HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 280, Issue 27, 25331-25338, July 8, 2005

This Article Abstract Full Text (PDF) All Versions of this Article: 280/27/25331    most recent M412549200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Magee, C. Articles by Linsenmayer, T. F. Search for Related Content PubMed PubMed Citation Articles by Magee, C. Articles by Linsenmayer, T. F. Social Bookmarking                      What's this?

SP3/SP1 Transcription Activity Regulates Specific Expression of Collagen Type X in Hypertrophic Chondrocytes^*

Cordula Magee, Maria Nurminskaya, Lidia Faverman, Philippe Galera¶, and Thomas F. Linsenmayer||

From the Department of Anatomy and Cellular Biology, Tufts University, Boston, Massachusetts 02111 and^¶ Faculté de Médecine, Universite de Caen, 14032 Caen Cedex, France

Received for publication, November 5, 2004 , and in revised form, March 4, 2005.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Previously, we have shown that two non-canonical specificity protein (SP)-binding sites within the proximal promoter (nucleotide (nt) –139 to +5) of the chicken Col10a1 gene are involved in conferring tissue-specific expression of type X collagen to hypertrophic chondrocytes. In the present study, we examined the role of SP3/SP1 transcription factors in the regulation of the Col10a1 promoter. The SP3/SP1 ratio is higher in hypertrophic versus non-hypertrophic chondrocytes, due to the significant decrease in SP1 in hypertrophic cells detected by real-time PCR and Western blot analyses. Functional analyses by transfection-mediated overexpression of SP1 and SP3 suggest that SP1 inhibits the Col10a1 promoter. This effect is negated by an interaction with SP3 in hypertrophic chondrocytes. Additionally, mutation analysis showed that the 40-bp intervening sequence (nt –115 to –75) is required for expression of the Col10a1 gene. In this sequence, a binding site for Dlx5/6 transcription factors (nt –99 to –87) retards a protein specific for hypertrophic chondrocytes in electrophoretic mobility shift assay. Endogenous levels of Dlx5 are 3-fold higher in hypertrophic versus non-hypertrophic cells by real-time PCR analysis, and overexpression of Dlx5 in non-hypertrophic chondrocytes activates the proximal Col10a1 promoter 3-fold. These results indicate that the SP3/SP1 ratio and Dlx5 are important regulators of the proximal Col10a1 promoter in hypertrophic cartilage and suggest that interactions between SP3 and SP1 regulate expression of different types of collagen during chondrocyte differentiation.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Collagen type X gene expression is specific to chondrocytes undergoing hypertrophy and endochondral ossification (2, 3). Several human skeletal diseases characterized by growth abnormalities and osteoarthritis are linked to mutations in the COL10a1 gene (4, 5). Genetic ablation of type X collagen in mice results in a mild skeletal phenotype, affecting mineralization, spongy bone formation, and hematopoiesis (6–8). However, overexpression of a truncated form of collagen X alters the assembly of cartilage matrix, resulting in severe growth abnormalities (9, 10).

Restriction of Col10a1 gene expression to hypertrophic chondrocytes is regulated predominantly at the transcriptional level (11, 12). Within the gene, two promoter regions have been implicated in this restricted expression: one is proximal (nt –139 to +5), and the other is distal (nt –4443 to –558) (1, 13). Previous studies in our laboratory have suggested a role for specificity protein (SP)¹ transcription factors in the tissue-specific expression of the chicken Col10a1 gene (1). Within the 140-bp proximal promoter, deletion analyses identified two 10-bp nonconsensus SP1-binding sites (termed CS1 and CS2) as potentially conferring cell type specificity. The supershift gel electrophoretic mobility assays suggested that at least two SP factors bound to these sites in both non-hypertrophic and hypertrophic chondrocytes and raised the possibility that the ratio of different SP proteins in the two cell types may be involved in regulating expression of type X collagen (1). In mammals, seven SP transcription factors (SP1 to SP7) have been identified and characterized to date (14). Two of these transcription factors (SP3 and SP7/Osterix) are necessary regulators of bone formation because both SP3- and SP7-null mice suffer from a lack of ossification and impaired bone formation (15, 16). The SPs form homotypic and heterotypic complexes with numerous proteins, including other SP family members (17–19), and these interactions determine whether SP proteins act as activators or repressors of target genes in a given cell type.

Recently, expression of the COL2A1 gene in articular chondrocytes has been shown to depend on the cooperation of SP1 with SP3 (20). Increased SP3/SP1 ratio mediates the transforming growth factor- and interleukin-1 induced inhibition of COL2A1 gene in differentiated chondrocytes (21, 22). Downregulation of type II collagen during chondrocyte maturation is paralleled by specific up-regulation of type X collagen (23). This suggests that the SP3/SP1 ratio may be one of the mechanisms coordinating the changes in collagen expression associated with chondrocyte differentiation.

