine. PKC expression was determined following 72 h (D) and the apoptotic effect of TRAIL (100 ng/nl) was determined after 5 h of treatment (E). Caspase 8 activation was determined in cells treated with TRAIL for 45 min using the fluorescent substrate Ac-IETD-AMC as described under "Experimental Procedures" (F) and cytochrome c release from the mitochondria to the cytosol was determined using Western blot analysis (G). The results represent the mean ± S.E. of triplicate measurements in each of four experiments (C, E, and F) or are from one representative experiment out of four similar experiments. (A, B, D, and G).

Statistical Analysis—The results are presented as the mean ± S.E. Data were analyzed using analysis of variance and a paired Student's t test to determine the level of significance between the different groups.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
PKC Protects Glioma Cells from the Apoptotic Effect of TRAIL—PKC regulates cell apoptosis in a cell and stimulus-dependent manner (13). To examine the role of PKC in the apoptotic effect of TRAIL we employed the A172 glioma cell line that exhibits high sensitivity to this ligand. Overexpression of a PKC kinase-dead (KD) mutant (K376R) using an adenovirus vector (Fig. 1A) did not affect the basal level of A172 cell apoptosis (Fig. 1B). However, it increased the apoptosis induced by TRAIL (Fig. 1, B and C). Similar results were obtained with a siRNA targeting the PKC mRNA. Transfection of the A172 cells with PKC siRNA reduced the expression of PKC by 80% after 3 days of transfection as compared with cells transfected with a scrambled siRNA (Fig. 1D), whereas it did not alter the expression of the other PKC isoforms (data not shown). The PKC siRNA-transfected cells exhibited a higher degree of cell apoptosis in response to TRAIL as compared with cells transfected with a control scrambled siRNA (Fig. 1E). Similarly, the PKC inhibitor rottlerin (5 µM) increased the apoptotic effect of TRAIL by about 35% as compared with control TRAIL-treated cells (data not shown).

The role of PKC in the apoptotic effect of TRAIL was also demonstrated using cells overexpressing PKC. Overexpression of PKC by infection with an adenovirus vector (Fig. 1A) or by transfection (data not shown) decreased cell apoptosis in response to TRAIL by about 55% (Fig. 1C). Similar results were obtained with anti-histone ELISA (data not shown). Overexpression of PKC did not significantly inhibit the activation of caspase 8 by TRAIL (Fig. 1F). However, it inhibited cytochrome c release to the cytosol (Fig. 1G), suggesting that PKC acted downstream of caspase 8 and upstream of the mitochondria pathway.

Cleavage of PKC by TRAIL—PKC undergoes caspase 3-dependent cleavage in response to diverse apoptotic stimuli (15, 19, 20). To examine the effect of TRAIL on the cleavage of PKC we treated the A172 cells with TRAIL (100 ng/ml) for various periods of time and examined the cleavage of PKC using an anti-PKC antibody that recognized the catalytic domain. We found that TRAIL induced cleavage of PKC and accumulation of the PKC catalytic fragment after 2–3 h of treatment (Fig. 2A). The time course of the cleavage of PKC correlated with induction of cell apoptosis by TRAIL as indicated by poly(ADP-ribose) polymerase cleavage (Fig. 2B) and by PI staining and FACS analysis (data not shown).

View larger version (34K): [in this window] [in a new window]   FIG. 2. Caspase-dependent cleavage of PKC in TRAIL-treated cells. A172 cells were treated with TRAIL (100 ng/ml) for 0–5 h. The cleavage of PKC was determined by Western blot using an anti-PKC antibody that recognizes the catalytic domain (A) and cell apoptosis was evaluated by poly(ADP-ribose) polymerase cleavage (B). The 40-kDa cleaved form (CF) is marked (A). The role of caspase 3, 8, and 9 in the cleavage of PKC was determined by pretreatment of the cells with caspase inhibitors DEVD, Z-IETD, and Z-LEHD (10 µM each) for 30 min followed by treatment with TRAIL (100 ng/ml) for 3 h (C). The results represent one of three separate experiments, which gave similar results. PARP, poly(ADP-ribose) polymerase.

