|
Originally published In Press as doi:10.1074/jbc.M501371200 on May 19, 2005
J. Biol. Chem., Vol. 280, Issue 28, 26193-26199, July 15, 2005
Chloramphenicol-induced Mitochondrial Stress Increases p21 Expression and Prevents Cell Apoptosis through a p21-dependent Pathway*
Ching-Hao Li,
Su-Liang Tzeng,
Yu-Wen Cheng, and
Jaw-Jou Kang
From the
Institute of Toxicology, College of Medicine, National Taiwan University, Taipei 100, Taiwan
Received for publication, February 4, 2005
, and in revised form, April 11, 2005.
 |
ABSTRACT
|
|---|
Pretreatment of HepG2 and H1299 cells with chloramphenicol rendered the cells resistant to mitomycin-induced apoptosis. Both mitomycin-induced caspase 3 activity and PARP activation were also inhibited. The mitochondrial DNA-encoded Cox I protein, but not nuclear-encoded proteins, was down-regulated in chloramphenicol-treated cells. Cellular levels of the p21waf1/cip1 protein and p21waf1/cip1 mRNA were increased through a p53-independent pathway, possibly because of the stabilization of p21waf1/cip1 mRNA in chloramphenicol-treated cells. The p21waf1/cip1 was redistributed from the perinuclear region to the cytoplasm and co-localized with mitochondrial marker protein. Several morphological changes and activation of the senescence-associated biomarker, SA -galactosidase, were observed in these cells. Both p21waf1/cip1 antisense and small interfering RNA could restore apoptotic-associated caspase 3 activity, PARP activation, and sensitivity to mitomycin-induced apoptosis. Similar effects were seen with other antibiotics that inhibit mitochondrial translation, including minocycline, doxycycline, and clindamycin. These findings suggested that mitochondrial stress causes resistance to apoptosis through a p21-dependent pathway.
 |
INTRODUCTION
|
|---|
Apoptosis, a genetically conserved physiologic process, plays a major role in the elimination of injured or unwanted cells in many physiological and pathological conditions. One apoptotic signaling pathway, termed the mitochondrial-dependent pathway, causes the release of mitochondrial cytochrome c into the cytosol where it then binds to Apaf-1 and caspase 9 and activates caspase 3 (13). The activation of executive caspases will lead to cleavage of PARP, lamin, and more than 100 other proteins and to DNA fragmentation (45). Mitochondria are also involved in the death receptor-associated extrinsic apoptotic pathway, where they mediate an amplification of the death signal. Thus, damage to mitochondrial integrity or function usually results in limited apoptosis in many cell types (68).
Mitochondrial damage such as mutations in the mtDNA or a deficiency of respiratory enzymatic activity are strongly correlated with age-related disease processes, especially carcinogenesis, tumorigenesis (8), and tumor progression (9). Hypotheses for explaining such effects are associated with an increase in reactive oxygen species generation (1011), compensative activation of anaerobic energy metabolism (12), and overexpression in transforming growth factor- (9, 13) or with expression of specific stress-associated genes, including cathepsin L (9), p21Cip1 (14), p27Kip1 (13). The p21Cip1 and p27Kip1 are universal cyclin-dependent kinase inhibitors (CKIs)1 that inhibit cell cycle progression and determine the fate of the cell through apoptosis, differentiation, and senescence. The induction of p21Cip1 and p27Kip1 were associated with genotoxins, oxidants, and metabolic perturbation. Recent studies show that inhibition of mitochondrial oxidative phosphorylation by 1-methyl-4-phenylpyridinium iodide or desferrioxamine mesylate will induce CKI accumulation and halt cell cycle progression (1314). Besides cell cycle regulation, increased p21Cip1 expression is also believed to profoundly affect the fate of the stressed cell, frequently favoring cell survival (1517).
Several antibiotics, including chloramphenicol, minocycline, doxycycline, and clindamycin, show potent bacteriostatic effects and are also inhibitors of mitochondrial translation in mammalian cells. Formation of gigantic mitochondria and free radical generation were reported in chloramphenicol-treated cells (1820). The adverse effects of chloramphenicol limit the clinical therapeutic administration of this antibiotic in Third World countries and in veterinary medicine (2122). Recently, several novel therapeutic effects were reported with minocycline in protecting neurons and preventing neurodegenerative diseases (2324) through the suppression of cell death (2526).
In the present studies, we found that chloramphenicol treatment causes an increase in cellular p21Cip1 level and resistance to anti-neoplastic administration in cancer cells. Mitomycin-induced caspase 3 activation was inhibited in chloramphenicol-treated cells, but caspase 3 activation could be restored by both p21Cip1 antisense and siRNA treatment. The results suggest that mitochondrial stress in cells induces resistance to apoptosis through a p21Cip1-dependent pathway.
 |
EXPERIMENTAL PROCEDURES
|
|---|
Cell Culture and TreatmentsHepatocarcinoma cell line HepG2 (p53+/+) and non-small cell lung cancer cell line H1299 (p53/, p21+/+) kindly donated by Dr. Y. S. Lin, were maintained in Dulbecco's modified Eagle's medium with 10% heat-inactivated fetal bovine serum and cultured in a humidified atmosphere of 5% CO2 in a 37 °C incubator. Chloramphenicol was dissolved in ethanol, protected from light, and prepared fresh each time it was used. The solvent content was less than 5 µl/ml in all studies.
Sub-G1 DNA Population EstimationCells seeded on 12- or 6-well plates were trypsinized and fixed overnight in 70% ethanol. To identify and quantify DNA content, cells were resuspended in phosphate-buffered saline containing RNase A (10 µg/ml) and propidium iodide (25 µg/ml) and analyzed by flow cytometry (BD Biosciences) equipped with an FL2 filter. Apoptotic cells were identified by a sub-G1 peak localized below the G0/G1 peak (27).