In the present study, we have analyzed the role of SP1 and SP3 transcription factors in cell type-specific regulation of collagen type X in hypertrophic chondrocytes versus non-hypertrophic chondrocytes. We have observed that SP1, which is generally thought to function as a stimulator of transcription, acts as an inhibitor of the Col10a1 gene in non-hypertrophic chondrocytes. In hypertrophic chondrocytes, the levels of SP1 are significantly lower than those in non-hypertrophic cells, and our data suggest that the inhibitory effect of SP1 is negated in these cells by SP3 protein. Expression levels of SP3 stay almost the same in both cell types, resulting in a higher SP3/SP1 ratio in hypertrophic cells. We demonstrate that the increased SP3/SP1 ratio results in the up-regulation of Col10a1 and that cell type-specific expression of the Col10a1 gene depends on SP3/SP1 cooperation. In addition, we have shown that the 40-bp intervening sequence between CS1 and CS2 is essential for expression of the proximal Col10a1 promoter in hypertrophic chondrocytes. This intervening sequence contains one Dlx5/6-binding site (nt –99 to –87). We have shown by electrophoretic mobility shift assay (EMSA) that this Dlx-binding site binds a hypertrophic chondrocyte-specific nuclear protein. Dlx5 is expressed at higher levels in hypertrophic cells, and overexpression of Dlx5 in non-hypertrophic chondrocytes activates the proximal Col10a1 promoter up to 3-fold. Taken together, these data suggest that the Dlx5 transcription factor may regulate the cell type-specific expression of collagen type X by direct binding to the proximal promoter of the gene.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Generation of CAT Constructs—The constructs pCAT I, pCAT VII, and pCAT X were generated as described previously (1, 24). Constructs were generated by annealing the following complementary 34- or 84-bp oligonucleotides: six consecutive copies of CS1 (5'-CCCCACCCCT-3') to generate pCAT-CS1; six consecutive copies of CS2 (5'-GGGGAGGAGC-3') to generate pCAT-CS2; one copy each of CS1 and CS2 separated by four consecutive copies of a nonsense sequence (5'-TGGACTTCAA-3') to generate pCAT XX with mutated intervening sequence; and one copy of a SP1 consensus binding sequence (5'-GGGGCGGGGC-3') to generate pCAT-SP1. To each oligonucleotide, a HindIII site was added at the 5' and 3' ends. The resultant annealed fragments were purified with the QIAquick PCR Purification Kit (Qiagen) and subjected to HindIII digestion. The digested products were cloned into the HindIII sites of the vector pCAT X (1). The resultant plasmids were sequenced (Invitrogen) to confirm their identities. The SP1 and SP3 expression vectors pEVR2/SP1 and pRC/CMV/SP3 were kindly provided by Dr. Guntram Suske (25).

Cell Culture and Transfection—All cells were primary cultures from 14-day-old chicken embryos (Spafas Inc., Norwich, CT). Hypertrophic chondrocytes were from the hypertrophic zone 3 of the tibia (26). Nonhypertrophic chondrocytes were from the caudal one-third of the sternum and from the resting zone (zone 1) of the growth plate (26). Cells were dissociated by 0.125% trypsin (Invitrogen), 0.3% collagenase type I (Sigma), and 0.06% bovine testes hyaluronidase type I (Sigma) and cultured in Dulbecco's modified Eagle's medium (Invitrogen) containing 10% bovine calf serum (Hyclone Labs) and 50 units/ml penicillin and streptomycin (Invitrogen). The hypertrophic chondrocytes were kept in culture for 2–4 weeks and passaged several times before use to ensure high levels of type X collagen expression by every cell, as detected by immunostaining (2). Non-hypertrophic chondrocytes were cultured for 4–7 days and passaged once before use. Hyaluronidase type I (Sigma) was added at 0.12 mg/ml to both types of chondrocytes to achieve better attachment of cells on the culture dishes.

For transient transfections, cells were plated on 24-well plates at 10⁴ cells/well for both types of chondrocytes. The cells were grown overnight before transfection. Plasmid DNA used for transfection was prepared using the Qiagen plasmid kit. The transient transfections were performed using FuGENE 6 reagent (Roche Applied Science). Briefly, 1 µg of the experimental construct (e.g. pCAT-I) and 0.2 µg of the -galactosidase internal control of pSV40--gal (Promega) were co-transfected into cells by 3 µl of FuGENE 6 reagent. Type I hyaluronidase was included in the transfection medium at 0.12 mg/ml to increase the transfection efficiency (6). Transfection mixture was added to the cells in 10% serum-containing media. Cells were harvested after 48–62 h. To disrupt SP3/SP1 interaction, chondrocytes were incubated with 100 nM mithramycin (Sigma) for 24 h following the 16–18-h transfection period (20).

In each experiment, transfections of each construct were done at least in triplicate. -Galactosidase activity was measured with the colorimetric assay kit (Pierce) and expressed as the optical density of the substrate reaction at the wavelength of 420 nm (A₄₂₀). CAT (in pg) was determined by enzyme-linked immunosorbent assay using an anti-CAT antibody (Roche Applied Science). Normalized levels of CAT expression were calculated as the ratio of CAT protein to -galactosidase activity (i.e. CAT/-galactosidase). The mean value of CAT/-galactosidase ratios from multiple transfections for each construct was taken as its CAT expression level in the experiment. Results presented in this study are from two or more separate experiments.

Preparation of Nuclear Extracts—Nuclear Extracts of chondrocyte cultures were prepared using the NE-PER kit (Pierce). Aliquots were frozen in an ethanol-dry ice bath and stored at –80 °C until use. Protein concentration was determined with the BCA protein assay kit (Pierce).

EMSA—Annealing complementary synthetic oligonucleotides generated double-stranded DNA probes. These were then labeled with ³²Pby a forward reaction with T4 kinase (Invitrogen), and the products were purified by Nensorb 20 cartridges (PerkinElmer Life Sciences). EMSA was performed as described previously (1) using the EMSA kit reagents (Pierce). The 34-bp double-stranded oligonucleotide GGATGCGTATCCGCCGGCGTCGTTTCGCTTATAC was used as a nonspecific competitor DNA at 50 ng/µl. Nuclear extracts of 7–14 µg and 1–3 x 10⁴ cpm of probes were used in each reaction. For competition assays, cold competitors were added in 200–400 molar excess.

Western Blotting—20 µg of nuclear extracts in reducing buffer were loaded onto 5–15% Tris-polyacrylamide gels in denaturing conditions, and proteins were separated by SDS-PAGE. Proteins were transferred to a polyvinylidene difluoride membrane (Bio-Rad), blocked with 5% dry milk overnight at 4 °C, and incubated with 1 µg/ml rabbit anti-SP1 or rabbit anti-SP3 antibody (Santa Cruz). Bands were visualized with a horseradish peroxidase-conjugated anti-rabbit IgG secondary antibody, followed by ECL using the SuperSignal kit (Pierce).

