| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 280, Issue 27, 25361-25368, July 8, 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
¶||**
**¶¶
From the
Department of Cellular and Molecular
Medicine and ||Departments of Medicine and
Biochemistry and Microbiology and Immunology, Faculty of Medicine, University
of Ottawa, Ottawa, Ontario K1H 8M5, Canada, The
University of Ottawa Centre for Neuromuscular Disease, Ottawa, Ontario KIH
8L6, Canada, **Molecular Medicine Program, Ottawa
Health Research Institute, Ottawa, Ontario, Canada, and
Department of Neurosciences, University of
New Mexico School of Medicine, Albuquerque, New Mexico 87131
Received for publication, September 22, 2004 , and in revised form, May 3, 2005.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
AChE is encoded by a single gene that is alternatively spliced to produce catalytic subunits that can be assembled into different molecular forms. In skeletal muscle, the AChET transcript is predominantly expressed (10–13) resulting in the synthesis of a catalytic subunit that can associate with structural subunits encoded by separate genes (14). In particular, the asymmetric forms of AChE as well as AChE transcripts themselves are preferentially expressed at the level of the neuromuscular junction (14–17). In mature muscle, AChE expression is tightly controlled by nerve-evoked electrical activity as well as by nerve-derived trophic factors (14, 18–21). However, AChE is also known to be regulated during myogenic differentiation, at times preceding the occurrence of nerve-muscle interactions (22–24). Under these conditions, however, there is relatively little information available concerning the nature of the molecular mechanisms that control AChE expression.
In a recent study, we have shown that an increase in the transcriptional
activity of the AChE gene could partially account for the initial
increase in AChE transcript levels observed in differentiating muscle cells
grown in culture (25). In this
latter study, the contribution of E- and N-box motifs located within the first
intronic region, along with their respective transcription factors, myogenin
and GA-binding protein 
and -
, was shown to be involved in
mediating this transcriptional induction. More recent studies performed by
others have also highlighted the contribution of specific 5'-regulatory
regions in the AChE gene during myogenesis, including Sp1, Egr-1, and
cAMP response elements (26,
27). In our earlier study,
however, we noted a clear discrepancy between the observed increase in
transcription and the overall induction in AChE transcripts, thereby
suggesting that transcription alone could not fully account for the increase
in AChE expression seen at later stages of differentiation
(25). In agreement with a
previous report (23), our
results indicated that posttranscriptional events also participate in
regulating the abundance of AChE mRNAs in differentiating muscle cells
(19). Despite the implication
of posttranscriptional mechanisms, the nature of the specific trans- and
cis-acting elements involved in these regulatory events remains unclear. With
this in mind, we have therefore initiated a series of experiments in an
attempt to characterize the posttranscriptional mechanisms that regulate AChE
transcripts in differentiating muscle cells.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
Plasmid Construction and Transfection Studies—The
3'-untranslated region (UTR) of the mouse 
2.4-kb AChE mRNA was
isolated and subcloned into a Renilla luciferase reporter construct
driven by the thymidine kinase promoter (phRG-TK from Promega, Madison, WI) as
described previously (19,
28). The shorter 3'-UTR
was chosen for these studies because the first polyadenylation site is
predominantly used in differentiating C2C12 cells
(23). To generate the AChE
3'-UTR fragment without the AU-rich element (ARE), we employed a
PCR-based protocol described elsewhere and used to delete the ARE from the
GAP-43 mRNA (29). Briefly, the
AChE 3'-UTR cDNA was used as a template, and two rounds of PCR
amplification were first performed with the following primers:
5'-CGAGCCCCTAGCAGGGCTGGGATATAATACGACCGA-3' and the flanking primer
5'-AGGTCTCGGATCCTTTATTGGCGGCCCAGAGGGGCGAAGG-3' (reaction 1); and
the flanking primer 5'-AGGTCTCTCTAGACCCCTTGGGGAC CCCAG-3' and
primer 5'-TATCCCAGCCCTGCTAGGGGCTCGGGCAGGGCGGCA-3' (reaction 2). To
remove the internal ARE region (21 nucleotides), we performed a third round of
PCR with the reaction 1 and reaction 2 PCR products using the two flanking
primers listed above to yield a product containing the AChE 3'-UTR
without the ARE region as confirmed by sequencing.