The Cleavage of PKC Is Essential for Its Protective Effect— The cleavage of PKC generates a constitutively active catalytic fragment that has been associated with the pro-apoptotic function of PKC in various cellular systems (19–21). However, the role of PKC cleavage in its protective effect has not been studied. To examine the role of PKC cleavage in its protective effect against TRAIL-induced apoptosis, we constructed a caspase-resistant PKC mutant in which the aspartic acid at position 327 was mutated to alanine. We overexpressed the PKC WT and the PKCD327A mutant in the A172 cells and examined their cleavage and effects on the apoptosis induced by TRAIL. As presented in Fig. 3A, overexpressed PKC underwent cleavage in response to TRAIL similar to the endogenous PKC, whereas the PKCD327A did not undergo cleavage and no accumulation of a PKC catalytic fragment was observed in TRAIL-treated cells. In addition, we found that in contrast to the protective effect of the overexpressed PKC, the PKC caspase mutant did not protect the A172 cells from TRAIL-induced apoptosis but rather increased it (Fig. 3B). These results suggest that the cleavage of PKC is essential for the protective effect of PKC and that the PKCD327A mutant acted as a dominant negative mutant of PKC by inhibiting its cleavage and protective effect.

Our recent studies (15) and studies from other groups (14, 33) indicate that PKC plays an essential role in the apoptosis induced by etoposide mainly via its cleaved catalytic fragment. Thus, PKC plays an opposite role in the apoptosis induced by TRAIL and etoposide. Because PKC undergoes cleavage in response to both stimuli we also examined the effect of the PKCD327A mutant in the apoptotic effect of etoposide. The PKCD327A mutant failed to undergo cleavage in response to etoposide (Fig. 3C), similar to the results obtained with TRAIL. However, in this case the PKC mutant protected the A172 cells from etoposide-induced apoptosis in contrast to its apoptotic effect in TRAIL-treated cells (Fig. 3D).

Both the Regulatory and Catalytic Domains of PKC Are Required for Its Protective Effect—The regulatory and catalytic domains of PKC have been associated with the regulation of cell apoptosis (19, 20, 48), however, their role in the protective effect of PKC has not been explored. To examine the relative contributions of the different domains of PKC to its protective effect we employed PKC chimeras between the regulatory and catalytic domains of PKC and - combined at the highly conserved hinge region. We found that overexpression of PKC did not affect the apoptotic effect of TRAIL, whereas PKC decreased it as already described (Fig. 1C). Cells overexpressing chimeras with the regulatory domain of PKC (PKC/) or the catalytic domain of PKC (PKC/) exhibited a similar degree of apoptosis to that of CV cells and none of the chimeras resembled cells overexpressing PKC (Fig. 4A), suggesting that both domains of PKC are required for its protective effect.

To further examine the roles of the regulatory and catalytic domains of PKC in its protective effect we overexpressed these two domains in the A172 cells and examined their effects on cell apoptosis in the absence and presence of TRAIL. We found that overexpression of the PKC catalytic (PKC-cat) domain induced some cell death in the A172 cells, whereas no apoptosis was observed with the PKC regulatory domain (PKC-reg, Fig. 4B). The PKC-reg did not alter the apoptotic response of the cells to TRAIL (Fig. 4B), whereas the PKC-cat slightly enhanced it. These results further support the results obtained with the PKC chimeras that both domains are required for the protective effect of PKC.

Using the PKC-cat and PKC-reg fragments tagged to GFP, we found that the catalytic domain of PKC accumulated in the cytosol and to a large degree in the nucleus, whereas the regulatory domain of PKC was expressed throughout the cell (Fig. 4C). The localization of the PKC-cat and -reg domains was not significantly altered by TRAIL treatment (data not shown).

TRAIL Induces Translocation of PKC to the Perinuclear Region—One of the important factors in the diverse apoptotic functions of PKC is its distinct patterns of translocation in response to different stimuli (13). To examine the effect of TRAIL on the translocation of PKC, we treated A172 cells with TRAIL for various periods of time and followed the localization of the endogenous PKC using immunofluorescence staining and confocal microscopy. In control cells, PKC was largely localized to the cytosol with some expression in the nucleus (Fig. 5A). Treatment with TRAIL induced translocation of PKC to the perinuclear region and in most of the cells this translocation was followed by the exit of PKC from the nucleus. Translocation was first observed after 15 min, was increased after 30 min, and persisted up to 1 h following TRAIL treatment. After that time PKC was mainly localized in the cytosol (Fig. 5A) and this localization persisted up to the time of PKC cleavage (2–3 h post-TRAIL treatment, data not shown).