Preparation of RNA and RT-PCR—Total RNA was isolated using TRIzol reagent (Invitrogen). Single-stranded cDNA was synthesized from 2.5 µg of total RNA by using SuperScript II reverse transcriptase (Invitrogen). PCR amplification was performed for 30 cycles to analyze gene expression with the following primers: chicken SP1, primers TCAACGCCGCCCAACGTCTCC (positions 1531–1550) and CCGCGCCGCCTTCTTGTTC (positions 2105–2124); chicken SP3, primers AGGTGGGGCACTGACATCAA (positions 1679–1698) and TTGTTCCTCCCGCAGTAATC (positions 2394–2413); and chicken -actin, primers ATATTGCTGCGCTCGTTGTTGTTGAC (positions 79–99) and GCATGGGGGAGGGCGTAG (positions 572–589). Real-time quantitative RT-PCR was performed using the QuantiTect SYBR Green PCR kit (Qiagen). Reactions were done in triplicates for each pair of primers, using the ABI 5700 sequence detector. Results were analyzed using the Microsoft Excel program.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Expression Levels of SP1 and SP3—Our previous data suggested that 1) transcription factors of the SP family may be differentially expressed in non-hypertrophic and hypertrophic chondrocytes and 2) binding of the SP proteins to the noncanonical CS-binding sites within the proximal promoter of the Col10a1 gene seemed to occur at different ratios in these cell types (1). These observations allowed suggesting regulation of collagen X expression by interacting SP factors. Another collagen gene, COL2A1, is also regulated by the ratio of two SP proteins (SP1 and SP3), as has been recently demonstrated in articular chondrocytes (21, 22). Increase in the SP3/SP1 ratio mediates down-regulation of collagen II induced by transforming growth factor- in differentiating articular chondrocytes. Similarly, collagen II levels decrease during chondrocyte differentiation from non-hypertrophic to hypertrophic state, whereas collagen X is up-regulated (23). Therefore, we proposed that the ratio of SP1 to SP3 transcription factors may regulate the transcription of chicken Col10a1 gene in differentiating chondrocytes.

To address this hypothesis, we first determined the levels of SP1 and SP3 in nuclear fractions of chondrocytes by Western blot analysis (Fig. 1). We observed that SP3 protein was expressed at similar levels in both cell types, but SP1 was clearly greater in non-hypertrophic cells. These results were confirmed and quantified by real-time RT-PCR. By this method, the level of SP1 mRNA in the non-hypertrophic chondrocytes was almost 20-fold higher than that of hypertrophic cells (non-hypertrophic/hypertrophic cells = 19.7 ± 5.7-fold, when normalized to the levels of mRNA for -actin). Conversely, the SP3 mRNA was basically the same for the two cell types (non-hypertrophic/hypertrophic cells = 0.73 ± 0.12-fold). The observed decrease in SP1 expression associated with chondrocyte maturation results in a higher SP3/SP1 ratio in hypertrophic versus non-hypertrophic chondrocytes (Fig. 1B). Similarly, the SP3/SP1 ratio in non-hypertrophic chondrocytes from the growth plate (resting chondrocytes from zone 1 of the growth plate) (26) appears to be much lower than that in hypertrophic cells (Fig. 1B, NH-zone1). This result suggests that the same regulatory mechanisms may control Col10a1 expression in cells that remain undifferentiated throughout their life time (i.e. sternal chondrocytes) and in chondrocytes, which will differentiate into hypertrophic cells (i.e. the growth plate chondrocytes).

View larger version (16K): [in this window] [in a new window]   FIG. 1. The SP3/SP1 ratio is higher in hypertrophic (Hyp) versus non-hypertrophic (NH) chondrocytes. A, protein levels determined by Western blot analysis. 20 µg of cell extracts were separated on a 5–15% acrylamide gel in denaturing conditions. Polyclonal antibodies against SP1 and SP3 (Santa Cruz) were employed (1:500). Equal loading was confirmed by detection of -tubulin (Sigma). B, ratio of SP3/SP1 mRNAs in hypertrophic (from hypertrophic zone of the growth plate) versus non-hypertrophic cartilage (from the lower sterna or from the resting zone of the growth plate), as determined by real-time quantitative RT-PCR.

To analyze the transcriptional activity of SP1 factor in non-hypertrophic and hypertrophic chondrocytes, we transfected both cell types with a pCAT-SP1 reporter vector construct. This construct was obtained by linking a consensus binding site for SP1 (GGGGCGGGGC) to the basal (55-bp) promoter from the Col10a1 gene, which shows little expression in either cell type (Fig. 2A, pCAT-X) (1). In non-hypertrophic chondrocytes, the reporter activity of the pCAT-SP1 vector was 3-fold lower than that in hypertrophic chondrocytes. The apparent inverse relationship between the abundance of SP1 mRNA and protein and the SP1-dependent CAT production in non-hypertrophic cells is consistent with an inhibitory role for this transcription factor (see the next paragraph and "Discussion"). In addition, these experiments reveal an essential role of the SP-binding site in supporting the activity of the Col10a1 basal promoter. Thus, the pCAT-SP1 construct was more active in both cell types than the pCAT X construct (Fig. 2A). This result indicates that an SP factor other than SP1 (supposedly, SP3) may act as a positive regulator of transcription in chondrocytes.

There are two possible mechanisms for the inhibitory action of SP1 on Col10a1 promoter: SP1 may function as a direct inhibitor of gene transcription, and in this case, expression of collagen type X in hypertrophic chondrocytes is associated with the reduced protein levels of SP1 in this cell type (Fig. 1). If so, increasing the levels of SP1 in hypertrophic chondrocytes should result in decreased expression of the Col10a1 gene in these cells (2). Alternatively, SP1 may actually act as an activator/positive regulator of Col10a1 promoter, but in non-hypertrophic cells this activity may be specifically repressed. If this is the case, then increasing the expression of SP1 in hypertrophic cells should either increase expression of Col10a1 or have no effect at all (if the maximum expression of Col10a1 has already been achieved).

