JBC Origene Your Gene Company

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M500047200 on May 9, 2005

J. Biol. Chem., Vol. 280, Issue 28, 26467-26476, July 15, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/28/26467    most recent
M500047200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Piccoli, C.
Right arrow Articles by Capitanio, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Piccoli, C.
Right arrow Articles by Capitanio, N.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Characterization of Mitochondrial and Extra-mitochondrial Oxygen Consuming Reactions in Human Hematopoietic Stem Cells

NOVEL EVIDENCE OF THE OCCURRENCE OF NAD(P)H OXIDASE ACTIVITY*

Claudia Piccoli{ddagger}, Roberto Ria§, Rosella Scrima{ddagger}, Olga Cela{ddagger}, Annamaria D'Aprile{ddagger}, Domenico Boffoli{ddagger}, Franca Falzetti§, Antonio Tabilio§, and Nazzareno Capitanio{ddagger}||

From the {ddagger}Department of Biomedical Science, University of Foggia, Foggia, Italy 71100 and the §Department of Clinical and Experimental Medicine, Hematology and Clinical Immunology Section, University of Perugia, Perugia, Italy 06100

Received for publication, January 3, 2005 , and in revised form, April 29, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This study was aimed to characterize the mitochondrial and extra-mitochondrial oxygen consuming reactions in human CD34+ hematopoietic stem cells. Cell samples were collected by apheresis following pre-conditioning by granulocyte colony-stimulating factor and isolated by anti-CD34 positive immunoselection. Polarographic analysis of the CN-sensitive endogenous cell respiration revealed a low mitochondrial oxygen consumption rate. Differential absorbance spectrometry on whole cell lysate and two-dimensional blue native-PAGE analysis of mitoplast proteins confirmed a low amount of mitochondrial respiratory chain complexes thus qualifying the hematopoietic stem cell as a poor oxidative phosphorylating cell type. Confocal microscopy imaging showed, however, that the intracellular content of mitochondria was not homogeneously distributed in the CD34+ hematopoietic stem cell sample displaying a clear inverse correlation of their density with the expression of the CD34 commitment marker. About half of the endogenous oxygen consumption was extra-mitochondrial and completely inhibitable by enzymatic scavengers of reactive oxygen species and by diphenylene iodinium. By spectral analysis, flow cytometry, reverse transcriptase-PCR, immunocytochemistry, and immunoprecipitation it was shown that the extra-mitochondrial oxygen consumption was contributed by the NOX2 and NOX4 isoforms of the . producer plasma membrane NAD(P)H oxidase with low constitutive activity. A model is proposed suggesting for the NAD(P)H oxidase a role of O2 sensor and/or ROS source serving as redox messengers in the activation of intracellular signaling pathways leading (or contributing) to mitochondriogenesis, cell survival, and differentiation in hematopoietic stem cells.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although hematopoietic stem cells (HSCs)1 have been gaining an extraordinary growing interest, in the last decades many aspects of their cellular biochemistry are still elusive and deserve attention (1). The main reason of such a gap in the knowledge of basic metabolic aspects of HSCs depends on the difficulties in obtaining enough, phenotypically pure, cell samples suitable for systematic functional biochemical analysis. Nevertheless, to acquire this information is of extreme importance, not only for the understanding of the mechanism underlying the processes leading to cell proliferation and differentiation, but also to improve and optimize the protocols for in vitro and in vivo cell recovery, maintenance and differentiation, applied in the cell therapy approaches where HSCs are believed to promise a profound change in the future of regenerative medicine (2, 3). Adult HSCs reside in the bone marrow stroma where a very peculiar cellular and biochemical niche environment preserves them till appropriate stimuli activate their self-renewal and mobilization in the blood (4-6). Here they undergo a proliferative and multistage differentiation process leading to commitment toward all the blood cell lineages (7) and possibly other non-hematic cell types (8). The oxygen tension in the stromal niche, although difficult to assess experimentally, is thought to be extremely low (9, 10), thus implying an almost anaerobic metabolic behavior whose low efficiency is well adapted to the low energy demand of this G0-G1 resting cell type. Furthermore, the hypoxic environment would limit the production of reactive oxygen species thus preserving from age-dependent oxidative damages such an essential cell reservoir. Upon mobilization of one of the two cell daughters, derived from the mother stem cell, in a normoxic milieu, a shift toward a more efficient aerobic metabolism is expected in view of the greater energetic effort required to sustain proliferation and differentiation. The larger availability of oxygen, experienced by the mobilized HSC, enables it to be used as the driving substrate for the mitochondrial oxidative phosphorylation as well as for other extra-mitochondrial oxidative reactions. In this work we have studied the enzymatic features of the cellular oxygen consuming reactions in human HSCs recovered from peripheral blood, upon mobilization from bone marrow by the growth factor granulocyte colony-stimulating factor (11-14), and isolated by immunoselection using as cell specific tag the CD34 antigenic marker.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Hematopoietic Stem Cells Source—HSCs, obtained upon informed consent from donors for allogeneic HSC transplant, were mobilized in the peripheral blood by recombinant granulocyte colony-stimulating factor treatment and collected by superparamagnetic iron-dextran particles directly conjugated to anti-CD34 as previously described (12, 15). The purity of the isolated cells was evaluated by flow cytometry using a phycoerythrin-conjugated monoclonal anti-CD34 antibody and challenged against a large panel of antigens characterizing late committed or mature hematopoietic cell types as previously reported (12). After selection, aliquots of cells were freshly used or cryopreserved in liquid nitrogen. Before use the frozen cell samples were thawed at room temperature and washed twice in RPMI 1640 to remove the cryoprotectant Me2SO. Cell viability as determined by trypan blue exclusion was typically between 80 and 95%.

Measurement of Oxygen Uptake—The rate of endogenous oxygen consumption was measured polarographically (the instrumental setting was computer-controlled) with a Clark-type oxygen electrode at 37 °C in 0.5 ml of RPMI 1640 without fetal bovine serum. After 10-15 min of baseline stabilization, 25 x 106 viable HSCs cells were added. Given the intrinsic low respiratory activity of the cell system a fine correction of the instrumental and/or medium-linked drift was absolutely necessary. A correction point by point for the first derivative of the non-linear drift, over the time course of the experiment, was applied. Comparable endogenous respiratory rate results were obtained with either freshly isolated and thawed samples.

Spectrophotometric Analysis—5 x 106 cell in 100 µl of 100 mM Tris, pH 7.4, were lysed with 2% Triton X-100 in the presence of a protease inhibitor mixture. Optical spectra from 400 to 700 nm of the oxidized (by 10 µM ferricyanide) and reduced (by a few grains of dithionite) samples were recorded in a microvolume (50 µl) cuvette. The baseline drifts because of the residual turbidity of the suspension was largely removed by differential analysis (reduced minus oxidized) and further corrected for a polynomial baseline passing throughout the cytochromic isosbestic points (16, 17).