Determination of the Mitochondrial Membrane PotentialFor detection of the mitochondrial membrane potential ( m), 40 nM DiOC6 was added and incubated for 15 min at 37 °C (27). DiOC6 is a lipophilic fluorochrome enriched in positive charge that diffuses across the inner membrane dependent on  m. Cells after chloramphenicol treatment were loaded with DiOC6 and incubated for 15 min at 37 °C. Finally, cells were harvested by trypsinization, and the fluorescence was measured by flow cytometry (BD Biosciences).
Western Blotting and Cytochrome c ReleaseTo obtain total cellular protein extracts, the cell monolayers were washed with phosphatebuffered saline and lysed in radioimmune precipitation assay lysis buffer. To obtain the cytosolic fraction for determination of cytochrome c release (28), cells were collected by centrifugation (1000 x g) and resuspended in buffer A (10 mM Hepes-KOH, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM dithiothreitol, proteinase inhibitor mixture, and 100 µg/ml digitonin). The samples were kept on ice for 20 min, and the cells were pelleted by high speed centrifugation (15,000 x g) for 10 min. The supernatant was stored for SDS-PAGE. Protein concentration was determined using the Borford reagents (Bio-Rad). Each sample was aliquoted and separated on SDS-PAGE with consistent voltage for 34 h. For immunodetection, protein samples in the gel were transferred onto a polyvinylidene difluoride membrane, blocked in nonfat milk, and incubated in TBST (Tris-buffered saline Tween 20) with antibodies specific to cytochrome c, p21, proliferating cell nuclear antigen, caspase 3 (Santa Cruz Biotechnology), p16, p27 (NeoMarker), Cox I, core II (Molecular Probes), phospho-c-Jun NH2-terminal kinase (Cell Signaling), p53 (Upstate%20Biotechnology">Upstate Biotechnology), PARP (eBioscience), and actin (Sigma). The chemoluminescence was enhanced by an ECL kit (PerkinElmer Life Sciences) as described by the manufacturer.
Senescence-associated (SA) -Galactosidase StainingCells were washed and fixed for 3 min in 2% formaldehyde/0.2% glutaraldehyde at room temperature. SA- -galactosidase activity was stained in solution (150 mM NaCl, 2 mM MgCl2, 40 mM citric acid, 5 mM sodium phosphate, pH 6.0, 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide) with 1 mg/ml X-Gal at 37 °C for 2448 h. The blue crystal from X-Gal cleavage could be detected locally in senescent cells (29).
RNA Extraction and RT-PCRTotal RNA was extracted according to Chomczynski and Sacchi (30). RT-PCR was performed by using SuperscriptTM (Invitrogen). Briefly, 3 µg of total RNA was denatured at 70 °C for 10 min and then reverse transcribed by 200 units of RT enzyme at 42 °C for 50 min. To end the reaction, the cDNA products were heated at 70 °C for 15 min. Target gene expression was detected by PCR amplification by using specific primer pairs (p21: sense CTGGGGATGTCCGTCAGAAC, antisense GAGTCTCCAGGTCCACCTGG; actin: sense TCATGAGGTAGTCAGTCAGG, antisense TGACCCAGATCATGTTTGAG). PCR was performed for 35 cycles in 25 µl of reaction mixture; cycling conditions were 94 °C for 40 s, 60 °C for 40 s, and 72 °C for 1 min. PCR products were visualized in 2% agarose gels stained with EtBr.
p21 Promoter Reporter AssayTwo constructs, the full-length 2.4-kb p21 promoter-luciferase reporter construct (pGL2-Waf1) (31) and the pRK5-laz construct (donated by Dr. Y. S. Lin), were transiently transfected into H1299 with Lipofectamine 2000 as recommended by the manufacturer. Chloramphenicol was added at the desired time point, and cells were lysed in buffer (100 mM potassium phosphate, pH 7.8, 1 mM EDTA, 10% glycerol, 1% Triton X-100, and 7 mM -mercaptoethanol). Luciferase activity was measured by a luciferase assay system (Promega). Briefly, 5 ml of sample was added to 45 ml of luciferase assay reagent, and the luminescence was recorded by luminometer after 1 min. The internal -galactosidase activity was assayed in 600 µl of buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgCl2 and 50 mM -mercaptoethanol) containing 120 µl of the substrate o-nitrophenyl- -D-galactopyranoside (2 mg/ml). The mixture was mixed gently and incubated at 37 °C for 13 h. The reaction was stopped by 300 µl of 1 M Na2CO3, and the colorimetric changes were quantified by spectrophotometer (DU-650; Beckman). The number of -fold increase in p21 reporter can be determined by comparing the luminescence with an uninduced control that is then normalized with the -galactosidase activities.
Laser Confocal MicroscopyFor immunofluorescent studies, cells were seeded onto cover glasses and cultured as previously. After treatments, cells were incubated in ice-cold methanol at 20 °C for 20 min for fixation and permeability. Before being mounted, samples were incubated in specific antibodies (antibody diluted in PBST with Tween 20, with different dilutions ranging from 1:1000 to 1:200) overnight at 4 °C, and then secondary antibodies were conjugated with fluorescein isothiocyanate or TRITC at room temperature for 2 h. Cells were observed under Leica confocal laser microscopy with excitation at 488 and 543 nm, respectively.