The mouse HuR coding region was amplified by PCR from mouse muscle cDNA using primers designed from the available mouse HuR sequence that spans the entire coding region. The resultant PCR product was subcloned into the pCI-neo vector (Promega) driven by the cytomegalovirus enhancer/promoter. The resulting vector (pHuR) product was sequenced and used to stably transfect C2C12 cells that were selected for G418 resistance resulting in a mouse HuR overexpressing C2C12 stable cell line pool.
Plasmid DNA was prepared using the Mega-Prep procedure (Qiagen, Mississauga, Ontario, Canada). DNA pellets were resuspended in 10 mM Tris-HCl, pH 8.5. Transfections were performed with the Lipofectamine reagent kit (Invitrogen) according to the manufacturer's instructions. Briefly, C2C12 myoblasts at 80% confluency were transfected with a total of 2 µg of plasmid DNA (1.0 µg of either the reporter construct or the parental vector and 1.0 µg of the vector used for transfection efficiency). Transfection efficiency was monitored by co-transfecting the basic firefly luciferase construct (pGL3) or the basic LacZ reporter vector (30). Transfected myoblasts were collected 24–48 h after transfection or were induced to differentiate and collected 48–72 h later.
To determine reporter gene activity, transfected myoblasts and myotubes
were washed with cold 1x PBS, scraped, and lysed in 1x reporter
lysis buffer (Invitrogen) followed by several freeze-thaw cycles. The extracts
were centrifuged (12,000 x g for 10 min at 4 °C), and the
resulting supernatant was used for the luciferase assays (Renilla and
firefly) or for -galactosidase assays using the appropriate kits and
according to the manufacturer's instructions (Invitrogen). Values obtained for
the AChE reporter luciferase and control parental (phRG-TK) constructs were
standardized to the values obtained with firefly luciferase or with
-galactosidase, thereby controlling for transfection efficiency.
HuR siRNA and Transfection Studies—The HuR normal and mutant siRNA duplexes (target sequence, 5'-AAAAGUCUGUUCAGCAGCAUUGG-3', and mutant sequence, 5'-AAAAGUCAAUUCAUCAGCAAUGG-3') were obtained from Dharmacon RNA Technologies. C2C12 myoblasts were transfected with siRNA duplexes designed to mouse HuR sequence using the RNAiFect transfection kit (Qiagen) according to the manufacturer's instructions. Transfected myoblasts were harvested within 24–48 h, and RNA was extracted (see below) and used for reverse transcription (RT)-PCR (see below).
Adenoviral Construct and Infection Studies—An adenoviral
construct containing the human HuD sequence (AdLS5a) was generated using the
HuD sequence subcloned from the previously described pcHuD vector
(31). AdLS5a contains the
human HuD cDNA under the regulation of the cytomegalovirus promoter and bovine
growth hormone polyadenylation sequence. In these viruses, the HuD expression
cassette replaces the early region 1, and transcription is directed leftward,
relative to the conventional human adenovirus serotype 5 map. A control virus,
Ad-lacZ, contains the Escherichia coli -galactosidase gene
under the regulation of the murine cytomegalovirus promoter and simian virus
40 polyadenylation sequence, and transcription from the expression cassette is
directed rightward. The early region 1-deleted, first generation adenoviral
vectors used in these studies were constructed using a combination of
conventional cloning techniques and RecA-mediated recombination
(32,
33). Recombinant adenoviral
helper viruses were grown and titered on 293 cells as described previously
(34). 293 cells
(35) were grown in monolayer
in minimum essential medium supplemented with 100 units of penicillin/ml, 100
mg of streptomycin/ml, 2.5 mg of fungizone/ml, and 10% fetal bovine serum
(complete medium). All cell culture media and reagents were obtained from
Invitrogen.