Bidimensional Polyacrylamide Gel Electrophoresis—Samples of mitoplast proteins for blue native-PAGE were prepared as described by Schagger (18). The first dimension native electrophoresis was run in a 5-12% acrylamide gradient. A lane was cut out of the first dimension gel and placed on a glass plate for incubation with lysis buffer at room temperature. The second dimension was a denaturing Tricine-SDS-PAGE. The proteins were visualized by silver staining. Densitometric analysis was performed by Versadoc imaging system, scanning the gel slabs along the lanes of the denaturating 2nd dimension run corresponding to the OXPHOS complexes separated in the 1st dimension run.

Laser Scanning Confocal Microscopy—3 x 106/ml CD34+ HSCs were incubated with 500 nM MitoTracker green (30 min, 37 °C), washed with PBS, fixed with 3.7% paraformaldeyde (5 min, room temperature), resuspended in PBS plus 1% bovine serum albumin, and incubated with an anti-CD34 monoclonal antibody (1 h, room temperature). Then, HSCs were washed 3 times with PBS/bovine serum albumin, pH 7.4, and incubated (1 h, room temperature) with a secondary TRITC-conjugated antibody. The HepG2 cell line was treated with the mitochondrial probe as described for the HSCs and with TO-PRO 3 for nucleus staining (5 min, room temperature). Confocal microscopy was performed with a Leica TCSSP2 microscope. Fluorescent signals emitted by Mitotracker green ({lambda}ex, 490 nm; {lambda}em, 516 nm) and by TRITC-conjugated secondary antibody ({lambda}ex, 544 nm; {lambda}em 572 nm) were quantified by the Leica Confocal Software (LCS-TCS version 2.61). By means of the "stack" function for the defined area of the LCS-Analysis Tools it produced a xz intensity profile of the average value of the pixels within marked edges, including a single cell, as a function of each focal plane. Correction was made for the minimal background by repeating the procedure in a cell-free field. The integrated value of the xz profile was taken as a measure of the fluorescence intensity of that individual cell relative to the selected emission channel. About one hundred single cells were analyzed for both emission channels.

Flow Cytometry—A Beckman Coulter Epics XL-MCL flow cytometer equipped with a 488-nm argon laser was used. To measure ROS production, samples were incubated with 10 µM 2',7'-dichlorodihydrofluorescein-diacetate (H2DCF-DA) at 37 °C, protected from light for 30 min in the presence of 20 µM cyclosporin A. After loading with dye, the cells were washed by centrifugation (3 min at 300 x g) and resuspended in PBS. Samples contained 200,000 cells and 5,000 events for each sample were analyzed following the instrumental procedure ({lambda}em, 529 nm).

Reverse Transcription-Polymerase Chain Reaction—3 µg of total cellular RNA isolated by TRIzol reagent was reverse transcribed to cDNA with specific antisense primers (50 pmol each, sequence shown in the legend of Fig. 3D) following the SuperScript Reverse Transcriptase protocol. Samples of 5 µl of reverse transcription reaction were PCR-amplified in a total volume of 50 µl with 50 pmol each of sense and antisense primers (sequences shown in the legend of Fig. 3D). The conditions were 35 cycles of denaturation at 94 °C (1 min), annealing at 60 °C (1 min), and extension at 72 °C (2 min); followed by a further 10-min extension. Purified PCR products were sequenced (3 times for each sample) on an automatic ABI Prism 310 DNA sequencer.

Double Immunofluorescence Cytochemistry—HSCs were cytocentrifuged at 400 x g on polylysine-coated slides for 4 min, fixed (4% paraformaldehyde), permeabilized (0.2% Triton X-100), blocked (3% bovine serum albumin in PBS), and then sequentially incubated with the 1:200 diluted rabbit anti-gp91 and mouse anti-p47. After two washes in PBS/bovine serum albumin the sample was incubated with 10 µg/ml of the fluorescein 5-isothiocyanate-labeled sheep anti-rabbit IgG and Texas Red-labeled goat anti-mouse IgG. Fluorescence was evaluated with a Zeiss Axioplan 2 microscope.

Immunoprecipitation and Immunoblotting—CD34+ HSC or polymorphonucleate cells (1 x 106) were lysed for 20 min in 1 ml of ice-cold lysis buffer (20 mM HEPES, pH 7.2, 150 mM NaCl, 1 mM EGTA, 10% glycerol, 1% Triton X-100, 1.5 mM MgCl2, 1 mM sodium vanadate, 2 mM sodium phosphate, and protease inhibitors mixture). Lysates were centrifuged at 12,000 rpm for 15 min and the supernatants incubated (2 h, 4 °C) with rabbit preimmune serum and 50 µl of a 50% Protein G-Sepharose slurry for preclearing, the after spinning supernatant was then incubated overnight at 4 °C with rabbit anti-gp91 (Upstate or Santa Cruz), anti-p67 (Upstate), or goat anti-p47 (Santa Cruz) polyclonal antibody and Protein A-Sepharose beads. Immunoprecipitates were washed in HNTG buffer, suspended in Laemmli's buffer, and run on 8% SDS-PAGE followed by Western blot. gp91phox, p67, p47, and serine-phosphorylated peptides were immunodetected by enhanced chemiluminescence under not limiting detecting antibodies.

Statistical Analysis—Two tailed Student's t test was applied to evaluate the significance of differences measured throughout the data sets reported.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Mitochondrial Oxygen Consumption in HSCs—Fig. 1 clusters the results of a multifaceted approach aimed to characterize the mitochondrial oxidative phosphorylation (OXPHOS) system in peripheral blood granulocyte colony-stimulating factor-mobilized CD34+ HSCs. Fig. 1, panel A, shows the outcome of a systematic high-resolution respirometric analysis, carried out on dense cell suspensions. The rate of endogenous cell respiration resulted on an average basis to be about 84 pmol of O2 consumed per min/106 cells (10-15 different preparations of HSC). This overall oxygen consumption rate was 60% inhibited by the cytochrome c oxidase inhibitor cyanide. Addition of antimycin A plus myxothiazol (inhibitors of cytochrome c reductase) resulted in a similar extent of inhibition of the respiratory activity (data not shown). Thus the measured respiratory activity attributable to mitochondria amounted to about 50 pmol of O2/106 cells/min. This value, when compared with that of other cell types measured under identical conditions, resulted in being at least 10 times lower (Ref. 19 and confirmed by ourselves). The CN-sensitive endogenous respiration was not enhanced by the addition of the protonophore un-coupler CCCP and was slowed down by the ATP-synthase inhibitor oligomycin (about 40% inhibition), indicating that the measured mitochondrial oxygen consumption rate featured an active (phosphorylating) state. The low endogeneous respiratory control ratio attained was likely because of the intrinsically limited activity of the cell sample. It must be mentioned that the experiments reported were carried out with cells obtained upon thawing of the frozen samples and immediately assayed soon after removal of Me2SO, used to preserve cell viability upon freeze-thaw. The cell viability tested by the trypan blue exclusion assay was never below 95%. Comparable results were obtained with fresh cell samples assayed a few hours after collection.