Plasmids, siRNA, and Antisense Oligonucleotide TransfectionTo perform transfections, H1299 cells were seeded at a density of 5 x 105 cells in 10-cm culture plates or 1 x 105 cells in 6-well plates. Twenty-four hours later, the cells in each plate were transfected with 20 µg of empty vector or pCEP4-p53wt by calcium phosphate precipitation (32). The transfecting medium was refreshed after 12 h, and cells were harvested at indicated intervals. For p21 siRNA (Santa Cruz Biotechnology) or phosphorothioate antisense oligonucleotide (p21 antisense: 5'-ATCCCCAGCCGGTTCTGACAT-3'; p21 sense: 5'-ATGTCAGAACCGGCTGGGGAT-3') studies, HepG2 and H1299 cells were transfected by using Lipofectamine 2000 (Invitrogen) as described (33). Briefly, 510-µg oligomers and 1 µg of Lipofectamine were diluted in 50 µl of incomplete Dulbecco's modified Eagle's medium, respectively, and then mixed vigorously and incubated at room temperature. Twenty minutes later, 100 µl of the mixture were layered on 500 µl of complete medium without penicillin/streptomycin. Cells were transfected for 6 h and then treated with chloramphenicol or other manipulation as described.
Caspase 3 Activity MeasurementCellular caspase 3 activity that recognizes the sequence DEVD was assayed using a caspase 3/CPP32 colorimetric assay kit (BioVision). After 12 h of apoptotic stimulation, cells were lysed in lysis buffer and centrifuged at 10,000 x g for 5 min. The supernatant was collected, and a volume containing 50100 µg of protein was diluted to 50 ml with lysis buffer for each assay. The lysate was then mixed with 50 µl of 2x reaction buffer (containing 10 mM dithiothreitol), and 200 µM DEVD-pNA substrate was added. The reaction was performed in a 37 °C water bath for 12 h. The cleaved pNA, with a light emission at 405 nm, was quantified by using an enzyme-linked immunosorbent assay reader (Dynatech MR-7000). The -fold increase in caspase 3 activity was determined by comparing the absorbance of pNA from the apoptotic sample with the absorbance of pNA from an uninduced control.
Statistical AnalysisThe results are expressed as the mean ± S.E. of at least three independent experiments. Paired data were evaluated by Student's t test.
 |
RESULTS
|
|---|
Chloramphenicol Inhibited the Apoptosis Induced by Mitomycin C in HepG2 CellsThe DNA-damaging agent mitomycin C (MMC) induced apoptosis in HepG2 cells, with features including DNA fragmentation (Table I), loss of the mitochondrial transmembrane potential (Fig. 1A), release of cytochrome c, and cleavage of PARP (Fig. 1B). Pretreatment with chloramphenicol (20 and 100 µg/ml) for 48 h prior to MMC exposure greatly attenuated these MMC-induced apoptotic effects (Table I; Fig. 1). A similar response was seen with H1299 cells, but not with Hep3B cells (Table I). Although chloramphenicol treatment attenuated the MMC-induced apoptosis, the induction of p53 and p21 proteins by MMC was not affected (Fig. 2A).
View this table:
[in this window]
[in a new window]
|
TABLE I Chloramphenicol-treated HepG2 and H1299 cells, but not Hep3B cells, were resistant to the apoptotic stimulus
Cells were exposed to MMC and then harvested 24 hours later. Cells were pretreated with chloramphenicol 48 h prior to addition of MMC and co-incubated with MMC until the experiment was halted. In p53-null H1299 cells, wild-type p53 was transfected by calcium phosphate precipitation, and cells were harvested 48 h later. Apoptotic index (%) was determined by propidium iodide-stained DNA fragments as described under "Experimental Procedures", and the data were expressed as mean ± S.E. The data were analyzed by Student's t-test. * represents statistical significance in comparison to control. *, p <0.05; **, p <0.01; ***, p <0.001. # represents the statistical significance in comparison to apoptotic stimulus-treated cells without chloramphenicol. ND, not detected.
|
|
Chloramphenicol Treatment Reduced the Expression of Mitochondrial-encoded Protein and Augmented p21 Expression The expression of the mitochondrial-encoded Cox I protein was greatly reduced in chloramphenicol-treated HepG2 cells. The expression of nuclear DNA-encoded protein, core II, was not affected (Fig. 2A). However, chloramphenicol treatment induced p21 protein expression (Fig. 2A). The induction of p21 protein was dose dependent (Fig. 2B). In agreement with its ability to inhibit MMC-induced apoptosis, chloramphenicol treatment induced p21 in H1299 cells, but not in Hep3B cells (Fig. 2C).