To test these possibilities, we co-transfected hypertrophic chondrocyte cell cultures with a pCATI reporter construct that exhibits cell type specificity for Col10a1 expression in hypertrophic chondrocytes (24) and SP1-producing plasmid (pEVR2/SP1) (25). Overexpression of SP1 (up to 4-fold) was verified by Western blot analysis (data not shown). In the hypertrophic chondrocytes, overexpression of SP1 resulted in an 4-fold decrease in CAT activity, as compared with control cell cultures transfected with the pCATI plasmid alone (Fig. 2B). In addition, real-time PCR analysis revealed a 28% down-regulation of endogenous Col10a1 mRNA in hypertrophic chondrocytes overexpressing SP1 transcription factor. The extent of endogenous Col10a1 down-regulation may be even greater but masked by low efficiency of transfection in hypertrophic chondrocytes (usually <20%). In the similarly co-transfected non-hypertrophic cells, which have very low levels of pCAT1 expression and high levels of endogenous SP1, no detectable changes of CAT reporter gene have been observed (data not shown). Taken together, these results suggest that SP1 factor may directly inhibit the activity of the proximal Col10a1 promoter. Therefore, high endogenous levels of SP1 in non-hypertrophic chondrocytes may represent one mechanism of negative regulation of type X collagen expression in this cell type.

View larger version (19K): [in this window] [in a new window]   FIG. 2. SP1 acts as a transcriptional inhibitor of the Col10a1 gene. A, activity of the reporter gene driven by the canonical SP1-binding site fused to basal promoter of Col10a1 (pCAT X) is lower in non-hypertrophic versus hypertrophic chondrocytes, despite significantly higher protein levels of SP1 in non-hypertrophic cells. B, the inhibitory effect of SP1 in hypertrophic chondrocytes on the 640-bp pCAT I reporter construct (which confers cell type-specific expression of collagen type X) (1). Chondrocytes were co-transfected with pCAT I and pEVR2/SP1 vectors. Reporter activity driven by pCAT I alone (normalized to -galactosidase expression) is assigned a value of 100%.

View larger version (23K): [in this window] [in a new window]   FIG. 3. Regulation of Col10a1 expression by the SP3/SP1 ratio and protein interactions. A, cell type-specific expression of collagen type X in hypertrophic chondrocytes depends on the SP3/SP1 interactions. Non-hypertrophic (NH) and hypertrophic (Hyp) chondrocytes were transiently transfected with pCAT I reporter construct and subsequently treated with 100 nM mithramycin (+M) to disrupt the SP3/SP1 interactions. Mithramycin dramatically reduces the activity of pCAT I in hypertrophic chondrocytes. B, increase in SP3/SP1 ratio (due to overexpression of SP3) activates proximal Col10a1 promoter in both non-hypertrophic and hypertrophic chondrocytes. Cells were co-transfected with pCAT I and pRC/CMV/SP3 expression vector (+SP3). Reporter activity driven by pCAT I alone (normalized to -galactosidase expression) in hypertrophic chondrocytes is assigned a value of 100%. C, increase in SP3/SP1 ratio up-regulates the endogenous expression of type X collagen in non-hypertrophic chondrocytes from the resting zone of the growth plate, as determined by real-time RT-PCR analysis. Freshly liberated cells do not synthesize mRNA for type X collagen (tissue). After 3 days in culture, these cells initiate synthesis of type X collagen (cell cultures), and this is increased by overexpression of SP3 factor. Levels of type X collagen mRNA are normalized to -actin mRNA. D, immunohistological identification of type X collagen-positive cells in 1- and 3-day-old cultures of non-hypertrophic chondrocytes from the resting zone of the growth plate. Hoechst staining identifies nuclear DNA.

The potential of SP3 to counteract the inhibitory action of SP1 on the Col10a1 gene was further assessed by co-transfecting non-hypertrophic (Fig. 3B, NH) and hypertrophic (Fig. 3B, HYP) chondrocytes with pCATI and SP3 plasmid (pRC/CMV/SP3) (25). Overexpression of SP3 increased the relative CAT activity in both cell types up to 150% (Fig. 3B).

In addition, we analyzed the effect of SP3 on expression of endogenous type X collagen in the non-hypertrophic resting chondrocytes of the growth plate, which have the same low SP3/SP1 ratio as the non-hypertrophic chondrocytes from sterna. Similarly to its effect on sternal non-hypertrophic chondrocytes, higher levels of SP3 result in 2-fold increase of endogenous Col10a1 mRNA in resting chondrocytes as detected by real-time PCR (Fig. 3C, cell cultures). Although in vivo resting chondrocytes do not synthesize collagen type X, they initiate its synthesis very rapidly in cell cultures. A significant number of type X collagen-positive cells (up to 20%) can be detected immunohistologically in the overnight cultures of resting chondrocytes, and even more are present in the 3-day-old cultures (Fig. 3D). The levels of Col10a1 mRNA also dramatically increase in cultured cells compared with cells freshly isolated from the tissues, as confirmed by real-time PCR analysis (>300-fold increase, reaching levels of expression comparable with that in hypertrophic chondrocytes) (Table I; Fig. 3C). Thus, non-hypertrophic chondrocytes from the resting zone of the growth plate rapidly initiate the program of differentiation in vitro, resulting in high levels of endogenous collagen type X expression. Therefore, these cells are not suitable for the analysis of cell type-specific expression of the Col10a1 gene, and in our succeeding analyses we employed the non-hypertrophic chondrocytes from caudal third of sterna, which do not differentiate in cell cultures.

Individual copies of either CS1 or CS2, when attached to the basal pCAT X reporter, produced little if any expression above that of the pCAT X itself (data not shown). Therefore, we tested concatamers consisting of either six copies of CS1 or six copies of CS2 attached to the basal promoter (constructs pCAT-CS1 and pCAT-CS2, respectively) (Fig. 4A). The levels of CAT expression from the test constructs were compared with that of the minimal promoter of the Col10a1 gene, pCAT VII (nt –139 to +5), which can direct high levels of expression in a cell-specific manner (1). Both constructs were able to direct high levels of CAT expression in hypertrophic chondrocytes. However, only the pCAT-CS1 construct directed this expression in a cell type-specific manner that was statistically significant for hypertrophic cells; for pCAT-CS2, the same trend was suggested by the data, although the difference between hypertrophic and non-hypertrophic cells was not as obvious (Fig. 4B).