The correlation between mitochondrial respiratory activity and cytochrome content in HSCs was assessed by differential spectrophotometric analysis on cell lysate. To avoid any loss of the overall cytochrome content, we preferred to carry out analysis on the whole detergent-solubilized cell suspension without separation of the particulate by centrifugation. Fig. 1, panel B, shows the absorbance difference visible spectra (dithionite reduced minus air oxidized) of whole cell lysate obtained upon Triton X-100 treatment (averaged from different HSCs preparation and normalized to 1 x 106 cells/ml). The spectra clearly indicated the presence of canonical mitochondrial a, b, and c type cytochromes both in the {alpha}-{beta} (500-650 nm) and the Soret (400-500 nm) regions (16, 17). A quantitative analysis, expressed as cytochrome c oxidase content (whose absorption at 605 nm is scarcely affected by optical overlapping because of the presence of contaminating chromophores), resulted in a value of 0.3 pmol/106 cells, which was again relatively much lower than that reported and confirmed by us in other cell types. However, when the measured CN-sensitive respiratory activity was referred to the cytochrome oxidase content (which is considered to be the main rate-limiting step for mitochondrial respiration under in vivo conditions (19)) a specific turn-over number of about 10 e-/aa3/s was calculated, which is comparable with the specific activity reported under steady-state respiration for other cell types (19). Measurement of the oxygen consumption rate in the presence of nitro-L-arginine methylester, an inhibitor of the NO synthase (whose product is known to result, under certain conditions, in inhibition of cytochrome c oxidase activity (20)), did not result in any appreciable increase of respiration (data not shown). Thus the low mitochondrial respiratory activity measured in our HSC samples was because of a relatively poor content of mitochondrial cytochromes rather than to an inhibitory control. This conclusion was further supported detecting by two-dimensional blue native-SDS-PAGE of mitoplast proteins with the pattern of subunits constituting the mitochondrial respiratory complexes (I to IV) as well as the ATP-synthase complex (Fig. 1, panel C). It can be noted that, although the overall composition of the OXPHOS complex subunits was comparable with that of mitoplasts prepared from HepG2 (taken as reference for a mitochondria-rich cell type), their content resulted in being lower. A densitometric analysis of the subunits assembled in OXPHOS complexes I to V confirmed that in mitoplasts from HSC CD34+ there was roughly half of the amount of that present in HepG2 (Fig. 1C, bottom panel). Considering that the comparison was made between the densitometric profiles normalized to the amount of mitoplast proteins loaded on the gel, it would indicate that the observed poor content of components of the mitochondrial OXPHOS system in HSCs was because of their lower density per mitochondria rather than (or in addition) to a lower amount of mitochondria per cell unit. To address this issue, the intracellular mitochondrial content was directly pinpointed in HSCs by laser scanner confocal microscopy analysis using MitoTracker green (a fluorochrome specifically accumulating in membrane potential-generating mitochondria). In addition, the same HSC sample was treated with a fluorophore-conjugated antibody recognizing the CD34 antigen marker. A typical outcome of such an analysis is shown in Fig. 2A from which a number of indications could be drawn. The morphology of the mitochondrial network resulted in most of the HSCs in a bipolar perinuclear clustering differently from the more intense and widespread appearance of the mitochondrial signal in the cytoplasm of HepG2. A diverse interorganelle connectivity has been recently described to be dependent on the cell-cycle phase (21). The density of the intracellular mitochondrial content was, however, not similar throughout the HSC sample. Some cell types showed, indeed, a faint staining with MitoTracker, whereas others displayed a much higher ability to load the mitochondrial probe (identical results were obtained with 3 different preparations of HSCs). Similarly the CD34 cell surface marker immunodetected in the same sample exhibited also a highly variable intercellular degree of clustered labeling. Noteworthy, the higher the CD34 signal density in a given HSC the lower the mitochondrial content in it, and vice versa. A quantitative estimation of the relative fluorescence signals, carried out on a large number of single cell imaging, showed a clear inverse correlation between CD34 and mitochondria content (Fig. 2B).



View larger version (45K):
[in this window]
[in a new window]
  		FIG. 1.
Characterization of the mitochondrial oxidative phosphorylation system in peripheral blood CD34+ human HSCs. A, endogenous cellular respiration. The respiratory rates are expressed as percentages (±S.E.) of the initial endogenous respiration that amounted to 84 ± 7 pmol of O2/min/106 HSCs (n = 15). CCCP, 2 µM; oligomycin, 2 µg/ml; KCN, 4 mM. Student's t test analysis: * and ** versus control, and #, p < 0.01; * versus **, p < 0.05; control versus #, N.S. B, differential spectrophotometric analysis of CD34+ HSC lysate. Average was obtained from 6 different HSC sample spectra normalized to 106 cells/ml. {Delta}{epsilon}605-630 = 27 mM-1 cm-1 was used for estimation of cytochrome c oxidase (16). C, two-dimensional blue native (BN) SDS-PAGE analysis of mitoplast proteins. The amounts of CD34+ HSCs and HepG2 proteins loaded in the first dimension were 130 and 90 µg, respectively. I, NADH-dehydrogenase; V, ATP synthase; III, cytochrome c reductase; IV, cytochrome c oxidase; II, succinate dehydrogenase; COX, cytochrome c oxidase purified from bovine heart mitochondria (10 µg). The gel slabs shown are representative of three different mitoplast preparations. The bottom panel quantifies the results of the densitometric analysis where the staining values (normalized to the amount of proteins loaded; n = 3 (±S.E.)) refer to the sum of the stained subunits of each OXPHOS complex. Student's t test analysis: HSC versus HepG2, p < 0.05 for each complex.

 



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 2.
Confocal microscopy analysis of CD34+ HSCs. A, functional mitochondria were green fluorescent labeled by MitoTracker (the specificity of Mitotracker was assessed by pre-treatment of HSCs with 5 µM CCCP (left panel)); CD34 cell density in HSCs was red fluorescent labeled by the TRITC-conjugated secondary antibody directed toward monoclonal anti-CD34 (treatment of HSCs directly with the secondary antibody resulted fluorescent negative). Nuclei in the HepG2 cell line was labeled by the blue fluorescent TO-PRO 3 probe. The images are the results of superimposed confocal planes and are representative of three different preparations for each condition (bars, 10 µm). B, correlation between CD34 cell density and mitochondrial content in HSCs. The green and red fluorescence signals of about 100 randomly selected single cells were quantified in arbitrary units (A.U.) by the image analyzer software provided with the confocal microscope (see "Materials and Methods") and clustered (±S.D.) every 5 A.U. increase of the fluorescence signal related to the CD34 antigen.