Confluent C2C12 myoblasts were infected with 9.5 x 107 particles of the adenoviral construct in a volume of 100 µl of culture medium, with a multiplicity of infection of 475. At this multiplicity of infection, almost all of the cells on the plate were infected.2 The cells were placed in a humidified incubator at 37 °C and 5% CO2 for 1 h before the addition of a supplementary growth medium. During this period, the cell culture plates were agitated every 15 min to ensure that the HuD adenoviral construct was in contact with all of the cells in the dish. The culture medium was changed 24 h later, and myogenic differentiation was induced with a low serum culture medium. Infected myoblasts and myotubes were washed with 1x PBS 24–72 h following infection, and RNA was extracted and used for RT-PCR as described below.
RNA Extraction and RT-PCR—Total RNA was extracted from myoblasts and differentiating myotubes using 1.0 ml of TRIzol reagent (Invitrogen) according to the manufacturer's instructions and as described previously (25, 28). Precipitated RNA was resuspended in RNase-free water and stored at –80 °C until used. RNA from each sample was quantified using the Amersham Biosciences Gene Quant II RNA/DNA spectrophotometer and adjusted to a final concentration of 50 ng/µl.
Reverse transcription of 4 µl of RNA (200 ng) was performed using the Omniscript reverse transcription kit (Qiagen) as recommended by the manufacturer. Briefly, the RNA was reverse transcribed in a final volume of 20 µl of RT master mix, 0.5 mM concentration of each dNTP, 10 units of RNase inhibitor (Applied Biosystems, Foster City, CA), 1 µM random hexamers (Applied Biosystems), and 4 units of Omniscript reverse transcriptase. RT was carried out at 37 °C for 60 min. Negative controls consisted of the same RT mixture in which the RNA was replaced with RNase-free water. All of the samples were prepared using the same RT master mix.
PCR was used to amplify the cDNAs corresponding to AChE, HuR, and S12 ribosomal protein (S12 hereafter) mRNAs. The primers for AChE, S12 (used as an internal control), and HuR (5'-primer CAGAGGTCATCAAAGATGC and 3'-primer ATCCCACTCATGTGATCTAC) were synthesized based on available sequences and amplified products of 670, 368, and 394 bp, respectively (16, 17, 25, 36–38). PCR was performed using HotStarTaq DNA polymerase (Qiagen) according to the manufacturer's instructions. All of the samples were prepared using the same PCR master mix. PCR cycling parameters consisted of an initial activation step at 95 °C for 15 min followed by denaturation at 94 °C for 1 min; annealing at 70 °C (for AChE), 54 °C (for S12), and 57.5 °C (for HuR) for 1 min each; and extension at 70 °C (for AChE) for 2 min and 72 °C (for S12 and HuR) for 1 min followed by a 10-min elongation step at 72 °C. PCR amplification was stopped during the linear range of amplification (16, 17). Typically, the cycle numbers were 35 cycles for AChE, 24 cycles for S12, and 24 cycles for HuR. PCR products were visualized on ethidium bromide-stained 1.5% agarose gels and quantified using the fluorescent dye VistraGreen (Amersham Biosciences) in 1.5% agarose gels. Quantification was performed using the Storm PhosphorImager and the accompanying ImageQuant software (Amersham Biosciences). The values obtained for AChE and HuR were standardized relative to the corresponding level of S12 in the same sample.
In Vitro Stability Assay—Poly(A)+ RNA was isolated from a total RNA extract obtained from mouse brain using Oligotex mRNA mini kit (Qiagen) according to the manufacturer's instructions. Cytoplasmic protein fractions were prepared as described previously (39) from C2C12 cells stably transfected with the HuR cDNA (pHuR cells) or from cells stably transfected with the empty vector (pCI-neo) as control. Briefly, C2C12 cell pellets were homogenized in MOPS buffer (10 mM MOPS-NaOH, pH 7.2, 200 mM sodium chloride, 2.5 mM magnesium acetate) with 100 µM dithiothreitol, 100 µM phenylmethylsulfonyl fluoride, and 1 Complete Mini, EDTA-free Protease Inhibitor Cocktail tablet as per the manufacturer's recommendations (Roche Applied Science). Homogenates were centrifuged (10,000 x g for 15 min at 4 °C), and the resulting supernatants were stored until further use. After optimization of protein and RNA concentrations, 2.5 ng/µl poly(A)+ RNA were incubated with 0.2 µg/µl protein extracts in MOPS buffer containing 1 mM ATP, 0.1 mM spermine, 2 mM dithiothreitol, and 1 unit/µl SUPERa-sin (Ambion, Austin, TX) in a final volume of 180 µl and incubated at 37 °C. At intervals of 0, 15, and 30 min, aliquots of 40 µl were removed, and the reaction stopped by adding 200 µl of ice-cold phenol/chloroform. De-proteination and precipitation of the RNA was then carried out in the presence of yeast tRNA (10 µg) as a carrier. AChE mRNA was detected by RT-PCR as described above.