Chloramphenicol Augments p21 Protein and mRNA Expression by Increasing mRNA StabilityPrevious data show that chloramphenicol induced p21 protein expression in both HepG2 and p53-null H1299 cells, suggesting that p53 might not be involved. The effect of chloramphenicol on p21 expression was further investigated in p53-null H1299 cells. The expression of mitochondrial-encoded Cox I, but not nuclear-encoded proliferating cell nuclear antigen, was inhibited by chloramphenicol treatment, as seen in HepG2 cells (Fig. 3A). Chloramphenicol treatment caused an overexpression of p21 protein in a time-dependent manner (Fig. 3A). Other CKIs, p16 but not p27, were also overexpressed in chloramphenicol-treated H1299 cells. In addition, p21 mRNA was increased in chloramphenicol-treated H1299 cells (Fig. 3B).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 1. The effects of chloramphenicol pretreatment on mitochondrial membrane potential, cytochrome c release, and PARP cleavage in MMC-treated HepG2 cells. A, chloramphenicol pretreatment reversed the collapse of the mitochondrial transmembrane potential in MMC-treated cells. For mitochondrial membrane potential analysis, MMC-treated cells (6 h) were trypsinized and stained with DiOC6 as described under "Experimental Procedures." The fluorescent intensity was collected and calculated by flow cytometry. * represents the statistical significance in comparison to control: *, p <0.05; **, p <0.01; ***, p <0.001. ### represents the statistical significance (p <0.001) of MMC-induced membrane potential changes between cells with or without chloramphenicol pretreatment. B, Western blots show the changes in cytochrome c (cyt-c) release and PARP cleavage in chloramphenicol-treated HepG2 cells. Cytosolic cytochrome c was isolated through digitonin permeability as described under "Experimental Procedures" and immunodetected by using -cytochrome c antibody. The data show that MMC induced mitochondrial cytochrome c release under both conditions; however, downstream PARP cleavage was detected only in cells without chloramphenicol pretreatment.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 2. Chloramphenicol inhibited mitochondrial-encoded protein expression and induced p21 induction. A, Western blots show the changes in cellular p53, p21, Cox I, and core II levels before and after MMC administration in HepG2 cells with or without chloramphenicol pretreatment. Total lysates from MMC-treated cells (5 µg/ml; 12 h) were extracted, separated by 12% SDS-PAGE, and immunodetected by -p53, -p21, -Cox I, and -core II antibodies. B, total lysates from chloramphenicol-treated (0100 µg/ml for 48 h) HepG2 cells were extracted, separated by SDS-PAGE, and immunodetected by antibodies specific to p21, COX I, and actin. The results showed a dose-dependent correlation between p21 expression and inhibition of mitochondrial translation. C, chloramphenicol-induced p21 expression was detected in H1299 and Hep3B cells by RT-PCR as described under "Experimental Procedures."
|
|
A reporter assay was performed to evaluate the direct effect of chloramphenicol on p21 transcription in H1299 cells transfected with the plasmid containing p21 promoter and luciferase. The luciferase activity was greatly enhanced when p53 was co-transfected, but not when treated with chloramphenicol (Fig. 3C), suggesting that chloramphenicol treatment did not affect the transcription of p21. The cellular content of p21 mRNA was increased after pretreatment with chloramphenicol and gradually decreased with time in the presence of actinomycin D (5 ng/ml) when the chloramphenicol was withdrawn from the medium (Fig. 3D). However, continuous exposure to chloramphenicol prevented the degradation of p21 mRNA. The half-life of p21 mRNA was calculated to be 18 and 26 h in the absence and presence of chloramphenicol, respectively.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3. Chloramphenicol induced an increase of p21 protein and mRNA in p53-null H1299 cells through increasing mRNA stability. A, the p53-null H1299 cells were treated with chloramphenicol (20 µg/ml; 048 h), and the total proteins were extracted and separated by SDS-PAGE. The changes in p21, p16, p27, Cox I, and proliferating cell nuclear antigen contents were determined by Western blotting. The CDK inhibitors p21 and p16, but not p27, were up-regulated in response to chloramphenicol-associated translational inhibition. B, the increase in p21 mRNA level in chloramphenicol-treated H1299 cells. Total RNA was isolated and reverse transcribed to cDNA as described under "Experimental Procedures." The p21 cDNA was amplified by Taq polymerase with a specific primer pair, as given under "Experimental Procedures." C, p21 promoter reporter assay. H1299 cells were co-transfected with pGL2-Waf1 (0.5 mg/well) and pRK5-laz (0.1 µg/well) by Lipofectamine 2000 as described under "Experimental Procedures." After treatments, cells were lysed and luciferase activity was determined by the luciferase assay system (Promega). The data showed that chloramphenicol-induced p21 expression is independent of p21 promoter activation. D, chloramphenicol stabilized p21 mRNA. H1299 cells were treated with actinomycin D (Act D) (5 ng/ml) and co-incubated with or without chloramphenicol for 612 h. mRNA was analyzed by RT-PCR as described under "Experimental Procedures."
|
|

View larger version (81K):
[in this window]
[in a new window]
|
FIG. 4. Chloramphenicol redistributed p21 to mitochondria. The immunofluorescence image shows that chloramphenicol treatment changed the p21 localization from the nucleus and perinuclear region (A) to the mitochondria (B). Cells were fixed in methanol and immunodetected by p21, histone H1, and core II antibodies. Subsequently, secondary antibodies conjugated with fluorescein isothiocyanate or rhodamine were incubated with the cells, and the fluorescent images were monitored by confocal microscopy.
|
|
In H1299 cells, the constitutively expressed p21 protein was distributed in the perinuclear region, as shown by immunofluorescence imaging (Fig. 4A). The expression of p21 was increased and the distribution of p21 was changed to the cytoplasm after chloramphenicol treatment (Fig. 4A). The p21 was then seen to be co-localized with core II, a mitochondria protein (Fig. 4B).
Chloramphenicol-induced Senescence-associated -Galactosidase ActivityThe activation of SA- -galactosidase has been identified as a biomarker of cellular senescence (29). The SA- -galactosidase activity was detected by the accumulation of blue-violet X-gal crystals in chloramphenicol-treated H1299 cells (Fig. 5). The morphology of these chloramphenicol-treated cells was changed to the more flattened, enlarged, and irregular shape characteristic of cell senescence.
The p21 Antisense Oligomers and siRNA Reversed the Anti-apoptotic Effects of ChloramphenicolTo determine the role of p21 in the resistance to apoptosis in chloramphenicol-treated H1299 cells, p21 antisense and siRNA were used. The p21 antisense, but not sense, oligonucleotides reversed the resistance of chloramphenicol-treated cells to MMC- and MG132-induced apoptosis (Table II). The increased cellular caspase 3 activity normally seen during apoptosis induced by MMC was inhibited in chloramphenicol-treated cells (Fig. 6A). Addition of p21 siRNA restored the increase of caspase 3 activity induced by MMC. Similar effects were seen in PARP and procaspase 3 cleavage, two marker events of cell apoptosis (Fig. 6B).