 
Extra-mitochondrial Oxygen Consumption in HSCs—The relative large CN-insensitive oxygen consumption rate exhibited by the HSC samples prompted us to verify the possible involvement of other cellular oxygen consuming reactions in addition to that elicited by the mitochondrial cytochrome c oxidase converting dioxygen to water molecules. First we tested the effect of externally added enzymatic scavengers of reactive oxygen species. Fig. 3A shows that addition of superoxide dismutase together with catalase strongly reduced the endogenous oxygen consumption rate by about 50%. Successive addition of cyanide further inhibited the respiratory activity, leaving a residual activity amounting to about 10% of the initial endogenous respiration. When the order of the additions was inverted, the same result was obtained and when SOD plus catalase were tested in the absence of cells no detectable effect was observed on the instrumental O2 consumption drift (not shown). This result indicated the occurrence of partial reduction of dioxygen to the superoxide anion and/or hydrogen peroxide revealed by the concerted action of the two antioxidant enzymes, which regenerated dioxygen. The relative large amount of ROS produced could not be ascribed to electron leaks of the mitochondrial respiratory chain activity because this has been reported never to exceed 2-3% of the O2 consumed under the controlled state IV condition and to be even lower under the active phosphorylating regimen (23). Moreover as the effect of the two antioxidant enzymes was exerted outside the cell, it seemed unlikely that intracellular ROS production could escape the endogenous antioxidant battery, rather suggesting a periplasmic location of the ROS generating system(s). A reexamination of the differential spectra of the whole HSC lysate (shown in Fig. 1B) compared with that of isolated mitochondria (not shown) revealed in the former a relatively larger amount of cytochromes absorbing in the 550-560 and 420-430 nm regions, when related to the absorbance of cytochrome c oxidase. This suggested the presence of a significant amount of extra-mitochondrial cytochromes (see below). In addition, the differential absorbance at 470-475 nm clearly indicated the presence of myeloperoxidase (which specifically absorbs in that region (24)).



View larger version (34K):
[in this window]
[in a new window]
  		FIG. 3.
Characterization of NAD(P)H oxidase activity and expression in peripheral blood Cd34+ human HSCs. A, effect of DPI and antioxidant enzymes on the CN-insensitive respiratory activity of HSCs. DPI, 10 µM; SOD and catalase, 500 units/ml each. B, cyto-fluorimetric measurement of reactive oxygen species by H2DCF-DA. 106 HSCs were incubated for 24 h in RPMI in the absence (black line) or presence (gray line) of 20 µM DPI and treated with 10 µM H2DCF-DA plus 20 µM cyclosporin A; the number of events reported were 5000 for both samples. Representative of three different experiments showing similar result are shown. In the histogram signal intensity (green fluorescence in FL1) on a logarithmic scale is displayed on the x axis, the y axis represents the number of cells at the respective intensities. C, spectral shift induced by 20 mM BICN on the reduced absorbance spectra of the HSC lysate. Gray line, reduced minus oxidized spectra; black line, BICN treated (10 min) reduced minus oxidized spectra; circles, reduced minus reduced +BICN differential spectra, {Delta}{epsilon}430-460 = 126 mM-1 cm-1 was used for estimation of the b type cytochrome (28). D, reverse transcription-PCR on whole RNA extracted from HSCs with primers selected for the regulatory subunits (p22, p47, and p67) and the four catalytic subunits of NADPH oxidase isoforms (NOX1-4). The primer sequences (5'-3') were: p22phox, forward, GTTTGTGTGCCTGCTGGAGT, reverse, TGGGCGGCTGCTTGATGGT (316 bp); p47phox, forward, ACCCAGCCAGCACTATGTGT, reverse, AGTAGCCTGTGACGTCGTCT (767 bp); p67phox, forward, CGAGGGAACCAGCTGATAGA, reverse, CATGGGAACACTGAGCTTCA (746 bp); NOX1, forward, GTACAAATTCCAGTGTGCAGACCAC, reverse, CAGACTGGAATATCGGTGACAGCA (397 bp); NOX2, forward, GCTGTTCAATGCTTGTGGCT, reverse, TCTCCTCATCATGGTGCA (403 bp); NOX3, forward, GGATCGGAGTCACTCCCTTCGCTG, reverse, ATGAACACCTCTGGGGTCAGCTGA (457 bp); NOX4, forward, CTCAGCGGAATCAATCAGCTGTG, reverse-AGAGGAACACGACAATCAGCCTTA (285 bp). MK, {varphi} X174 markers.

 
It is known that in many cell types the major ROS producer (even more efficient, under certain conditions, than the mitochondrial respiratory chain) is the cell membrane-bound NAD(P)H oxidase (NOX) (25), which oxidizes NAD(P)H, transferring electrons to dioxygens, which is partially reduced to the superoxide anion (26). Being a flavoenzyme, NOX is efficiently inhibited by diphenylene iodinium (DPI) (27). To verify this possibility we tested the effect of DPI on the endogenous respiration. As shown in Fig. 3A, DPI, at a concentration reported to inhibit NOX, resulted in a marked decrease of the endogenous respiratory activity (by about 50%). Successive addition of cyanide completely inhibited the DPI-insensitive oxygen consumption rate. When the order of addition of the two inhibitors was inverted, complementary results were observed and, more important, addition of SOD plus catalase after inhibition by DPI did not cause any effect on the oxygen consumption rate (data not shown).

Direct measurement of cellular ROS production was assessed by flow cytometry using DCF-DA as a specific probe for H2O2 detection. DCF-DA permeates cell membranes, is deacetylated by intracellular esterase, and becomes fluorescent upon oxidation. Although DCF is membrane impermeant and thus should remain trapped inside the cell it can also be the substrate of the P-glycoprotein multidrug resistant (MDR1) pump (28). Thus cells expressing MDR1 can slowly release DCF unless treated with MDR1 inhibitors. Because it is long known that HSCs express significant amounts of MDR1 (29), during the HSC assay we treated HSCs with a MDR1 inhibitor. Fig. 3B shows that incubation of HSC with cyclosporin A (a specific inhibitor of MDR) (28) allowed detection of production of intracellular ROS and that this was strongly inhibited by pretreatment with DPI. Omission of cyclosporine A from the assay protocol resulted in a more vanishing result probably because of the intrinsically low ROS producing activity combined with an efficient MDR1-mediated drug efflux activity in HSCs (data not shown).

NOX contains as redox active prosthetic groups two hemes b, absorbing at 428 and 558 nm. To discriminate the spectral overlapping because of the presence of mitochondrial cytochromes, we exploited the well characterized and specific capacity of the tert-butyl isocyanide (BICN) to induce a large red shift upon binding to one of the two b cytochromes of the reduced NAD(P)H oxidase (30). Fig. 3B shows that addition of BICN to the dithionite-reduced HSC lysate resulted in a shift in the Soret region of the spectra from 427 to 434 nm. The symmetrical shape of the differential spectra (reduced + BICN minus reduced) indicated that binding of BICN occurred almost exclusively on the b-type cytochrome of the NOX-like enzyme excluding contributions from other cytochromes. This was confirmed verifying that BICN did not cause any spectral shift when tested on isolated mitochondria (not shown). From the differential spectra it was, therefore, possible to estimate the BICN-sensitive b-cytochrome content that amounted to 0.5 pmol/106 HSCs and from the DPI-sensitive oxygen consumption rate, the specific activity of the NOX-like enzyme was calculated 1.0 ± 0.2 O2 consumed per b558/s. A comparison of these values with those reported in literature revealed that the amount of putative NOX in our HSC sample was only half of that reported for the highly specialized neutrophils (31), although the activity was lower than that reported for the resting enzyme. Compounds (like phorbol myristate acetate, arachidonate, and bacterial lipopolysaccaride) known to trigger the respiratory burst in macrophagic cells by activating the resting NOX (32, 33) when tested on our HCS samples resulted as beiing ineffective (data not shown), so excluding the possibility that our observations were because of neutrophils contamination.