In Vitro Transcription—cDNAs encoding for the AChE
full-length 3'-UTR, the ARE region alone, and the AChE 3'-UTR
minus the ARE were obtained by PCR amplification of the
pGL3–3'-UTR plasmid as described previously
(19,
28). This cDNA was used as the
template for the in vitro transcription of the 3'-UTR. In
vitro transcription was performed with the T7 in vitro
transcription system (Promega) as recommended by the manufacturer. Briefly 0.5
µg of cDNA, 5 µCi of [-32P]UTP, nucleotides, RNase
inhibitor, and T7 polymerase were used to synthesize radiolabeled transcripts.
The template PCR was digested with DNase I for 20 min at 37 °C. The
resulting radiolabeled RNA was purified using the RNase-free G-25 RNA
purification column (Roche Applied Science). The integrity of the RNA was
verified by gel electrophoresis. Biotin-labeled transcripts (AChE 3'-UTR
with or without the ARE, and with the ARE region alone) were obtained using
the same method except that 0.5 µM bio-11-CTP (Sigma) was used
instead of the radiolabeled UTP. Unlabeled probes were generated by the same
method and used in competition assays.
Electrophoretic Mobility Shift Assay and Supershift—RNA-based electrophoretic mobility shift assays (REMSAs) and supershift assays were performed with total protein extracts obtained from myoblasts and myotubes. The cells were washed with 1x PBS, scraped, and lysed in 500 µl of homogenization buffer (0.3 M sucrose, 60 mM NaCl, 15 mM Tris, pH 8.0, 10 mM EDTA) supplemented with protease inhibitors (mini-complete protease inhibitor, Roche Applied Science) followed by several freeze-thaw cycles. The samples were centrifuged (15,000 x g for 15 min at 4 °C), and the resulting supernatants were stored at –80 °C in 20–100-µg aliquots to be used for REMSAs and other assays. The total amount of protein present in the extracts was determined with the Coomassie protein assay kit (Pierce).
REMSAs were performed as described previously (28). In brief, 20 µg of protein extract were incubated with 2 x 105 cpm of 32P-labeled AChE 3'-UTR or the ARE region in the presence of yeast tRNA (0.2 µg/µl) and heparin (2.5 mg/ml) for 20 min at room temperature. The mixture was separated by 5% native PAGE with 0.5x Tris borate-EDTA running buffer. The gels were subsequently dried and exposed to film at –80 °C. Competition assays were performed by incubating an excess of cold probe with the protein for 10 min prior to the incubation with the radiolabeled RNA. Supershift assays were performed by incubating the protein in the binding buffer with 0.5 µg of mouse monoclonal antibody directed against HuR (Molecular Probes, Eugene, OR) or a nonspecific antibody at room temperature for 1 h prior to the addition of the radiolabeled transcripts.