Although these analyses detected appreciable levels of CAT expression from both pCAT-CS1 and pCAT-CS2 in the transfected cells, especially in hypertrophic chondrocytes, this expression was lower than that with pCAT VII (nt –139 to +5) (Fig. 4B). It is unlikely that this difference is due to the spatial organization of the binding sites, a known parameter in transcriptional regulation of gene expression by two cis elements (28), because the designed multimers of six copies of either CS maintain the distance between the first and last CS copies equal to the size of the 45-bp intervening sequence in the native promoter.

An alternative possibility for the cell type-specific transcription of the pCAT VII minimal promoter was the presence of additional regulatory sites between the CS1 and CS2 sites, i.e. in the 45-bp intervening sequence, located at nt –115 to –75 (INT sequence).

Involvement of the Intervening Sequence in Cell Type-specific Expression of Collagen Type X— To assess the role of the INT sequence, which separates the CS1 and CS2 sites, we designed a derivative of the pCAT VII construct, pCAT XX, in which a 45-bp nonsense sequence replaced the original INT sequence (Fig. 4A). Relative reporter activity of pCAT XX was very low in both analyzed cell types, and no specific expression was observed in hypertrophic chondrocytes (Fig. 4C), indicating that the correct nucleotide sequence of this intervening region is required for cell type-specific transcriptional regulation, possibly due to the presence of sites for the binding of additional regulatory factors. The EMSAs using double-stranded DNA for the INT sequence as a probe identified two major protein bands retarded from the nuclear extracts of hypertrophic chondrocytes, but only one of these (the lower band) was present in the non-hypertrophic cells (Fig. 5A). This suggests that hypertrophic chondrocytes possess a nuclear complex (resulting in the upper band) that might be involved in the cell-specific expression of the Col10a1 gene because it is either absent from or unable to bind to the promoter in non-hypertrophic cells.

To further dissect the INT region, a panel of oligonucleotides was designed to cover its length (Fig. 5B). Only INT-2 (nt –99 to –75) and INT-3 (nt –105 to –85) retarded both bands in EMSA of nuclear extracts from hypertrophic cells, indicating that any potential transcription factors are binding to the overlapping region, i.e. between nt –99 and –85. This sequence (AGATAATACTGC between nt –99 and –87) was identified as a binding site for Dlx5/6 homeobox proteins by computer analysis with Genomatix software (indicated in Fig. 5B by a dark circle). No other known potential binding sites were identified within the 45-bp INT sequence. To determine whether any of the nuclear complexes in the hypertrophic chondrocytes are indeed retarded by a Dlx-binding sequence, we generated a mutated 45-bp INT probe (Mut-INT) by replacing the 6-bp core Dlx-binding sequence (nt –96 to –91, TAATTA) with a random sequence (CTGCAT). The Mut-INT retarded only the lower band from the nuclear extracts of hypertrophic chondrocytes, whereas the upper band was lost (Fig. 5C). This suggests that a Dlx-binding site in the INT sequence of the minimal chicken promoter binds a specific transcription factor in hypertrophic chondrocytes only and thus may be involved in the cell-specific expression of the Col10a1 gene by these cells. (The anti-Dlx antibodies available today do not cross-react with the chicken Dlx proteins, and therefore the supershift assays could not be performed in our studies.)

View larger version (29K): [in this window] [in a new window]   FIG. 4. Contributions of noncanonical CS1/CS2 SP-binding sites and the intervening sequence in cell type-specific expression of Col10a1 gene. A, schematic diagram of the CAT reporter constructs. B, CS1 DNA-binding site (pCAT-CS1) directs high levels of specific transcriptional activity in hypertrophic () compared with non-hypertrophic () chondrocytes. CS2 site (pCAT-CS2) provides for high levels of reporter activity in both cell types. Values of CAT reporter activity normalized to -galactosidase are expressed as a relative percentage compared with the expression levels of pCAT VII. C, the 45-bp intervening sequence in the minimal promoter of chicken Col10a1 is important for cell type-specific expression of collagen type X. The pCAT XX construct (a derivative of pCAT VII), in which the intervening sequence between CS1 and CS2 is replaced with a 45-bp nonsense sequence, directs very low levels of reporter activity in both non-hypertrophic () and hypertrophic () chondrocytes and fails to provide for cell type-specific expression in hypertrophic cells.

View larger version (20K): [in this window] [in a new window]   FIG. 5. The 45-bp intervening sequence (INT) in the minimal promoter binds a hypertrophic chondrocyte-specific transcription factor. A, protein binding was analyzed by EMSA. Two protein bands are retarded by the nt –115 to –70 intervening sequence in the nuclear extracts of hypertrophic chondrocytes, whereas only one protein band is retarded from the nuclear extract of non-hypertrophic chondrocytes. The differentially expressed protein band is marked with an arrow. B, schematic diagram of the intervening sequence and the overlapping primers used to narrow down the binding sites for the retarded proteins. The nt –99 to –85 region is responsible for retarding both protein bands from the nuclear extracts of the hypertrophic chondrocytes. The Dlx-binding site (at nt –99 to –87), identified by the Genomatix software program, is marked with a dark circle. C, the Dlx-binding site retards the upper protein band specific for hypertrophic chondrocytes. EMSA analysis used either the original 45-bp sequence of INT segment (INT) as a probe or the INT sequence with mutated 6-bp Dlx site (INT-Mut). No binding of the upper protein is detected with INT-Mut (marked by the arrow).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The tissue-specific expression of type X collagen has been studied extensively over the last decade, and significant progress has been made. Several growth factor-responsive elements have been identified in the promoter region of the gene (e.g. parathyroid hormone-releasing protein- and bone morphogenetic protein-7 (OP-1)-response elements) (29, 30), in addition to various transcription factors essential for its expression (e.g. Cbfa1 (Runx-2) and c-fos) (31, 32). Many of these elements are located in the distal promoter of the chicken gene. For example, the bone morphogenetic protein-responsive element is localized 2.5–2.9 kb upstream from the transcription start site (33). In addition to mediating bone morphogenetic protein signaling, this site may mediate the mechanical stress-induced expression of Col10a1 (34).