To further characterize the subcellular localization of PKC following TRAIL treatment we used the ER marker calnexin (49). As shown in Fig. 5B, the ER marker calnexin stained the perinuclear region in a similar pattern to that of PKC in the TRAIL-treated cells. Merged images clearly showed co-localization of the green fluorescence of PKC and of the red fluorescence of calnexin, suggesting that TRAIL induced translocation of PKC to the ER. Similar results were observed using anti-KDEL antibody (Stressgen) as an ER marker (data not shown).

View larger version (20K): [in this window] [in a new window]   FIG. 3. A PKC caspase-resistant mutant (D327A) enhances cell apoptosis in response to TRAIL but inhibits cell apoptosis in response to etoposide. A172 cells were infected with adenovirus vectors expressing LacZ (CV), PKC, or PKCD327A. Following 24 h, the cells were treated with TRAIL for 3 h (A) or with etoposide for 18 h (C) and the cleavage of PKC was determined using Western blot analysis. Cell apoptosis was determined following a 5-h treatment with TRAIL (B) and 36 h with etoposide (D) using PI staining and FACS analysis. The results are representative of four similar experiments (A and C) or represent the mean ± S.E. of triplicate measurements in each of four independent experiments (B and D).

Phosphorylation of PKC on Tyrosine 155 Is Essential for Its Protective Effect—To examine the role of tyrosine phosphorylation of PKC in its protective effect against TRAIL-induced apoptosis, we employed a PKC mutant in which tyrosine 155 was mutated to phenylalanine (PKCY155F). We overexpressed PKC WT and the PKCY155F mutant in A172 cells and examined the apoptosis of the transfected cells in response to TRAIL. As already described (Fig. 1C), overexpression of PKC reduced cell apoptosis. In contrast, overexpression of the PKCY155F increased apoptosis of the A172 cells by 10–15% as compared with CV cells (Fig. 7A), suggesting that the phosphorylation of PKC on tyrosine 155 is essential for the protective effect of PKC and that PKCY155F acted as a dominant negative of PKC. Similarly, we found that overexpression of PKC decreased the expression of active caspase 3, whereas overexpression of PKCY155F slightly increased it as compared with CV cells (Fig. 7B). This apoptotic effect was specific for the PKCY155F mutant because overexpression of other PKC tyrosine mutants, PKCY52F and PKCY187F, protected the A172 cells against TRAIL-induced apoptosis, similar to the effect of PKC (Fig. 7C).

Phosphorylation on Tyrosine 155 Is Essential for the Translocation and Cleavage of PKC—One of the possible mechanisms for the different effects of PKC and the PKCY155F mutant on TRAIL-induced apoptosis is their differential subcellular localization following TRAIL treatment. To examine this point, we followed the translocation of PKC and the PKCY155F mutant tagged with GFP in TRAIL-treated cells. A172 cells were transfected with GFP constructs and the translocation of PKC and PKCY155F was monitored as a function of time following TRAIL treatment. Similar to the endogenous PKC, PKC-GFP exited the nucleus and translocated to the ER after 15 min of TRAIL treatment and this translocation persisted up to 60 min thereafter (Fig. 8A). In contrast, no significant translocation was observed in the A172 cells transfected with the PKCY155F-GFP mutant, and in TRAIL-treated cells the PKCY155F-GFP mutant was localized to the cytoplasm and nucleus similar to the control untreated cells (Fig. 8A). The translocation of the PKCY155F mutant in response to PMA and etoposide was also examined. We found that PMA induced translocation of the PKCY155F mutant to the plasma and perinuclear membranes, similar to translocation of the PKC-GFP WT (Fig. 8B). Etoposide induces nuclear translocation of PKC. We found that the PKCY155F-GFP translocated to the nucleus in response to etoposide, similar to PKC-GFP (Fig. 8B).

The cleavage of PKC was essential for its protective effect. We therefore examined whether phosphorylation of PKC on tyrosine 155 was associated with the cleavage of PKC by TRAIL. Using cells overexpressing PKC WT and various PKC tyrosine mutants, we found that TRAIL induced the cleavage of PKC and that of the PKCY187F and PKCY52F mutants but did not induce cleavage of the PKCY155F (Fig. 8C). Thus, phosphorylation of PKC on tyrosine 155 was essential for the cleavage of PKC in response to TRAIL. In contrast, phosphorylation of PKC on tyrosine 155 was not essential for the cleavage of PKC by etoposide (data not shown), suggesting a specific role of this phosphorylation site in the apoptotic pathway activated by TRAIL.