Immunoprecipitation and AChE mRNA Analysis—Immunoprecipitation of HuR from myoblasts and myotubes was performed as previously described with some modifications (28, 40). Myoblast and myotube protein extracts obtained as described above were precleared with 5 µg of normal mouse IgG (Santa Cruz Biotechnology, Santa Cruz, CA) and 30 µl of paramagnetic protein G Dynabeads (Dynal Biotech, Oslo, Norway) in 300 µl of immunoprecipitation buffer (10 mM Tris-HCl, pH 7.5, 1% Igepal CA-630, 1% bovine serum albumin fraction V, 2 mM EDTA, 3 mM magnesium acetate, 100 µM ZnCl2, 1 µg/ml yeast tRNA) for 1 h at room temperature with constant mixing. The precleared protein extracts were then incubated with 2 µg of a mouse monoclonal antibody directed to HuR (Molecular Probes) or normal mouse IgG (Santa Cruz Biotechnology) for 1 h at room temperature with constant mixing. The protein antibody solution was incubated with 30 µl of prewashed paramagnetic protein G Dynabeads for 1 h at room temperature with constant mixing. The protein G Dynabeads were washed with immunoprecipitation buffer three times, and the protein and mRNA were extracted with 0.5 ml of TRIzol according to the manufacturer's instructions. The mRNA was precipitated in the presence of 10 µg of RNase-free glycogen (GenHunter, Nashville, TN) and subsequently used for RT-PCR. The protein pellet was solubilized in 1x PBS with 1% SDS and used for Western blotting (see below).
mRNA-binding Protein Pull-down Assay—Myoblast and myotube protein extracts (100 µg) were incubated with 2 µg of biotin-labeled AChE 3'-UTR with and without the ARE or with the ARE region alone, in 1x binding buffer as used in REMSAs (20 mM Hepes, pH 7.5, 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM dithiothreitol, 0.1 mM ZnCl2, 5% glycerol, 0.2 mg/ml yeast tRNA) for 30 min at room temperature with intermittent mixing. The biotin-labeled RNA and associated mRNA-binding proteins were incubated with 50 µl of paramagnetic streptavidin Dynabeads (Dynal Biotech), prewashed in RNase-free buffers and 1x binding buffer for 1 h at room temperature with constant mixing, and washed three times with 1x binding buffer. The protein was solubilized in PBS and subjected to Western blot analysis for the detection of HuR.
Western Blot—For Western blotting, 25 µg of myoblast and
myotube protein extracts or proteins extracted from the mRNA-binding pull-down
assays were denatured in SDS loading buffer and subjected to 3% SDS-PAGE. The
separated proteins were transferred to nitrocellulose Trans-Blot transfer
medium (Bio-Rad, Hercules, CA). Following transfer the membranes were blocked
in either 10% nonfat skim milk or 10% bovine serum albumin in Tris-buffered
saline and Tween 20 for 1 h at room temperature with constant agitation. The
membranes were incubated with mouse monoclonal antibodies directed against HuR
(1:1,000) or -tubulin (1:5,000) (Sigma) followed by the appropriate
secondary antibody (1:10,000 or 1:25,000). The proteins were revealed using
the SuperSignal West Dura extended duration substrate enhanced
chemiluminescence kit (Pierce).
Statistical Analysis—An analysis of variance was performed to evaluate the effect of the AChE 3'-UTR on luciferase activity in transfected C2C12 cells. The Fisher's least squares difference test was used to determine whether the differences seen between group means were significant. The level of significance was set at p < 0.05. Data are expressed as mean ± S.E. throughout.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
10-fold over the levels seen in 50% confluent myoblasts. The extent of
this increase reached more than 50-fold in 4-day-old myotubes
(Fig. 1B). This
pattern of expression of AChE mRNA during myogenic differentiation is in
agreement with earlier reports
(23,
25).
Previous studies have also shown that changes in the transcriptional
activity of the AChE gene cannot solely account for the large
increase in transcript levels seen in myotubes, therefore implicating
posttranscriptional mechanisms such as those regulating transcript stability.
Because elements located in the 3'-UTR are often implicated in the
control of mRNA turnover (41,
42), we next sought to
determine whether the AChE 3'-UTR plays a role in regulating the
relative abundance of AChE transcripts in differentiating muscle cells. To
this end, we engineered a luciferase reporter construct in which the
endogenous 3'-UTR was replaced with the mouse AChE 3'-UTR
terminating at the first polyadenylation signal (see
Fig. 2A). The short
3'-UTR was chosen over the longer 3'-UTR because previous studies
have demonstrated that the first polyadenylation signal is used preferentially
over the second signal (23,
43). As a result, there is
significantly more of the 2.4-kb AChE mRNA in C2C12 cells than the
3.2-kb transcript. In addition, the short 3'-UTR was shown to be
important in the regulation of AChE mRNA expression during neuronal
differentiation of PC12 cells
(28,
44).