The occurrence of a NOX-like enzyme in CD34+ HSCs was verified by a more direct molecular approach. Fig. 3D shows the results of a reverse transcriptase-PCR amplification experiment carried out on whole RNA extracts from HSC samples. As it is known that plasma membrane NADPH oxidase encompasses a family of structurally linked isoforms, the primers used were selected on the basis of the known sequences of the genes coding for four catalytic isoform subunits (NOX 1 to 4) and for three regulatory subunits (p22, p47, and p67). It is shown that only NOX2 and NOX4 were expressed in our stem cell samples, together with the regulatory subunits. The reverse transcription-PCR products corresponding to NOX2, NOX4, and p22 were sequenced and matched the sequences of the corresponding coding genes (34, 35).

To further verify the presence of the NOX gene products at a translational level and to assess the activation state of the enzyme we performed an immunofluorescent cytochemical analysis on the HSCs with antibodies against the catalytic NOX2 gp91phox (the sole isoform for which antibodies are commercially available) and the regulatory p47 subunits (Fig. 4A). The two secondary antibodies were conjugated with two different complementing fluorophores. It can be seen that both the anti-gp91phox and anti-p47 antibodies bound the HSC as revealed by FITC and Texas Red staining, respectively. Noteworthy both the fluorescent signals were clustered in a polarized manner and more important, the superimposition of the two fluorescence signals indicated large co-localization (Fig. 4A). More then 95% of the cells present in our samples were immunostainable, displayed co-localization of the fluorescent signals, and were, in addition, reactive toward a fluorescein 5-isothiocyanate-conjugated anti-CD34 antibody (not shown). This result clearly indicated the presence in the CD34+ HSCs of a significant amount of NOX subunits and that possibly these were assembled in a functional complex. To support and complement the NOX subunits immuno-co-localization evidence, a set of immunoprecipitation experiments were carried out (Fig. 4B). HSCs lysate was immunoprecipitated with antibody against NOX2 gp91phox and the precipitate immunoblotted with an excess of either anti-gp91 or anti-p47 or anti-P-serine antibodies; in a complementary experiment the lysate was immunoprecipitated with anti-p47 and immunoblotted with the same antibodies. As a positive control, polymorphonucleate cells were subjected to the same treatment. It is shown, by comparing the amount of p47 immunoprecipitated by anti-p47 with that co-precipitated by anti-gp91 that practically most, if not all, the CD34+ HSC content of NOX resulted in association of the catalytic and one of the regulatory activating subunits. It has been reported that phosphorylation of the p47 subunit is a step required for the NOX assembling process (36, 37), thus the presence in the immunoprecipitate of a band migrating with the same molecular mass of p47 and reacting against an anti-P-serine antibody strongly supported the conclusion that the HSCs were endowed with a constitutively assembled NAD(P)H oxidase. Furthermore, we extended the immunoprecipitation experiment to analyze the interaction of the other regulatory subunit, p67, to the catalytic NOX2 subunit. It is shown that the immunoprecipitate with anti-p67 reacted with antibodies against both gp91phox and p47. The complementary result was obtained with anti-gp91 immunoprecipitate reacting with anti-p67, thus providing conclusive evidence that the HSC NADPH oxidase complex is fully assembled.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The first aim of this work was to study the endogenous oxidative metabolism in human hematopoietic stem cells with specific concerns to the mitochondrial and extra-mitochondrial oxygen consuming reactions, given that a functional characterization of this specific issue for HSCs is completely missing in literature. The large amount of cells required for this survey imposed the choice of granulocyte colony-stimulating factor-mobilized HSCs. The treatment is known to increase by at least 20-fold the circulating population of hematopoietic stem cells without altering their multipotency features as cytokine conditioning seems to mobilize predominantly bone marrow quiescent rather than proliferating stem cells (38, 39). The CD34 antigen, used as cell tag for immunoselection of the HSCs, is a sialomucin-like membrane protein, possibly involved in interaction with the bone marrow stromal mesenchyma (22) and widely referred as a specific marker of hematopoietic stem/progenitor cells, whose expression is progressively lost upon differentiation (40). As differentiation is a continuum multistage process we cannot, however, exclude the possibility that the cell sample used in this work was a composite of cellular subsets pre-conditioned toward commitment (14, 40, 41). Having the opportunity to identify different stem cell subtypes on the same sample this might give, in principle, the chance to correlate different early stages of differentiation to a specific cell function.



View larger version (36K):
[in this window]
[in a new window]
  		FIG. 4.
Analysis of the quaternary structure of NAD(P)H oxidase in HSCs. A, immunocytochemistry on HSCs with antibodies directed against gp91phox and p47phox subunits (bar, 10 µm). The result of the experiment shown for a single selected cell is representative of practically all of the cell population. Control with the same samples treated with secondary antibodies were negative. B, immunoprecipitation analysis of NAD(P)H oxidase on HSCs and polymorphonucleate cell lysates. The slight difference in the mobility of gp91phox in the blots shown in the upper and lower panels depended on the features of the antibody manufacturer. See "Materials and Methods" for further experimental details.

 
The analysis by confocal microscopy revealed, indeed, that the expression of the CD34 antigen was not homogeneously distributed in the HSC population and that its signal density correlated inversely with that of a probe specifically labeling functional mitochondria. This result confirmed the heterogeneous response of HSCs subsets to the rhodamine effluxes, a less specific mitochondrial probe used in cytofluorimetry (42). The amount of mitochondria detectable in HSCs, even in those containing the larger number, was, however, much lower than that observed in other cell types. This observation was corroborated by (i) the measurement of the CN-sensitive respiratory activity, (ii) the spectrophometrically detectable cytochrome content, and (iii) the two-dimensional electrophoretic analysis of the oxidative phosphorylation complexes. Taken together, all these data although qualifying, on an average basis, the HSCs as poor oxidative phosphorylating cells, when normalized to the different CD34+ cell type subsets, would indicate the occurrence of a more efficient bioenergetic competence in those HSCs undergoing pre-commitment. This is, of course, not surprising because to activate and sustain a proliferative/differentiation program a more efficient energy supply system than glycolysis is required, even in the early steps of commitment, and this would be fulfilled by the mitochondrial oxidative phosphorylation apparatus. Thus along with the actuation of the differentiation program, or even before it, a biogenetic program leading to mitochondria proliferation must also be activated. The understanding of the stimulatory triggering and the signaling pathway for mitochondria biogenesis would be of extraordinary importance to maintain the multipotency of the mobilized HSCs, thus improving the efficiency of re-homing and hence the success of transplantation in mielo-ablated patients or to promote conditions required for ex vivo differentiation (43, 44).

An unexpected and intriguing result emerged from this study was the observation that about half of the endogenous cell respiration was CN-insensitive, suppressed by SOD/catalase and inhibitable by DPI. These functional clues, suggestive of the occurrence of an extra-mitochondrial oxygen consumption contributed by a flavoenzyme producing oxygen reactive species, were further supported by spectrophotometric, flow cytometry, reverse transcription-PCR, immunodetection analysis, and clearly identified in HSCs the presence of a plasma membrane NAD(P)H oxidase.