View larger version (29K): [in this window] [in a new window]   FIG. 4. Apoptosis of A172 cells overexpressing PKC chimeras and the regulatory or catalytic domains of PKC in response to TRAIL. A172 cells overexpressing PKC, PKC, and the chimeras PKC/ and PKC/ (A) or the regulatory (PKC Reg) or catalytic (PKC Cat) domains of PKC (B) were stimulated with TRAIL for 5 h. Cell apoptosis was determined using PI staining and FACS analysis. The localization of the regulatory and catalytic domains was determined in cells transfected with the PKC-cat and the PKC-reg tagged to GFP using confocal microscopy (C). The results represent the mean ± S.E. of four separate experiments (A and B) or are representative of five similar experiments (C).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
In this study we explored the role of PKC in the apoptotic effect of TRAIL. Various studies have reported that PKC regulates the apoptotic function of TRAIL using either the PKC activator PMA or various PKC inhibitors (43, 44); however, the role of PKC in the effect of TRAIL has not been explored. In an attempt to delineate the molecular mechanisms underlying the anti-apoptotic effect of PKC, we focused on three factors that are central for the diverse apoptotic function of PKC, its cleavage, localization, and tyrosine phosphorylation (13).

We found that PKC protected the A172 cells from the apoptosis induced by TRAIL. Thus, the inhibition of PKC activity or expression increased, whereas overexpression of PKC attenuated the apoptotic effect of TRAIL. PKC has been extensively studied for its effects on the regulation of apoptosis in various cellular systems (13, 52). In many of these studies PKC acted as a pro-apoptotic kinase and it contributed to the apoptotic effects of a large and diverse apoptotic stimuli, including etoposide (14, 15), radiation (18), UV radiation (17), and ceramide (31). However, in other systems PKC clearly acted in an anti-apoptotic fashion (25, 26). Thus, PKC protected macrophages from NO-induced apoptosis (27) and glioma cells from the apoptosis induced by Sindbis virus infection (28). The basis for the anti- and pro-apoptotic effects of PKC is not understood and, although various downstream targets have been associated with the pro-apoptotic effect of PKC, less is known about the mechanisms involved in its anti-apoptotic effect. We found that PKC inhibited the release of cytochrome c from the mitochondria and the cleavage of caspase 3, whereas it did not alter the activation of caspase 8 induced by TRAIL. Thus, PKC acted downstream of caspase 8 activation and upstream of the mitochondrial pathway.

View larger version (42K): [in this window] [in a new window]   FIG. 5. Translocation of PKC in A172 cells treated with TRAIL. A172 cells were treated with TRAIL (100 ng/ml) for 0–90 min and the translocation of PKC was examined using immunofluorescent staining (A). Fixed cells were incubated with a rabbit anti-PKC antibody for 1 h followed by incubation with an anti-rabbit Alexa Fluor 488 antibody. Cells were visualized by confocal microscopy. For colocalization studies, cell treated with TRAIL were first stained with anti-PKC antibody as described above followed by incubation with mouse anti-calnexin antibody and Alexa Fluor 546 (B). The localization of PKC is shown in green (left), ER staining is shown in red (middle), and the merge image (right) is yellow for the overlapping red and green signals. The results are from one representative experiment out of five similar experiments.

View larger version (28K): [in this window] [in a new window]   FIG. 6. TRAIL induces phosphorylation of PKC on tyrosine 155. A172 cells were treated with TRAIL (100 ng/ml) for 0–120 min and the phosphorylation of PKC on tyrosine 155 and 187 was determined using anti-phospho-PKC antibodies (pPKCY155 and pPKCY187). The membranes were also blotted with anti-PKC antibody. The results are representative of four similar experiments. CF, cleaved form.

The cleavage of PKC is well documented and it occurs in response to many apoptotic stimuli such as etoposide (15), cisplatin (55), and UV radiation (56). The caspase-dependent cleavage of PKC leads to the generation of a constitutively active catalytic fragment that is associated with the apoptotic function of PKC in response to various apoptotic stimuli (15, 19, 20, 55, 56). Moreover, overexpression of the PKC catalytic fragment has been reported to induce cell apoptosis in various systems by phosphorylating apoptosis related proteins such as p73 and DNA-PK (21, 22). The fate and function of the regulatory domain released following the caspase-dependent cleavage are less understood. However, in a recent study Schultz et al. (48) reported that the regulatory domain of PKC exerted an apoptotic function when overexpressed, suggesting that both the regulatory and catalytic domains of PKC can regulate cell apoptosis. The cleavage of PKC and the roles of its catalytic and regulatory domains have not been studied previously in cellular systems where PKC acted as an anti-apoptotic kinase.