View this table:
[in this window]
[in a new window]
|
TABLE II The possible factors involved in chloramphenicol-associated apoptotic prevention
Cells were exposed to MMC or MG132 and then harvested 24 or 48 h later, respectively. Cells were pretreated with chloramphenicol 30 min or 48 h prior to addition of apoptotic-inducing agents and co-incubated with them until the experiment was halted. Apoptotic index (%) was determined by propidium iodide-stained DNA fragments as described under "Experimental Procedures," and the data were expressed as mean ± S.E. The data were analyzed by Student's t-test. * represents statistical significance in comparison to MMC or MG132 treated only. # represents the statistical significance in comparison to cells with apoptotic stimulus and Cap co-treatments. ND, not detected.
|
|
Mitochondrial Stress by Other 70 S Ribosomal Inhibitors Also Causes p21 Induction, SA- -Galactosidase Activation, and p21-associated Apoptotic ResistanceDrugs, including doxycycline, minocycline, and clindamycin, that have been shown to inhibit prokaryotic translation also induced p21 accumulation (Fig. 7A), SA- -galactosidase staining (Fig. 7B), and inhibition of MMC-induced caspase 3 activation (Fig. 7C).
 |
DISCUSSION
|
|---|
Mitochondria have been shown to play an important role in apoptosis induced by many factors (34). Alteration of mitochondria can change the death signaling in either a positive or a negative fashion. Full mitochondrial function is required in amyloid 2535-induced apoptosis (67). On the other hand, inhibition of the expression of mitochondrial-encoded proteins increases the susceptibility to nitric oxide-induced apoptosis in endothelial cells (35). In the present study, we reported that inhibition of mitochondrial-encoded protein expression by chloramphenicol attenuates mitomycin-induced apoptosis. This attenuating effect is p53 independent, because chloramphenicol treatment did not affect the MMC-induced p53 expression. In addition, the same effect was observed in p53-null H1299 cells. Chloramphenicol treatment enhanced the p21 expression in both HepG2 and H1299 cells, but not in Hep3B cells. The MMC-induced apoptosis in HepG2 and H1299 cells, but not in Hep3B cells, was attenuated by chloramphenicol treatment. The correlation between the chloramphenicol-induced p21 expression and the anti-apoptotic effect suggests that p21 might play an important role. This is further supported by the inhibitory effect of p21 antisense and siRNA on the chloramphenicol-induced anti-apoptotic effect.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 6. p21 siRNA reverses the anti-apoptotic effects of chloramphenicol treatments. A, caspase 3 activity assay. MMC-associated caspase 3 activation was inhibited in chloramphenicol-treated cells. However, p21 siRNA could reverse the protective effects of chloramphenicol on caspase 3. *** represents the statistical significance (p <0.001) of MMC-induced caspase 3 activation in comparison to control. ### represents the statistically significant difference (p <0.001) between cells with or without chloramphenicol pretreatment. B, p21 siRNA treatments reversed the protective effects of chloramphenicol on procaspase 3 and nuclear PARP cleavage.
|
|
p21 functions as a cyclin-dependent kinase inhibitor and halts cell cycle progression via interaction with the cyclin-cydon-dependent kinase complex through its N-terminal domain (3637). This arrest of DNA replication permits DNA repair and diminishes DNA damage by DNA-damaging agents. Although the anti-apoptotic effect of p21 is well established, the mechanisms by which p21 can prevent cells from undergoing apoptosis are not well understood.
It has been shown that p21 phosphorylation by Akt at Thr-145 will relocalize p21 from the perinuclear region into the cytoplasm (40) where the p21 can interact with ASK1 (38) and procaspase 3 (39). When it reacts with ASK1, the resulting p21-ASK1 complex inhibits c-Jun NH2-terminal kinase-induced apoptosis (38). On the other hand, the p21-procaspase 3 complex can mask the serine proteinase cleavage site and inhibit caspase 3 activation. Interestingly, the p21-procaspase 3 complex was found to colocalize with mitochondria (39). We found that, upon pretreatment of the cells with chloramphenicol, not only was the basal expression of p21 increased but also the p21 was redistributed from the perinuclear region to the cytoplasm and co-localized with the mitochondrial marker protein, core II. Furthermore, we found that MMC-induced activation of caspase 3 was inhibited in chloramphenicol-pretreated cells without significant changes in the cytochrome c levels in the cytosol. These data suggested that p21 accumulation and redistribution might be important in desensitization to MMC-induced apoptosis in chloramphenicol-pretreated cells.