First discovered in neutrophils, NOX is the major player in the host defense mechanism catalyzing the oxidation of NAD(P)H and the monoelectronic reduction of O2 to the superoxide anion radical . is then converted by chemical or enzymatic dismutation in H2O2 (26, 45), which is used by myeloperoxidase to oxidize chloride anions to hypochlorite (a product of the reaction is also the O2 singlet). In the presence of reduced metal ions H2O2 gives rise to OH. by a Fenton-like reaction. This battery of strong oxidants and free radicals constitutes the chemical army used by neutrophiles and macrophages to kill bacteria (26). The harmful potency of this series of reaction requires a tight control that activates the oxidative burst just when required. The control is exerted by a change in the assembly of the enzymatic complex. The NAD(P)H oxidase is made by two membrane-embedded subunits, p22 and gp91 (26), this latter being the catalytic unit of the enzyme containing two hemes b558 and a flavin prosthetic group. In addition, gp91 contributes at least in part to the binding site of the reductant NAD(P)H (26). The gp91/p22 heterodimer is catalytically dormant and to be activated requires the recruitment of a number of additional cytoplasmic regulatory subunits (26, 45, 46). These subunits are p40, p47, p67, and the assembly of the multisubunit active complex is triggered by a multitude of intracellular signaling pathways leading to phosphorylation of p47 and p67 and mediated by the activation of the small G-protein Rac2. Together with the best characterized neutrophil NOX, similar enzymatic features have been discovered in the last decade in a number of cell types not involved in host defense (32, 46-48). The NADPH oxidase family encompasses five isoforms, NOX-1 to -5, with NOX 1-4 more closely related and NOX2 being the earlier discovered neutrophil isoform (46-48). The NOX2-like enzymes are constitutively active (scarcely stimulatable) in these cells, although at a rate that is much lower than that exhibited by the macrophagic cell types (47). The different behavior remains largely unknown but probably relies on the fact that non-phagocytic cells express isoforms of the neutrophil gp91phox and in some cases, some of the regulatory subunits and/or lack the specific activating intracellular signaling pathway (46-48).

In this study we have found that the CD34+ HSCs express the catalytic subunits of NOX2 and NOX4 and the three regulatory subunits p67, p47, and p40. Attempts to stimulate activity of the neutrophil isoform (i.e. NOX2) by PMA, arachidonate, or lipopolysaccharide failed. Given the limited availability of NOX4 antibodies our molecular analysis was limited to the NOX2 isoform. The observation by immunofluorescence microscopy that gp91 expression was speedily and homogeneously distributed in the CD34+ HSC population, along with the fact that proteins from the cell lysate immunoprecipitated and immunoblotted with anti-gp91phox showed a staining comparable with that obtained from polymorphonucleate control cells would exclude that the NAD(P)H oxidase activity and content were confined to a subset of CD34+ HSCs, committed toward the myeloid lineage possibly leading to progenitors of eosinophils, macrophages-monocytes. Even if this latter event might be suggested by the presence of a small but spectrally detectable amount of myeloperoxidase it is likely to be limited to a specific cell subset (whose clinical relevance deserves, however, attention). Our interpretation of the results is that adult hemopoietic stem cells express a NAD(P)H oxidase constitutively activated to a low rate of . production whose function is thus not related to the host defense mechanism. This observation has never been published before, the only exemption, to our knowledge, concerning stem-type cells is a limited number of reports where a NOX-like activity has been inferred in embryonic stem cells (49, 50). The intrinsically low DPI-sensitive oxygen consumption, measurable only by high resolution respirometry with concentrated cell suspension, limited the possibility to measure directly ROS production in our HSC samples by the relatively poor sensitive cytochrome c reduction assay or the problematic chemiluminescent lucigenin-based test. In addition, it must be considered that in the case of the cytochrome c reduction assay only the extracellular superoxide anion can be detected. If dismutates to H2O2 not only cannot this react with oxidized cytochrome c but can even re-oxidize its reduced form. In line with this we have, indeed, found that (i) HSC express all the SOD isoforms comprising the extracellular SOD3 isoform (51)2 and (ii) the cyto-fluorimetric measurement of a small but DPI-sensitive ROS detection was made possible by DCF, which is mainly a H2O2 selective probe. These observations suggest that O2 is reduced by NOX to dismutates to H2O2, which being freely membrane-permeant, diffuses inside the cell.

The question is to what function does the HSC NOX serve? A possible answer comes from the proposal that in nonhematopoietic cells ROS produced by the NOX2 isoforms are used to sense the environmental O2 tension and/or as intracellular redox messenger used for cell growth and development (52-58). When ROS concentration is taken below detrimental values, which in an aspecific way would induce a profound oxidative stress, their action would be more selective and targeted to systems controlling gene expression involved in the cell cycle or in differentiation programs. In addition to this, the kinetic features of the NAD(P)H oxidase with a Km for dioxygen of about 10 µM (59, 60), which is in the physiological O2 concentration range in bone marrow, makes attractive the possibility that the HSC NOX could serve as an efficient oxygen sensor, well adapted to produce ROS at a rate depending on the degree of environmental oxygenation that the cells experience (9, 10). Consistently with this is the reported observation that under certain conditions a low amount of ROS and related reactive species have been found to activate mitochondrial proliferation (61, 62). It has been shown that NO/cGMP-dependent mitochondrial biogenesis is operating in a number of different cell types (63) linked to the activation of PGC-1{alpha} and NRF1 expression, master regulators of mitochondrial content (62). Moreover it is long known that nitric-oxide synthase activity in vascular endothelial cells is enhanced by H2O2 and recently was shown that NADPH oxidase might be the cellular source of ROS (64). This matches our proposal that together with the actuation of a proliferation/differentiation program, ROS might control mitochondriogenesis, pre-committing the cell to satisfy the on-coming bioenergetic needs (see the scheme illustrated in Fig. 5).

The puzzling feature emerging from this study is that the NOX enzyme expressed in CD34+ HSCs seems to be the same isoform operating as the defending mechanism in the neutrophil lineage, although insensitive to ordinary activators and constitutively working at a basal producing rate. Interestingly the immunocytochemistry analysis presented here (Fig. 4A) has revealed a clustered distribution of NOX2 gp91phox, which might be in line with the general notion that lipid rafts function as the physical platform for signal integration at the plasma membrane. A modulatory role of lipid rafts on the NAD(P)H oxidase activation in neutrophils has recently been suggested (65).