Interestingly, a 1.6-kb promoter of the chicken Col10a1 gene is sufficient for directing tissue-specific expression in transgenic mice (6, 35). Although the 4.6-kb promoter has higher tissue specificity, these data suggest that the cis regulatory elements required for cell-specific expression of the avian Col10a1 gene are present in the proximal 2-kb fragment. Moreover, detailed analyses of the chicken Col10a1 gene by transient transfection assays detected multiple regulatory domains enhancing tissue-specific transcription in even smaller proximal promoters, ranging down to 550 bp (13), and even 139 bp (1) upstream of the transcription start site.

Previous studies from our laboratory have suggested a role for the SPs in regulating the cell type-specific expression of type X collagen (1). The SP proteins, binding to GC-rich motifs in gene promoters, belong to the Krüppel-like family of transcription factors (XKLF), which are characterized by a three-zinc finger DNA-binding domain located toward the carboxyl terminus of the protein (27). Outside the zinc finger DNA-binding domain, the homology between the proteins is either low or not present at all. In mammals, seven SPs (SP1 to SP7) have been identified and characterized to date (14).

Usually, SP1, SP2, and SP4 act as transcriptional activators, whereas SP3 is generally considered to be a transcriptional repressor (17). Co-transfection experiments in Drosophila SL2 cells suggested a functional antagonism between SP1 and SP3 (36), with SP3 competing with SP1 for the same GC-boxes and thus suppressing the transcriptional activator functions of SP1 (20, 22). The SP factors form homotypic and heterotypic complexes with numerous proteins, including other SP family members (17–19). These complexes define the activity of SP factors as transcriptional activators or inhibitors in a given cell type. There is accumulating evidence that the roles of SP proteins in the regulation of transcription may vary depending on the cell type. For example, SP3 can act as a transcriptional activator of transforming growth factor- receptor type II in breast cancer cells (37) and of the human COL1A2 gene (38), whereas SP1 down-regulates expression of the cyclin-dependent kinase inhibitor p21WAF1/Cip1 in smooth muscle cells (39).

In the present study, we have observed that in non-hypertrophic chondrocytes, SP1 protein acts as an inhibitor of Col10a1 gene transcription, whereas SP3 acts as a transcriptional activator. First, we have shown that in non-hypertrophic cells that do not make type X collagen, both the SP1 protein and mRNA are more abundant (>10-fold) than in hypertrophic chondrocytes, which synthesize this collagen. Second, we demonstrate that a consensus SP1-binding site sequence linked to the basal promoter of chicken Col10a1 shows considerably less activity (4-fold) in non-hypertrophic chondrocytes than in hypertrophic cells. Lastly, we have observed that overexpression of SP1 in hypertrophic chondrocytes reduces the activity of the Col10a1 gene, whereas SP3 increases the activity of the Col10a1 gene, as deduced by expression from a 640-bp proximal promoter construct sufficient to drive cell type-specific expression in hypertrophic chondrocytes (24). All of these results are consistent with the high endogenous levels of SP1 in non-hypertrophic chondrocytes being responsible for negative regulation of type X collagen in this cell type.

View larger version (17K): [in this window] [in a new window]   FIG. 6. Dlx5 transcription factor positively regulates transcription of Col10a1. A, overexpression of Dlx5 in non-hypertrophic chondrocytes up-regulates transcription of the endogenous type X collagen and of the Col10a1 promoter. Endogenous expression of Col10a1 was analyzed by real-time RT-PCR in non-hypertrophic chondrocytes from the resting zone of the growth plate. Activity of the promoter was studied in non-hypertrophic sternal cells co-transfected with pCAT I and pCMV/Dlx5 expression vector (+Dlx5). Values of CAT reporter activity normalized to -galactosidase are expressed as fold induction relative to that obtained with pCAT I alone. B, Dlx5 is expressed at higher levels in hypertrophic (Hyp) versus non-hypertrophic (NH) chondrocytes as revealed by RT-PCR analysis. RT-PCR for -actin was performed as a positive control for the reaction.

Additional observations of the present study suggest that a Dlx transcription factor(s) directly regulates Col10a1 gene expression. Dlx genes are a family of homologs of the Drosophila Distal-less (Dll) gene. Throughout development, these transcription factors are expressed in various tissues and organs, including those of the skeletal system, with especially high levels in developing cartilages and in the perichondrium of cartilages that are undergoing endochondral ossification (40). Double inactivation of both Dlx5 and Dlx6 results in severe craniofacial, axial, and appendicular skeletal abnormalities (41). Because expression of collagen type X in hypertrophic cartilage is absent or severely retarded in the double knock-out genetic background (41), it has been suggested that Dlx5 and Dlx6 act during the transition from prehypertrophic to hypertrophic chondrocytes (42). A recent gain of function study suggests that Dlx5 is a positive regulator of chondrocyte hypertrophy in the chicken embryo (43). Consistent with these studies and in addition to them, our data show that Dlx5 may be directly involved in the regulation of Col10a1 gene expression in hypertrophic chondrocytes.

In the minimal 139-bp promoter of the chicken Col10a1 gene, the Dlx-binding site is a 10-bp sequence within the 45-bp intervening (INT) sequence located between the two SP binding sites (CS1 and CS2). The INT sequence itself is required for high level, tissue-specific expression of the gene in hypertrophic chondrocytes, as determined by transfection analysis. It binds, in a cell type-specific manner, a protein from nuclear extracts of hypertrophic chondrocytes. This binding depends on the presence of the Dlx consensus binding site. Additionally, we have shown that Dlx5 is up-regulated in hypertrophic chondrocytes, and overexpression of Dlx5 in non-hypertrophic chondrocytes activates the minimal 139-bp promoter of the Col10a1 gene in this cell type. These data, when taken together, provide evidence for the positive regulation of the proximal Col10a1 promoter by direct binding of Dlx protein(s). This mechanism of regulation may in part explain the phenotype of retarded chondrocyte maturation in the Dlx5/6-null mice (41).