|
5-fold. To show the
specificity of this increase, we transfected a reporter construct containing
the 3'-UTR of utrophin. As expected on the basis of recent studies
showing a lack of posttranscriptional regulation of utrophin transcripts
during myogenic differentiation
(45,
46), no change in reporter
expression was observed between myoblasts and myotubes (data not shown). These
results highlight the specificity of the increase in reporter expression
obtained with the AChE 3'-UTR. The increased expression of the reporter
gene under these conditions supports the notion that the 3'-UTR is
involved in regulating AChE transcript levels during myogenic
differentiation. Pattern of Interactions between the AChE 3'-UTR and RNA-binding Proteins—We next examined the intensity and binding pattern of proteins found in myoblasts and myotubes that interact with the AChE 3'-UTR using REMSA. For these experiments, we used in vitro transcribed RNA that corresponded to either the full-length AChE 3'-UTR (FL) or to ARE. AREs are well characterized cis-acting elements found in UTRs that mediate transcript stability through interactions with destabilizing trans-acting factors such as AUF1 or with stabilizing trans-acting factors including those of the Hu family (41, 47). REMSA performed with the FL probe revealed the presence of two major protein-RNA complexes (Fig. 3, indicated with black arrows) that formed in myoblasts and myotubes. Although there is no apparent change in the mobility of these bands, the binding intensity of both complexes is greatly increased in myotubes, suggesting that the abundance of mRNA-binding proteins is increased in myotubes and/or that their binding characteristics to the AChE 3'-UTR are affected. This apparent increase in binding activity in myotubes was observed in several independent experiments using different protein extracts (n = 4). REMSA performed using the ARE probe also showed some important changes in the pattern of RNA-protein interactions in myoblasts versus myotubes (Fig. 3). In particular, there was a clear increase in the band intensity using proteins extracted from 4-day-old myotubes (Fig. 3, indicated with arrows). Here, again, the increased banding intensity obtained with differentiated myotubes was consistently observed (n = 3). The specificity of the binding was demonstrated in competition experiments using a cold probe to the ARE (Fig. 3, ARE-C). Taken together, these results suggest that there are specific RNA-binding complexes that interact with the AChE 3'-UTR in which the ability to bind to the 3'-UTR increases according to the state of myogenic differentiation.
|
In an initial experiment, we performed supershift REMSA with an antibody directed to HuR and protein extracts from myoblasts and myotubes, to determine whether HuR was present in the protein complexes interacting with the AChE 3'-UTR. As shown in Fig. 4A, the addition of the HuR antibody to the RNA/protein extract mixture resulted in the supershift of an RNA-protein complex formed using myotube protein extracts. This supershift was mostly evident using the myotube extract. As a control, no supershift was apparent when a nonspecific antibody was used instead of the antibody directed against HuR.
|
|
HuR Increases the Expression of AChE mRNA—To further
demonstrate that HuR has a direct effect on the level of AChE mRNA, we created
stable C2C12 cells that overexpressed HuR (pHuR). As shown in
Fig. 5A, endogenous
HuR protein levels are increased by severalfold in HuR-overexpressing muscle
cells. Stable transfections with the empty vector (pCI-neo), which was used as
a control in these experiments, showed no effect on endogenous HuR levels. We
next measured endogenous levels of AChE mRNA in these cells by RT-PCR. In
undifferentiated myoblasts, we did not observe any significant changes in AChE
mRNA levels between control and pHuR cells (data not shown, see
"Discussion"). In 2-day differentiated myotubes, however, we
observed an 3-fold increase in the levels of AChE mRNA
(Fig. 5, B and
C). Similarly, siRNAs directed against HuR resulted, as
seen previously (50), in a
decrease in HuR that in our experiments was accompanied by an 30%
decrease in the levels of endogenous AChE transcripts. Finally, infection of
C2C12 cells with an adenoviral vector encoding the highly related HuD family
member resulted in a further induction of AChE mRNA in myotubes (data not
shown).