Apparently the HSCs would lack the regulatory/activating system(s) of NOX2, leaving the possibility that the same enzyme might have a dual function depending on the developmental stage and differentiation fate. In the CD34+ hematopoietic precursors NOX2 would work as an O2 sensor and a ROS producer with the aim to signal the cell of an environmental change and at the same time to provide the messenger(s) preparing the cell (given a suitable biochemical stimulatory milieu) to differentiate. The observation that culturing under hypoxic conditions or in the presence of antioxidants prevents CD34+ HSCs from differentiation, improving preservation of their multipotency, would be in line with our proposal (66-68). Consistently is a recent report (69) in which the oxidative stress defense system (in terms of enzymatic antioxidants) in murine embryonic stem cells was compared at different stages of differentiation. Therein is shown that a shift in the thiol-disulfide equilibrium maintained by the glutathione/thioredoxin occurs during the early steps of differentiation, which makes the committing cells more proficient to cope with an increased level of reactive oxygen species. The authors conclude that this might serve to adjust the basal ROS concentration to a level appropriate to a role as second messenger in differentiation. Moreover in Ref. 70 it has been shown that signaling by the receptor activator of the NF-{kappa}B ligand (RANKL), which is essential for differentiation of bone marrow precursors into osteoclasts, is mediated by a transiently increased production of ROS produced by the NOX1 isoform. Depletion of NOX1 activity by RNA interference blocked completely RANKL-mediated ROS production and osteoclast differentiation.



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 5.
Schematic working model illustrating the possible function of NAD(P)H oxidase in growth and differentiation of CD34+ hematopoietic stem cells.

 
However, the observation deserves attention that in CD34+ HSCs two isoforms of NAD(P)H (i.e. NOX2 and NOX4) co-exist. This resembles what was already reported for endothelial cells and vascular layers (71). In that complex, interplay of several signaling pathways has been suggested to put the NOX2 and -4 isoforms upstream and downstream of redox-sensitive signaling transducers in a sense of a self-enforcing loop (72). That such a positive feed-back mechanism is indeed functional is supported by the observation that exogenously applied H2O2 can increase NAD(P)H oxidase activity in non-phagocytic cells (73).

Once the HSC is committed to differentiation, depending on the hematopoietic lineage undertaken, it will loose the NOX2/4 complexes or complement them with a regulatory/activating device suitable in the host defense mechanism or in cell type-specific redox signaling. Alternatively other NOX isoform(s) might be expressed. Further analysis is ongoing in our laboratory to test the above reported working hypothesis.


   FOOTNOTES
 
* This work was supported by the University of Foggia Funds for Research "Quota progetti 2002-2003." The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Both authors contributed equally to this study. Back

|| To whom correspondence should be addressed: Dept. of Biomedical Science, University of Foggia, viale L. Pinto OO.RR. 71100 Foggia, Italy. Tel.: 39-0881-711148; Fax: 30-0881-714745; E-mail: n.cap{at}unifg.it.

1 The abbreviations used are: HSCs, hematapoietic stem cells; OX-PHOS, oxidative phosphorylation; ROS, reactive oxygen species; PBS, phosphate-buffered saline; TRITC, tetramethylrhodamine isothiocyanate; DPI, diphenylene iodinium; BICN, tert-butyl isocyanide; Me2SO, dimethyl sulfoxide; CCCP, carbonyl cyanide m-chlorophenylhydrazone; SOD, superoxide dismutase; NOX, NAD(P)H oxidase; H2DCF-DA, 2',7'-dichlorodihydrofluorescein-diacetate; DCF, dichlorofluorescein; MDR1, multidrug resistant 1; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)-ethyl]glycine. Back