In an attempt to determine the roles of the regulatory and catalytic domains of PKC in its protective effect against TRAIL-induced apoptosis, we employed PKC chimeras between the regulatory and catalytic domains of PKC and PKC. We found that both domains were required for the protective effect of PKC, because neither of the chimeras acted like PKC to protect the A172 cells from TRAIL-induced apoptosis. The involvement of both domains was further confirmed by the experiment of overexpressing the PKC-reg and PKC-cat because neither of them protected the A172 cells from the apoptotic effect of TRAIL. These results are similar to our recent results in which the two domains were required for the apoptotic effect of PKC in response to etoposide (15). Unlike these two systems, the isoform specificity of PKC for inhibition of glioma cell proliferation depended only on the regulatory domain (45). The mechanisms that are involved in the protective effect of the catalytic domain in this case as compared with its apoptotic effects in other systems are not understood. However, it is noteworthy that the localization of the catalytic domain in TRAIL-treated cells was outside the nucleus as compared with its nuclear localization in response to apoptotic stimuli or when overexpressed (14, 15, 33). Thus, the phosphorylation of different substrates, anti-apoptotic as compared with pro-apoptotic, as a result of this differential localization could account for the different effects of the catalytic domain.

TRAIL induced translocation of PKC to the ER within 15 min of treatment. PKC has been reported to undergo differential translocation to distinct subcellular sites in response to diverse apoptotic stimuli. Thus, PKC was translocated to the nucleus in response to etoposide (14, 15), to the mitochondria in response to PMA (32) and H₂O₂ (57), and to the Golgi in response to ceramide (31). Interestingly, we recently found that PKC translocated to the ER in response to infection of glioma cells with Sindbis virus (28). Similar to its effect in TRAIL-treated cells, PKC protected glioma cells from the apoptosis induced by SV infection (28). It is currently not clear what is the function of PKC in the ER and which proteins can be phosphorylated by PKC at this site. One candidate is Bcl2, which resides in the ER in addition to its mitochondrial localization (58) and has been shown to be a PKC substrate (59) and to protect cells from TRAIL-induced apoptosis (60).

View larger version (23K): [in this window] [in a new window]   FIG. 7. Phosphorylation of tyrosine 155 is essential for the protective effect of PKC. A172 cells were transfected with CV, PKC, and the PKCY155F mutant (A and B) or with PKC and the PKC tyrosine mutants, PKCY155F, PKCY52F, and PKCY187F (C). Cells were then treated with TRAIL (100 ng/ml) for 5 h and cell apoptosis was determined using PI staining and FACS analysis (A and C). The expression of active caspase 3 (B) was determined using Western blot analysis. The results are representative of five similar experiments (A and B) or represent the mean ± S.E. of triplicate measurements in each of four independent experiments (C).

View larger version (56K): [in this window] [in a new window]   FIG. 8. Phosphorylation of PKC on tyrosine 155 is essential for the translocation and cleavage of PKC. A172 cells were transfected with PKC and the PKCY155F mutant tagged to GFP. Cells were then treated with TRAIL for various periods of time and translocation was followed using confocal microscopy (A). The translocation of the PKC-GFP and the PKCY155F-GFP was examined in response to PMA (1 µM, 30 min) and etoposide (50 µg/ml, 3 h) (B). Cells were also transfected with PKC or PKC tyrosine mutants (Y155F, Y187F, and Y52F), treated with TRAIL for 3 h, and PKC cleavage was determined using Western blot analysis (C). The results are representative of four similar experiments. CF, cleaved form.

View larger version (18K): [in this window] [in a new window]   FIG. 9. PKC increases AKT phosphorylation in TRAIL-treated cells. A172 cells overexpressing CV, PKC, and PKCY155F mutants were stimulated with TRAIL for 0–60 min. The phosphorylation of AKT was determined using anti-phospho AKT (Ser473) antibody. The results are representative of three similar experiments.