Our present and previous (1) studies demonstrate the ability of the chicken proximal Col10a1 promoter to direct the cell type-specific expression in hypertrophic chondrocytes. Despite the fact that many skeletal abnormalities are associated with impaired regulation of chondrocyte hypertrophy, transcriptional regulation of the proteins specific for hypertrophic cartilage, such as collagen type X, is still unspecified. These studies demonstrate that the SP3/SP1 ratio may be an important regulator of Col10a1 expression and present the first evidence on the ability of a Dlx transcription factor to bind directly to the Col10a1 proximal promoter and thus regulate its cell type-specific expression.

	FOOTNOTES

 
^* This work was supported by National Institutes of Health Grant HD-23681. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Both authors contributed equally to this work.

^|| To whom correspondence should be addressed: Dept. of Anatomy and Cellular Biology, Tufts University, 135 Harrison Ave., J-333, Boston, MA 02111. Fax: 617-636-6536; E-mail: thomas.linsenmayer{at}tufts.edu.

¹ The abbreviations used are: SP, specificity protein; nt, nucleotide(s); RT, reverse transcription; EMSA, electrophoretic mobility shift assay; CAT, chloramphenicol acetyltransferase; CMV, cytomegalovirus.

	ACKNOWLEDGMENTS

 
We are grateful to Dr. Guntram Suske for providing the SP1 and SP3 expression vectors. We thank Drs. F. Long and A. Bendall for helpful discussions.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Long, F., Sonenshein, G. E., and Linsenmayer, T. F. (1998) J. Biol. Chem. 273,6542 –6549[Abstract/Free Full Text]
2. Schmid, T. M., and Linsenmayer, T. F. (1985) Dev. Biol. 107,373 –381[CrossRef][Medline] [Order article via Infotrieve]
3. Arias, J. L., Carrino, D. A., Fernandez, M. S., Rodriguez, J. P., Dennis, J. E., and Caplan, A. I. (1992) Arch. Biochem. Biophys. 298,293 –302[CrossRef][Medline] [Order article via Infotrieve]
4. Warman, M. L., Abbott, M., Apte, S. S., Hefferon, T., McIntosh, I., Cohn, D. H., Hecht, J. T., Olsen, B. R., and Francomano, C. A. (1993) Nat. Genet. 5,79 –82[CrossRef][Medline] [Order article via Infotrieve]
5. Ikegawa, S., Nishimura, G., Nagai, T., Hasegawa, T., Ohashi, H., and Nakamura, Y. (1998) Am. J. Hum. Genet. 63,1659 –1662[CrossRef][Medline] [Order article via Infotrieve]
6. Jacenko, O., LuValle, P. A., and Olsen, B. R. (1993) Nature 365,56 –61[CrossRef][Medline] [Order article via Infotrieve]
7. Kwan, K. M., Pang, M. K., Zhou, S., Cowan, S. K., Kong, R. Y., Pfordte, T., Olsen, B. R., Sillence, D. O., Tam, P. P., and Cheah, K. S. (1997) J. Cell Biol. 136,459 –471[Abstract/Free Full Text]
8. Gress, C. J., and Jacenko, O. (2000) J. Cell Biol. 149,983 –993[Abstract/Free Full Text]
9. Jacenko, O., Ito, S., and Olsen, B. R. (1996) Ann. N. Y. Acad. Sci. 785,278 –280[Medline] [Order article via Infotrieve]
10. Jacenko, O., Chan, D., Franklin, A., Ito, S., Underhill, C. B., Bateman, J. F., and Campbell, M. R. (2001) Am. J. Pathol. 159,2257 –2269[Abstract/Free Full Text]
11. LuValle, P., Hayashi, M., and Olsen, B. R. (1989) Dev. Biol. 133,613 –616[CrossRef][Medline] [Order article via Infotrieve]
12. Linsenmayer, T. F., Chen, Q. A., Gibney, E., Gordon, M. K., Marchant, J. K., Mayne, R., and Schmid, T. M. (1991) Development 111,191 –196[Abstract]
13. Dourado, G., and LuValle, P. (1998) J. Cell. Biochem. 70,507 –516[CrossRef][Medline] [Order article via Infotrieve]
14. Milona, M. A., Gough, J. E., and Edgar, A. J. (2003) BMC Genomics 4,43[CrossRef][Medline] [Order article via Infotrieve]
15. Gollner, H., Dani, C., Phillips, B., Philipsen, S., and Suske, G. (2001) Mech. Dev. 106,77 –83[CrossRef][Medline] [Order article via Infotrieve]
16. Nakashima, K., and de Crombrugghe, B. (2003) Trends Genet. 19,458 –466[CrossRef][Medline] [Order article via Infotrieve]
17. Suske, G. (1999) Gene (Amst.) 238,291 –300[CrossRef][Medline] [Order article via Infotrieve]
18. Majello, B., De Luca, P., and Lania, L. (1997) J. Biol. Chem. 272,4021 –4026[Abstract/Free Full Text]
19. Lania, L., Majello, B., and De Luca, P. (1997) Int. J. Biochem. Cell Biol. 29,1313 –1323[CrossRef][Medline] [Order article via Infotrieve]
20. Ghayor, C., Chadjichristos, C., Herrouin, J. F., Ala-Kokko, L., Suske, G., Pujol, J. P., and Galera, P. (2001) J. Biol. Chem. 276,36881 –36895[Abstract/Free Full Text]
21. Chadjichristos, C., Ghayor, C., Herrouin, J. F., Ala-Kokko, L., Suske, G., Pujol, J. P., and Galera, P. (2002) J. Biol. Chem. 277,43903 –43917[Abstract/Free Full Text]