2 C. Piccoli and N. Capitanio, unpublished observation. Back


   ACKNOWLEDGMENTS
 
N. C. extends gratitude to Professor Sergio Papa for continuous encouragement and critical evaluation of the manuscript and Dr. Gaetano Villani for helpful discussions. We thank the referee for stimulating criticism that helped improving the manuscript.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. To, L. B., Haylock, D. N., Simmons, P. J., and Juttner, C. A. (1997) Blood 89, 2233-2258[Free Full Text]
  2. Asahara, T., Kalka, C., and Isner, J. M. (2000) Gene Ther. 7, 451-457[CrossRef][Medline] [Order article via Infotrieve]
  3. Alessandri, G., Emanueli, C., and Madeddu, P. (2004) Ann. N. Y. Acad. Sci. 1015, 271-284[Abstract/Free Full Text]
  4. Cottler-Fox, M. H., Lapidot, T., Petit, I., Kollet, O., DiPersio, J. F., Link, D., and Devine, S. (2003) Hematology (Am. Soc. Haematol. Educ. Program), 419-437
  5. Zhang, J., Niu, C., Ye, L., Huang, H., He, X., Tong, W. G., Ross, J., Haug, J., Johnson, T., Feng, J. Q., Harris, S., Wiedemann, L. M., Mishina, Y., and Li, L. (2003) Nature 425, 836-841[CrossRef][Medline] [Order article via Infotrieve]
  6. Pazianos, G., Uqoezwa, M., and Reya, T. (2003) BioTechniques 35, 1240-1247[Medline] [Order article via Infotrieve]
  7. Leusch, M. W., and Daley, G. O. (2004) Curr. Top. Dev. Biol. 60, 127-196[Medline] [Order article via Infotrieve]
  8. Heike, T., and Nakahata, T. (2004) Int. J. Hematol. 79, 7-14[Medline] [Order article via Infotrieve]
  9. Swartz, H. M., and Dunn, J. F. (2003) Adv. Exp. Med. Biol. 530, 1-12[Medline] [Order article via Infotrieve]
  10. Chow, D. C., Wenning, L. A., Miller, W. M., and Papoutsakis, E. T. (2001) Biophys. J. 81, 675-684[Abstract/Free Full Text]
  11. Lapidot, T., and Petit, I. (2002) Exp. Hematol. 30, 973-981[CrossRef][Medline] [Order article via Infotrieve]
  12. Tabilio, A., Falzetti, F., Giannoni, C., Aversa, F., Martelli, M. P., Rossetti, M., Caputo, P., Chionne, F., Gambelunghe, C., and Martelli, M. F. (1997) J. Hemathotherapy 6, 227-234
  13. Fritsch, G., Stimpfl, M., Kurz, M., Printz, D., Buchinger, P., Fischmeister, G., Hoecker, P., and Gadner, H. (1996) Bone Marrow Transplant. 17, 169-178[Medline] [Order article via Infotrieve]
  14. Bonnet, D. (2002) J. Pathol. 197, 430-440[CrossRef][Medline] [Order article via Infotrieve]
  15. Aversa, F., Tabilio, A., Velardi, A., Cunningham, I., Terenzi, A., Falzetti, F., Ruggeri, L., Barbabietola, G., Aristei, C., Latini, P., Reisner, Y., and Martelli, M. F. (1998) New Engl. J. Med. 339, 1186-1193[Abstract/Free Full Text]
  16. Williams, J. N., Jr. (1964) Arch. Biochem. Biophys. 107, 537-543[CrossRef][Medline] [Order article via Infotrieve]
  17. North, J. A., Rein, D., and Tappel, A. L. (1996) Anal. Biochem. 233, 115-123[Medline] [Order article via Infotrieve]
  18. Schagger, H. (1995) Methods Enzymol. 260, 190-202[Medline] [Order article via Infotrieve]
  19. Villani, G., Greco, M., Papa, S., and Attardi, G. (1998) J. Biol. Chem. 273, 31829-31836[Abstract/Free Full Text]
  20. Brunori, M., Giuffre, A., Forte, E., Mastronicola, D., Barone, M. C., and Sarti, P. (2004) Biochim. Biophys. Acta 1655, 365-371[Medline] [Order article via Infotrieve]
  21. Capaldi, R. A., Aggeler, R., Gilkerson, R., Hanson, G., Knowles, M., Marcus, A., Margineantu, D., Marusich, M., Murray, J., Oglesbee, D., Remington, S. J., and Rossignol, R. (2002) Biochim. Biophys. Acta 1555, 192-195[Medline] [Order article via Infotrieve]
  22. Lanza, F., Healy, L., and Sutherland, D. R. (2001) J. Biol. Regul. Homeostasis Agents 15, 1-13
  23. Cadenas, E., and Davies, K. J. (2000) Free Radic. Biol. Med. 29, 222-230[CrossRef][Medline] [Order article via Infotrieve]
  24. Floris, R., Kim, Y., Babcock, G. T., and Wever, R. (1994) Eur. J. Biochem. 222, 677-685[Medline] [Order article via Infotrieve]
  25. Babior, B. M. (1999) Blood 93, 1464-1476[Free Full Text]
  26. Cross, A. R., and Segal, A. W. (2004) Biochim. Biophys. Acta 1657, 1-22
  27. Hancock, J. T., and Jones, O. T. (1987) Biochem. J. 242, 103-107[Medline] [Order article via Infotrieve]
  28. Bernardi, P., Petronilli, V., Di Lisa, F., and Forte, M. (2001) Trends Biochem. Sci. 26, 112-117[CrossRef][Medline] [Order article via Infotrieve]
  29. Drach, D., Zhao, S., Drach, J., Mahadevia, R., Gattringer, C., Huber, H., and Andreeff, M. (1992) Blood 80, 2729-2734[Abstract/Free Full Text]
  30. Doussiere, J., Gaillard, J., and Vignais, P. V. (1996) Biochemistry 35, 13400-13410[CrossRef][Medline] [Order article via Infotrieve]
  31. Woodman, R. C., Ruedi, J. M., Jesaitis, A. J., Okamura, N., Quinn, M. T., Smith, R. M., Curnutte, J. T., and Babior, B. M. (1991) J. Clin. Investig. 87, 1345-1351
  32. Cox, J. A., Jeng, A. Y., Blumberg, P. M., and Tauber, A. I. (1987) J. Immunol. 138, 1884-1888[Abstract]
  33. DeLeo, F. R., Renee, J., McCormick, S., Nakamura, M., Apicella, M., Weiss, J. P., and Nauseef, W. M. (1998) J. Clin. Investig. 101, 455-463[Medline] [Order article via Infotrieve]
  34. Cheng, G., Cao, Z., Xu, X., van Meir, E. G., and Lambeth, J. D. (2001) Gene (Amst.) 269, 131-140[CrossRef][Medline] [Order article via Infotrieve]
  35. Dinauer, M. C., Pierce, E. A., Bruns, G. A., Curnutte, J. T., and Orkin, S. H. (1990) J. Clin. Investig. 86, 1729-1737
  36. El Benna, J., Faust, R. P., Johnson, J. L., and Babior, B. M. (1996) J. Biol. Chem. 271, 6374-6378[Abstract/Free Full Text]
  37. Hoyal, C. R., Gutierrez, A., Young, B. M., Catz, S. D., Lin, J. H., Tsichlis, P. N., and Babior, B. M. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 5130-5135[Abstract/Free Full Text]
  38. Uchida, N., He, D., Friera, A. M., Reitsma, M., Sasaki, D., Chen, B., and Tsukamoto, A. (1997) Blood 89, 465-472[Abstract/Free Full Text]
  39. Steidl, U., Kronenwett, R., and Haas, R. (2003) Ann. N. Y. Acad. Sci. 996, 89-100[Abstract/Free Full Text]
  40. Gross, S., Heim, K., Gruntmeir, J. J., Stillman, W. S., Pyatt, D. W., and Irons, R. D. (1997) Eur. J. Haematol. 59, 318-326[Medline] [Order article via Infotrieve]
  41. Spangrude, G. J., and Johnson, G. R. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 7433-7437[Abstract/Free Full Text]
  42. Kim, M., Cooper, D. D., Hayes, S. F., and Spangrude, G. J. (1998) Blood 91, 4106-4117[Abstract/Free Full Text]
  43. Jetmore, A., Plett, P. A., Tong, X., Wolber, F. M., Breese, R., Abonour, R., Orschell-Traycoff, C. M., and Srour, E. F. (2002) Blood 99, 1585-1593[Abstract/Free Full Text]
  44. Bunting, K. D., and Hawley, R. G. (2003) Biol. Cell. 95, 563-578[Medline] [Order article via Infotrieve]
  45. Babior, B. M. (2004) Curr. Opin. Immunol. 16, 42-47[CrossRef][Medline] [Order article via Infotrieve]
  46. Quinn, M. T., and Gauss, K. A. (2004) J. Leukocyte Biol. 76, 760-781[Abstract/Free Full Text]
  47. Bokoch, G. M., and Knaus, U. G. (2003) Trends Biochem. Sci. 28, 502-508[CrossRef][Medline] [Order article via Infotrieve]
  48. Geiszt, M., and Leto, T. L. (2004) J. Biol. Chem. 279, 51715-51718[Free Full Text]
  49. Sauer, H., Rahimi, G., Hescheler, J., and Wartenberg, M. (2000) FEBS Lett. 476, 218-223[CrossRef][Medline] [Order article via Infotrieve]
  50. Sauer, H., Neukirchen, W., Rahimi, G., Grunheck, F., Hescheler, J., and Wartenberg, M. (2004) Exp. Cell Res. 294, 313-324[CrossRef][Medline] [Order article via Infotrieve]
  51. Zelko, I. N., Mariani, T. J., and Folz, R. J. (2002) Free Radic. Biol. Med. 33, 337-349[CrossRef][Medline] [Order article via Infotrieve]
  52. Porwol, T., Ehleben, W., Brand, V., and Acker, H. (2001) Respir. Physiol. 128, 331-348[CrossRef][Medline] [Order article via Infotrieve]
  53. Haddad, J. J. (2004) Biochem. Biophys. Res. Commun. 316, 969-977[CrossRef][Medline] [Order article via Infotrieve]
  54. Kamata, H., and Hirata, H. (1999) Cell Signal. 11, 1-14[CrossRef][Medline] [Order article via Infotrieve]
  55. Finkel, T. (2001) IUBMB Life 52, 3-6[Medline] [Order article via Infotrieve]
  56. Laloi, C., Apel, K., and Danon, A. (2004) Curr. Opin. Plant Biol. 7, 323-328[CrossRef][Medline] [Order article via Infotrieve]
  57. Hancock, J. T., Desikan, R., and Neill, S. J. (2001) Biochem. Soc. Trans. 29, 345-350[CrossRef][Medline] [Order article via Infotrieve]
  58. Sauer, H., Wartenberg, M., and Hescheler, J. (2001) Cell. Physiol. Biochem. 11, 173-186[CrossRef][Medline]