In addition to its translocation to the ER, phosphorylation on tyrosine 155 was also essential for the cleavage of PKC by TRAIL. The translocation of PKC to the ER was transient and preceded the cleavage of PKC, suggesting that PKC was cleaved outside of the ER. Interestingly, the inability of the PKCY155F mutant to undergo cleavage by TRAIL was specific to this apoptotic stimulus because this mutation did not interfere with the ability of PKC to undergo cleavage in response to etoposide. Similarly, mutations in tyrosines 187 and 52 did not attenuate the cleavage of PKC in response to TRAIL.

TRAIL has been reported to activate both pro- and anti-apoptotic signaling pathways in various cellular systems including ERK (51), c-Jun N-terminal kinase (40), AKT (51), and NF-B (40). AKT has been implicated as an important inhibitor of TRAIL-induced apoptosis (50, 69). AKT exerts its anti-apoptotic effect by phosphorylating pro-apoptotic proteins such as BAD, caspase 9, and forkhead transcription factors or by activating anti-apoptotic pathways such as NF-B or the expression of FLIP (70). We found that PKC increased the phosphorylation of AKT in control and TRAIL-treated cells and that this effect was dependent on the phosphorylation of PKC on tyrosine 155. The mechanism by which the tyrosine-phosphorylated form of PKC enhances the activation of AKT is currently not understood. One possible mechanism is an inhibitory effect of PKC on phosphatase activity, similar to the recent results reported for PKC (71). Alternative mechanisms include the activation of PDK-1 or phosphatidylinositol 3-kinase by PKC.

In summary, we demonstrated that PKC protected glioma cells from TRAIL-induced apoptosis and that the phosphorylation of PKC on tyrosine 155, its translocation to the ER, and its cleavage were associated with the protective effect of this isoform. PKC acted downstream of caspase 8 activation and inhibited the mitochondrial pathway, probably via activation of AKT. Cleavage of PKC and its translocation to the ER contributed to its protective effects by mechanisms that are still not understood.

Although PKC has been extensively studied as a key kinase in the regulation of cell apoptosis, the mechanisms underlying its anti-apoptotic effects are not well understood. Our results provide new information regarding the factors that play a role in the anti-apoptotic effects of PKC and implicate tyrosine phosphorylation of PKC on tyrosine 155 as a key factor in the regulation of AKT phosphorylation and cell survival in glioma cells.

In addition to characterizing the anti-apoptotic role of PKC in TRAIL-induced apoptosis, our results also have important implications for understanding the factors that regulate the apoptotic function of this key signaling molecule. Table I summarizes the localization, phosphorylation, and cleavage of PKC in response to TRAIL and etoposide where PKC acts as an anti- or pro-apoptotic kinase, respectively. Both TRAIL and etoposide induce phosphorylation of PKC albeit on different residues and in both cases tyrosine phosphorylation is essential for the apoptotic function of PKC. Tyrosine phosphorylation on distinct tyrosine residues can modulate the subcellular localization of PKC, its affinity toward different substrates, and its association with other proteins via SH2 domains. These results clearly position tyrosine phosphorylation of PKC as a pivotal factor in the regulation of the diverse functions of PKC in cell apoptosis.

View this table: [in this window] [in a new window]   TABLE I Comparison of the behavior of PKC in response to the treatment of A172 glioma cells with TRAIL and etoposide

	FOOTNOTES

^|| To whom correspondence should be addressed: Hermelin Brain Tumor Center, Dept. of Neurosurgery, Henry Ford Hospital, Detroit, MI 48202. E-mail: chaya{at}mail.biu.ac.il.

¹ The abbreviations used are: PKC, protein kinase C; TRAIL, tumor necrosis factor-related apoptosis inducing ligand; NF-B, nuclear factor B; PMA, phorbol 12-myristate 13-acetate; Z, benzyloxycarbonyl; fmk, fluoromethyl ketone; GFP, green fluorescent protein; siRNA, small interfering RNA; CMV, cytomegalovirus; ELISA, enzyme-linked immunosorbent assay; PBS, phosphate-buffered saline; ER, endoplasmic reticulum; PI, propidium iodide; FACS, fluorescence activated cell sorter; EGFP, epidermal growth factor protein.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Adams, J. M. (2003) Genes Dev. 17, 2481–2495[Free Full Text]
2. Strasser, A., O'Connor, L., and Dixit, V. M. (2000) Annu. Rev. Biochem. 69, 217–245[CrossRef][Medline] [Order article