|
2–3-fold in C2C12 cells that stably overexpressed HuR. In
additional control experiments, we verified that the ARE plays an important
role in this process because transfection of a reporter construct containing
the mutant AChE 3'-UTR fragment without the ARE decreased significantly
expression of the reporter. These results indicate that through its
interaction with the ARE located in the 3'-UTR, HuR increases the
expression of AChE transcripts in differentiating skeletal muscle cells. |
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
|
It is well established that transcript stability is governed by the presence of the 5'-cap, the 3'-poly(A)+ tail, and mRNA-binding proteins that bind to specific sequences or structures in the 3'-UTR. In skeletal muscle, recent studies have found that in response to different stimuli, the stability of certain transcripts, including vascular endothelial growth factor and cytochrome c oxidase (COX), is altered (49, 53). During myogenic differentiation, transcripts encoding the myogenic factors myoD and myogenin display increased stability that results, at least in part, from the specific binding of the mRNA-binding protein HuR (50, 54). The increase in the stability of these transcripts is important in dictating, in turn, the overall levels of proteins encoded by these mRNAs during myogenic differentiation.
HuR is a member of the ELAV (embryonic lethal abnormal vision)-like family of mRNA-binding proteins that includes the neuronally expressed HuB (HelN1), HuC, and HuD proteins (48). These proteins contain three RNA recognition motifs that are known to bind AREs: the AUUUA general sequence, U-rich sequences, and CU-rich motifs (55, 56). The function of this family of mRNA-binding proteins is to stabilize transcripts by inhibiting the de-adenylation and targeting of the transcripts to the exosome or by blocking the activity of specific endonucleases that recognize the AREs (57–59). Using several complementary approaches, we have shown here that HuR can directly interact with AChE transcripts via their 3'-UTR. Additionally, overexpression of HuR in stably transfected C2C12 cells, as well as down-regulation of HuR via siRNA, clearly affected the endogenous levels of AChE mRNA through the 3'-UTR. In parallel experiments, we have also found that HuD, although not normally expressed in muscle, can increase AChE transcript levels in differentiated cells. This indicates that the Hu proteins share similar target preferences. Thus, AChE joins a growing family of transcripts that contain varying types of AREs that are stabilized by the Hu family of proteins in several distinct tissues (40, 41, 49, 60, 61).
Transcriptional and Posttranscriptional Regulation of AChE—Myogenic differentiation is a complex process involving the expression of several genes including those encoding proteins found at the neuromuscular junction (for review see Refs. 62–65). Previous studies have established that the expression of genes encoding synaptic proteins in muscle is most often induced by myogenic regulatory factors such as myoD and myogenin (63). As mentioned above, recent studies have demonstrated that HuR binds to elements in the 3'-UTR of myoD and myogenin during myogenic differentiation, resulting in an increase in the stability of these transcripts (50, 54). Thus, transcription factors that are key to the process of myogenic differentiation are themselves regulated posttranscriptionally by HuR (50, 54).
In the present study, we found that AChE, for which transcriptional regulation during myogenic differentiation is known to involve myogenin and an E-box (25, 26), is also a direct posttranscriptional target for the stabilizing effects of HuR. Together, the results of these and other studies show that AChE expression is regulated by increases in transcription as well as by increases in transcript stability during myogenic differentiation (28). In this context, our preliminary studies performed with pHuR stable C2 cells have shown that overexpression of HuR does increase the expression of an AChE promoter-reporter construct.3 Accordingly, combined with earlier studies that focused on the role of HuR in myogenic differentiation, our findings further indicate therefore that HuR assumes a key regulatory function: (i) by controlling the stability of mRNAs encoding transcription factors known to modulate the transcriptional activity of the AChE gene during myogenic differentiation; and (ii) by also directly controlling the stability of AChE transcripts. Such dual roles for HuR in differentiating myogenic cells would confer to this RNA-binding protein a master regulatory function necessary to optimize gene expression via both transcriptional and posttranscriptional events (see further discussion in Refs. 60 and 66–68).