22. Chadjichristos, C., Ghayor, C., Kypriotou, M., Martin, G., Renard, E., Ala-Kokko, L., Suske, G., de Crombrugghe, B., Pujol, J. P., and Galera, P. (2003) J. Biol. Chem. 278,39762 –39772[Abstract/Free Full Text]
23. Castagnola, P., Dozin, B., Moro, G., and Cancedda, R. (1988) J. Cell Biol. 106,461 –467[Abstract/Free Full Text]
24. Long, F., and Linsenmayer, T. F. (1995) J. Biol. Chem. 270,31310 –31314[Abstract/Free Full Text]
25. Hagen, G., Muller, S., Beato, M., and Suske, G. (1994) EMBO J. 13,3843 –3851[Medline] [Order article via Infotrieve]
26. Stocum, D. L., Davis, R. M., Leger, M., and Conrad, H. E. (1979) J. Embryol. Exp. Morphol. 54,155 –170[Medline] [Order article via Infotrieve]
27. Kaczynski, J., Cook, T., and Urrutia, R. (2003) Genome Biol. 4,206[CrossRef][Medline] [Order article via Infotrieve]
28. Aberdam, D., Virolle, T., and Simon-Assmann, P. (2000) Microsc. Res. Tech. 51,228 –237[CrossRef][Medline] [Order article via Infotrieve]
29. Harada, S., Sampath, T. K., Aubin, J. E., and Rodan, G. A. (1997) Mol. Endocrinol. 11,1832 –1845[Abstract/Free Full Text]
30. Riemer, S., Gebhard, S., Beier, F., Poschl, E., and von der Mark, K. (2002) J. Cell. Biochem. 86,688 –699[CrossRef][Medline] [Order article via Infotrieve]
31. Zhang, J. H., Tang, J., Wang, J., Ma, W., Zheng, W., Yoneda, T., and Chen, J. (2003) Int. J. Oncol. 23,1043 –1048[Medline] [Order article via Infotrieve]
32. Thomas, D. P., Sunters, A., Gentry, A., and Grigoriadis, A. E. (2000) J. Cell Sci. 113, Pt 3,439 –450[Abstract]
33. Volk, S. W., LuValle, P., Leask, T., and Leboy, P. S. (1998) J. Bone Miner. Res. 13,1521 –1529[CrossRef][Medline] [Order article via Infotrieve]
34. Wu, Q., Long, F., Linsenmayer, T. F., and Chen, Q. (2002) Trans. Orthop. Res. Soc. 27, PA34
35. Campbell, M. R., Gress, C. J., Appleman, E. H., and Jacenko, O. (2004) Am. J. Pathol. 164,487 –499[Abstract/Free Full Text]
36. Dennig, J., Beato, M., and Suske, G. (1996) EMBO J. 15,5659 –5667[Medline] [Order article via Infotrieve]
37. Ammanamanchi, S., Freeman, J. W., and Brattain, M. G. (2003) J. Biol. Chem. 278,35775 –35780[Abstract/Free Full Text]
38. Ihn, H., and Trojanowska, M. (1997) Nucleic Acids Res. 25,3712 –3717[Abstract/Free Full Text]
39. Kavurma, M. M., and Khachigian, L. M. (2003) J. Biol. Chem. 278,32537 –32543[Abstract/Free Full Text]
40. Zhao, G. Q., Zhao, S., Zhou, X., Eberspaecher, H., Solursh, M., and de Crombrugghe, B. (1994) Dev. Biol. 164,37 –51[CrossRef][Medline] [Order article via Infotrieve]
41. Robledo, R. F., Rajan, L., Li, X., and Lufkin, T. (2002) Genes Dev. 16,1089 –1101[Abstract/Free Full Text]
42. Bendall, A. J., and Abate-Shen, C. (2000) Gene (Amst.) 247,17 –31[CrossRef][Medline] [Order article via Infotrieve]
43. Ferrari, D., and Kosher, R. A. (2002) Dev. Biol. 252,257 –270[CrossRef][Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				H.-W. Su, S.-W. Wang, F. K. Ghishan, P. R. Kiela, and M.-J. Tang Cell confluency-induced Stat3 activation regulates NHE3 expression by recruiting Sp1 and Sp3 to the proximal NHE3 promoter region during epithelial dome formation Am J Physiol Cell Physiol, January 1, 2009; 296(1): C13 - C24. [Abstract] [Full Text] [PDF]

				B. Poree, M. Kypriotou, C. Chadjichristos, G. Beauchef, E. Renard, F. Legendre, M. Melin, S. Gueret, D.-J. Hartmann, F. Mallein-Gerin, et al. Interleukin-6 (IL-6) and/or Soluble IL-6 Receptor Down-regulation of Human Type II Collagen Gene Expression in Articular Chondrocytes Requires a Decrease of Sp1{middle dot}Sp3 Ratio and of the Binding Activity of Both Factors to the COL2A1 Promoter J. Biol. Chem., February 22, 2008; 283(8): 4850 - 4865. [Abstract] [Full Text] [PDF]

				D. Li, D. Mitchell, J. Luo, Z. Yi, S.-G. Cho, J. Guo, X. Li, G. Ning, X. Wu, and M. Liu Estrogen Regulates KiSS1 Gene Expression through Estrogen Receptor {alpha} and SP Protein Complexes Endocrinology, October 1, 2007; 148(10): 4821 - 4828. [Abstract] [Full Text] [PDF]

				K. Driller, A. Pagenstecher, M. Uhl, H. Omran, A. Berlis, A. Grunder, and A. E. Sippel Nuclear Factor I X Deficiency Causes Brain Malformation and Severe Skeletal Defects Mol. Cell. Biol., May 15, 2007; 27(10): 3855 - 3867. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 280/27/25331    most recent M412549200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Magee, C. Articles by Linsenmayer, T. F. Search for Related Content PubMed PubMed Citation Articles by Magee, C. Articles by Linsenmayer, T. F. Social Bookmarking                      What's this?