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 7. 70 S ribosomal inhibitors induced p21 expression and senescence and inhibited MMC-induced caspase 3 activation. A, total RNA extracted from H1299 cells treated with mitochondrial translational inhibitors (100 µg/ml; 48 h) were reverse transcribed to cDNA by SuperscriptTM. The p21 cDNA fragment was amplified by Taq polymerase and observed by EtBr staining of a 2% agarose gel. B, all the inhibitors showed positive results in senescence-associated -galactosidase staining, suggesting that mitochondrial translation inhibitors are senescence inducers. C, caspase 3 activity assay. Cells were treated with 70 S ribosomal inhibitors (100 µg/ml) for 48 h followed by MMC (10 µg/ml) treatment for another 12 h. Cells were lysed, and caspase 3 activities were determined by a caspase 3/CPP32 colorometric assay kit, as described under "Experimental Procedures." The data showed that all inhibitors could inhibit caspase 3 activation by MMC.
|
|
In this study, the levels of both p21 protein and p21 mRNA were increased in a dose- and time-dependent manner in cells pretreated with chloramphenicol. Expression of the p21 gene is controlled by transcriptional as well as post-transcriptional mechanisms (41). It has been reported that transcription of p21 can be regulated by p53 and other transcription factors, including E2F, AP2, Sp1, BRCA1, Smad, C/EBP, etc. (41). However, chloramphenicol treatment did not change the reporter signal in H1299 cells transfected with a plasmid containing the p21 promoter. This suggested that post-transcriptional control might be involved in chloramphenicol-induced p21 accumulation. Post-transcriptional regulation of p21 expression has been demonstrated with ultraviolet C (42), okadaic acid (43), phorbol 12-myristate 13-acetate (43), 1 adrenergic agonist phenylephrine (44), and histone deacetylase inhibitors (45). p21 mRNA contains a conserved AU-rich element in its 3'-untranslated region that could bind with the AUBF, hnRNP, and Elav-like protein HuR. In UVC-treated cells, HuR were accumulated in cytoplasm where they bound with p21 mRNA and enhanced stability of the p21 mRNA (42). Moreover, a poly(C)-binding protein might also bind to p21 mRNA and stabilize the p21 mRNA (46). Our data showed that chloramphenicol treatment could stabilize p21 mRNA and thereby increase cellular protein level. However, the factors participating in chloramphenicol-induced p21 mRNA stabilization, and hence in p21 overexpression, are still unclear.
Chloramphenicol-treated cells also showed morphological changes that resemble senescence (flattened, irregular shapes rich in vacuoles) with increased SA -galactosidase activity. The SA -galactosidase has been evidenced as a biomarker of senescence in fibroblasts, endothelial cells, and keratinocytes (29). Senescent cells often show morphological alteration (29), cell cycle blockade (47), overexpression of the CDIs p21Cip1 and p16INK4A, and pRB dephosphorylation (48). Senescent cells often show a decline in death signaling that would lead to accumulation of damaged cells, possibly representing a significant factor in the development of cancer (49). Mitochondria have been demonstrated that will operate the senescence biogenesis, especially in cellular redox regulation. A defect in mitochondrial complex II caused by the iron chelator desferrioxamine mesylate also causes senescence (49). These findings, together with our findings reported here, suggest that mitochondrial damage might trigger biological senescence and senescence-associated responses.
In the present studies, we found that chloramphenicol and other 70 S ribosomal inhibitors could induce p21 induction, anti-apoptosis, and senescence-like morphological deterioration. Our data also provide evidence that chloramphenicol-associated apoptotic resistance occurs through a p21-dependent pathway. Although chloramphenicol and its metabolites have been considered weak mutagens (1920), we provide evidence that chloramphenicol might promote tumorigenesis indirectly through p21-associated apoptotic resistance. Hence, the clinical significance of our studies is that chloramphenicol administration, as well as other 70 S ribosomal inhibitors, should be used with caution, especially during cancer chemotherapy. Moreover, several antibiotics such as minocycline and doxycycline have been emphasized for their therapeutic effects on neurodegenerative diseases (2324). Both drugs showed strong neuroprotective potency in neurons, and an effect on Bcl protein homeostasis has been demonstrated that may have participated in anti-apoptotic processes (2526). Our studies appear to provide another anti-apoptotic pathway that inhibits caspase 3 activation in a p21-dependent process.
 |
FOOTNOTES
|
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 
To whom correspondence should be addressed: Institute of Toxicology, College of Medicine, National Taiwan University, No. 1 Jen-Ai Rd., Section 1, Taipei 100, Taiwan. Tel.: 886-2-23123456 (ext. 8603); Fax: 886-2-23410217; E-mail: jjkang{at}ha.mc.ntu.edu.tw.
1 The abbreviations used are: CKI, cyclin-dependent kinase inhibitor; siRNA, small interfering RNA; X-gal, 5-bromo-4-chloro-3-indolyl- -D-galactopyranoside; RT, reverse transcription; MMC, mitomycin C; SA, senescence-associated; TRITC, tetramethylrhodamine isothiocyanate. 