Additional Factors Regulate AChE Expression
Posttranscriptionally—On the basis of our studies, however, it
appears that HuR is not the sole factor important for modulating the abundance
of AChE transcripts in differentiating myotubes at the posttranscriptional
level, as suggested by the 50–100-fold increase in AChE mRNA
versus the 3-fold increase caused by HuR. Indeed, we observed
the formation of different protein complexes with both the full-length and the
ARE probes using extracts from myoblasts and myotubes. The 3'-UTR of
transcripts often behave in a fashion similar to 5'-regulatory regions
of genes because several trans-acting factors with different properties may
bind with different affinities to form active complexes that affect the
stability of specific transcripts. For instance, the 3'-UTR of
cyclooxygenase-2, GAP-43, and BC1 are all known to associate with a number of
different mRNA-binding proteins
(31,
61,
69–71).
In addition, the same cis-acting elements within the 3'-UTR, including
the ARE, can also interact with different trans-acting factors that have
contrary effects such as the predominantly destabilizing factors AUF1 and
tristetraprolin and the stabilizing factor HuR
(61,
72,
73). In some cases, the level
of expression of the different factors and their binding affinity may
determine the preferential level of interaction of one factor versus
another that can result in dramatically opposite effects
(74). Therefore, HuR may
represent only one of the several RNA-binding proteins that can interact with
AChE transcripts to modulate their expression during myogenic
differentiation.
In addition to the myriad of trans-acting factors that are expressed in cells under specific conditions, there are other elements that also need to be considered because they may regulate the binding ability and specificity of these RNA-binding proteins. In this context, one intriguing finding in our study was the inability of HuR from myoblasts to bind exogenous AChE 3'-UTR, despite the presence of HuR in these cells (data not shown). In fact, RT-PCR assays and Western blotting experiments revealed that HuR is equally abundant in myoblasts and myotubes (data not shown) as was also observed by others (see also Ref. 50). This indicates therefore that additional regulatory events favor HuR-RNA interactions in myotubes. One possibility involves the cellular localization of HuR in myoblasts versus myotubes. Previous studies have demonstrated that HuR is predominantly localized in nuclei in myoblasts and that it shuttles out to the cytoplasm during myogenesis where it can interact with and stabilize specific transcripts (50, 54). Because in our study we used total protein extracts containing equivalent amounts of HuR protein and found that HuR from myoblast extracts was unable to bind the AChE 3'-UTR, we speculate that there must be some modifications or other factors that affect the ability of HuR to bind to exogenous, in vitro transcribed, AChE transcripts or to those already present in the cytoplasm. The regulation of HuR binding could indeed be mediated by posttranslational modifications, such as phosphorylation or methylation. In this context, metabolic stress was recently shown to regulate the cytoplasmic localization of HuR and its binding through activation of the AMP-activated kinase (75). In addition, HuR has been shown recently to be methylated by the arginine methyltransferase CARM1 (co-activator-associated arginine methyltransferase) in the hinge region adjacent to the novel nuclear localization signal, resulting in a nuclear-cytoplasmic shuttling ability and/or enhanced interactions with other proteins or transcripts (76, 77). Therefore, although our study clearly highlights the important role of HuR in the regulation of AChE mRNA in differentiating myogenic cells, there are several aspects relevant for our complete understanding of the nature of these posttranscriptional regulatory events that are obviously complex and that will hence necessitate further experimentation.
|
FOOTNOTES |
|---|
¶ Recipient of a fellowship from the Association Française contre les
Myopathies.
¶¶ A CIHR investigator. To whom correspondence should be addressed: Dept. of Cellular and Molecular Medicine, University of Ottawa, 451 Smyth Rd., Ottawa, Ontario K1H 8M5, Canada. Tel.: 613-562-5800 (ext. 8383); Fax: 613-562-5636; E-mail: jasmin{at}uottawa.ca.
1 The abbreviations used are: AChE, acetylcholinesterase; ARE, AU-rich
element; FL, full-length AChE 3'-UTR; PBS, phosphate-buffered saline;
REMSA, RNA electrophoretic mobility shift assay; UTR, untranslated region; RT,
reverse transcription; siRNA, small interfering RNA; S12, S12 ribosomal
protein; MOPS, 4-morpholinepropanesulfonic acid.
2 R. J. Parks, unpublished observations.
3 G. Bélanger and B. J. Jasmin, unpublished observation..
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