 |
REFERENCES
|
|---|
- Liu, X., Kim, C. N., Yang, J., Jemmerson, R., and Wang, X. (1996) Cell 86, 147157[CrossRef][Medline]
[Order article via Infotrieve]
- Kroemer, G., and Reed, J. C. (2000) Nat. Med. 6, 513519[CrossRef][Medline]
[Order article via Infotrieve]
- Newmeyer, D. D., and Ferguson-Miller, S. (2003) Cell 112, 481490[CrossRef][Medline]
[Order article via Infotrieve]
- Zamzami, N., Brenner, C., Marzo, I., Susin, S. A., and Kroemer, G. (1998) Oncogene 16, 22652282[CrossRef][Medline]
[Order article via Infotrieve]
- Nagata, S. (2000) Exp. Cell Res. 256, 1218[CrossRef][Medline]
[Order article via Infotrieve]
- Morais, C., Sandra, S., Russell, H., and Oliveira, C. R. (2002) Brain Res. 931, 117125[CrossRef][Medline]
[Order article via Infotrieve]
- Jiang, S., Cai, J., Wallace, D. C., and Jones, D. P. (1999) J. Biol. Chem. 274, 2990529911[Abstract/Free Full Text]
- Morais, R., Zinkewich-Peotti, K., Parent, M., Wang, H., Babai, F., and Zollinger, M. (1994) Cancer Res. 54, 38893896[Abstract/Free Full Text]
- Amuthan, G., Biswas, G., Zhang, S. Y., Klein-Szanto, A., Vijayasarathy, C., and Avadhani, N. G. (2001) EMBO J. 20, 19101920[CrossRef][Medline]
[Order article via Infotrieve]
- Xu, D., and Finkel, T. (2002) Biochem. Biophys. Res. Commun. 294, 245248[CrossRef][Medline]
[Order article via Infotrieve]
- Pfeuty, A., and Gueride, M. (2000) FEBS Lett. 468, 4347[CrossRef][Medline]
[Order article via Infotrieve]
- Cowan, D. B., Jones, M., Garcia, L. M., Noria, S., del Nido, P. J., and McGowan, F. X. (2003) Arterioscler. Thromb. Vasc. Biol. 23, 17541760[Abstract/Free Full Text]
- Yoon, G., Kim, H. J., Yoon, Y. S., Cho, H., Lim, I. K., and Lee, J. H. (2002) Biochem. J. 366, 613621[CrossRef][Medline]
[Order article via Infotrieve]
- Soldner, F., Weller, M., Haid, S., Beinroth, S., Miller, S. W., Wullner, U., Davis, R. E., Dichgans, J., Klockgether, T., and Schulz, J. B. (1999) Exp. Cell Res. 250, 7585[CrossRef][Medline]
[Order article via Infotrieve]
- Poluha, W., Poluha, D. K., Chang, B., Crosbie, N. E., Schonhoff, C. M., Kilpatrick, D. L., and Ross, A. H. (1996) Mol. Cell. Biol. 16, 13351341[Abstract]
- Gartel, A. L., and Tyner, A. L. (2002) Mol. Cancer Therap. 1, 639649
- Han, Z., Wei, W., Dunaway, S., Darnowski, J. W., Calabresi, P., Sedivy, J., Hendrickson, E. A., Balan, K. V., Pantazis, P., and Wyche, J. H. (2002) J. Biol. Chem. 277, 1715417160[Abstract/Free Full Text]
- Karbowski, M., Kurono, C., Wozniak, M., Ostrowski, M., Teranishi, M., Soji, T., and Wakabayashi, T. (1999) Biochim. Biophys. Acta 1449, 2540[Medline]
[Order article via Infotrieve]
- Robbana-Barnat, S., Decloitre, F., Frayssinet, C., Seigneurin, J. M., Toucas, L., and Lafarge-Frayssinet, C. (1997) Drug Chem. Toxicol. 20, 239253[Medline]
[Order article via Infotrieve]
- Lafarge-Frayssinet, C., Robbana-Barnat, S., Frayssinet, C., Toucas, L., and Decloitre, F. (1994) Mutat. Res. 320, 207215[CrossRef][Medline]
[Order article via Infotrieve]
- Kasten, M. J. (1999) Mayo Clinic Proc. 74, 825833[Abstract]
- Hammett-Stabler, C. A., and Johns, T. (1998) Clinic. Chem. 44, 11291140[Abstract/Free Full Text]
- Zhu, S., Stavrovskaya, I. G., Drozda, M., Kim, B. Y., Ona, V., Li, M., Sarang, S., Liu, A. S., Hartley, D. M., Wu, C., Gullans, S., Ferrante, R. J., Przedborski, S., Kristal, B. S., and Friedlander, R. M. (2002) Nature 417, 7478[CrossRef][Medline]
[Order article via Infotrieve]
- Wang, X., Zhu, S., Drozda, M., Zhang, W., Stavrovskaya, I. G., Cattaneo, E., Ferrante, R. J., Kristal, B. S., and Friedlander, R. M. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 1048310487[Abstract/Free Full Text]
- Wang, J., Wei, Q., Wang, C. Y., Hill, W. D., Hess, D. C., and Dong, Z. (2004) J. Biol. Chem. 279, 1994819954[Abstract/Free Full Text]
- Scarabelli, T. M., Stephanou, A., Pasini, E., Gitti, G., Townsend, P., Lawrence, K., Chen-Scarabelli, C., Saravolatz, L., Latchman, D., Knight, R., and Gardin, J. (2004) J. Am. Coll. Cardiol. 43, 865874[Abstract/Free Full Text]
- Lee, C. C., and Kang, J. J. (2002) Chem. Res. Toxicol. 15, 15341542[CrossRef][Medline]
[Order article via Infotrieve]
- Tonomura, N., McLaughlin, K., Grimm, L., Goldsby, R. A., and Barbara, A. O. (2003) J. Immunol. 170, 24692478[Abstract/Free Full Text]
- Dimri, G. P., Lee, X., Basile, G., Acosta, M., Scott, G., Roskelley, C., Medrano, E. E., Linskens, M., Rubelj, I., Pereira-Smith, O., Peacocke, M., and Campisi, J. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 93639367[Abstract/Free Full Text]
- Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156159[Medline]
[Order article via Infotrieve]
- Lee, S. J., Ha, M. J., Lee, J., Nguyen, P., Choi, Y. H., Pirnia, F., Kang, W. K., Wang, X. F., Kim, S. J., and Trepel, J. B. (1998) J. Biol. Chem. 273, 1061810623[Abstract/Free Full Text]
- Chen, S. S., Chang P. J., Cheng, Y. W., and Lin Y. S. (2002) EMBO J. 21, 44914499[CrossRef][Medline]
[Order article via Infotrieve]
- You, H., Yu, W., Munoz-Medellin, D., Brown, P. H., Sanders, B. G., and Kline, K. (2002) Mol. Carcinog. 33, 228236[CrossRef][Medline]
[Order article via Infotrieve]
- Susin, S. A., Zamzami, N., and Kroemer, G. (1998) Biochim. Biophys. Acta 1366, 151165,[Medline]
[Order article via Infotrieve]
- Ramachandran, A., Moellering, D. R., Ceaser, E., Shiva, S., Xu, J., and Darley-Usmar, V. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 66436648[Abstract/Free Full Text]
- Roninson, I. B. (2002) Cancer Lett. 179, 114[CrossRef][Medline]
[Order article via Infotrieve]
- Dotto, G. P. (2000) Biochim. Biophys. Acta 1471, M43-M56[Medline]
[Order article via Infotrieve]
- Asada, M., Yamada, T., Ichijo, H., Delia, D., Miyazono, K., Fukumuro, K., and Mizutani, S. (1999) EMBO J. 18, 12231234[CrossRef][Medline]
[Order article via Infotrieve]
- Suzuki, A., Tsutomi, Y., Yamamoto, N., Shibutani, T., and Akahane, K. (1999) Mol. Cell. Biol. 19, 38423847[Abstract/Free Full Text]
- Zhou, B. P., Liao, Y., Xia, W., Spohn, B., Lee, M. H., and Hung, M. C. (2001) Nat. Cell Biol. 3, 245252[CrossRef][Medline]
[Order article via Infotrieve]
- Gartel, A. L., and Tyner, A. L. (1998) Prog. Mol. Subcell. Biol. 20, 4371[Medline]
[Order article via Infotrieve]
- Wang, W., Furneaux, H., Cheng, H., Caldwell, M. C., Hutter, D., Liu, Y., Holbrook, N., and Gorospe, M. (2000) Mol. Cell. Biol. 20, 760769[Abstract/Free Full Text]
- Park, J. W., Jang, M. A., Lee, Y. H., Passaniti, A., and Kwon, T. K. (2001) Biochem. Biophys. Res. Commun. 280, 244248[CrossRef][Medline]
[Order article via Infotrieve]
- Liu, J., Shen, X., Nguyen, V. A., Kunos, G., and Gao, B. (2000) J. Biol. Chem. 275, 1184611851[Abstract/Free Full Text]
- Hirsch, C. L., and Bonham, K. (2004) FEBS Lett. 570, 3740[CrossRef][Medline]
[Order article via Infotrieve]
- Giles, K. M., Daly, J. M., Beveridge, D. J., Thomson, A. M., Voon, D. C., Furneaux, H. M., Jazayeri, J. A., and Leedman, P. J. T. (2003) J. Biol. Chem. 278, 29372946[Abstract/Free Full Text]
- Bringold, F., and Serrano, M. (2000) Exp. Gerontol. 35, 317329[CrossRef][Medline]
[Order article via Infotrieve]
- Stein, G. H., Beeson, M., and Gordon, L. (1990) Science 249, 666669[Abstract/Free Full Text]
- Yoon, Y. S., Byun, H. O., Cho, H., Kim, B. K., and Yoon, G. (2003) J. Biol. Chem. 278, 5157751586[Abstract/Free Full Text]
- Suh, Y. (2002) Mech. Ageing Dev. 123, 881890[CrossRef][Medline]
[Order article via Infotrieve]

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
T. A. Klimova, E. L. Bell, E. H. Shroff, F. D. Weinberg, C. M. Snyder, G. P. Dimri, P. T. Schumacker, G. R. S. Budinger, and N. S. Chandel
Hyperoxia-induced premature senescence requires p53 and pRb, but not mitochondrial matrix ROS
FASEB J,
March 1, 2009;
23(3):
783 - 794.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Khidr, G. Wu, A. Davila, V. Procaccio, D. Wallace, and W.-H. Lee
Role of SUV3 Helicase in Maintaining Mitochondrial Homeostasis in Human Cells
J. Biol. Chem.,
October 3, 2008;
283(40):
27064 - 27073.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Crescenzi, G. Palumbo, J. de Boer, and H. J.M. Brady
Ataxia Telangiectasia Mutated and p21CIP1 Modulate Cell Survival of Drug-Induced Senescent Tumor Cells: Implications for Chemotherapy
Clin. Cancer Res.,
March 15, 2008;
14(6):
1877 - 1887.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Harms, K. Albrecht, U. Harms, K. Seidel, L. Hauck, T. Baldinger, D. Hubner, G. Kronenberg, J. An, K. Ruscher, et al.
Phosphatidylinositol 3-Akt-Kinase-Dependent Phosphorylation of p21Waf1/Cip1 as a Novel Mechanism of Neuroprotection by Glucocorticoids
J. Neurosci.,
April 25, 2007;
27(17):
4562 - 4571.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Li, X. Wang, N. Li, J. Qiu, Y. Zhang, and X. Cao
hPEBP4 Resists TRAIL-induced Apoptosis of Human Prostate Cancer Cells by Activating Akt and Deactivating ERK1/2 Pathways
J. Biol. Chem.,
February 16, 2007;
282(7):
4943 - 4950.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-L. Tzeng, Y.-W. Cheng, C.-H. Li, Y.-S. Lin, H.-C. Hsu, and J.-J. Kang
Physiological and Functional Interactions between Tcf4 and Daxx in Colon Cancer Cells
J. Biol. Chem.,
June 2, 2006;
281(22):
15405 - 15411.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Pei, J. E. Turse, Q. Wu, and T. A. Ficht
Brucella abortus Rough Mutants Induce Macrophage Oncosis That Requires Bacterial Protein Synthesis and Direct Interaction with the Macrophage.
Infect. Immun.,
May 1, 2006;
74(5):
2667 - 2675.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|