JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M502248200 on May 25, 2005

J. Biol. Chem., Vol. 280, Issue 29, 26886-26895, July 22, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/29/26886    most recent
M502248200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bugreev, D. V.
Right arrow Articles by Mazin, A. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bugreev, D. V.
Right arrow Articles by Mazin, A. V.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Activation of Human Meiosis-specific Recombinase Dmc1 by Ca2+*

Dmitry V. Bugreev{ddagger}§, Efim I. Golub¶, Alicja Z. Stasiak||, Andrzej Stasiak||, and Alexander V. Mazin{ddagger}**

From the {ddagger}Department of Biochemistry and Molecular Biology, Drexel University College of Medicine, Philadelphia, Pennsylvania 19102, the §Institute of Chemical Biology and Fundamental Medicine, Siberian Branch of Russian Academy of Sciences, 630090 Novosibirsk, Russia, the Department of Genetics, Yale University School of Medicine, New Haven, Connecticut 06510, and the ||Laboratoire d'Analyse Ultrastructurale, Université de Lausanne, CH-1015 Lausanne-Dorigny, Switzerland

Received for publication, February 28, 2005 , and in revised form, May 9, 2005.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Rad51 and its meiotic homolog Dmc1 are key proteins of homologous recombination in eukaryotes. These proteins form nucleoprotein complexes on single-stranded DNA that promote a search for homology and that perform DNA strand exchange, the two essential steps of genetic recombination. Previously, we demonstrated that Ca2+ greatly stimulates the DNA strand exchange activity of human (h) Rad51 protein (Bugreev, D. V., and Mazin, A. V. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 9988–9993). Here, we show that the DNA strand exchange activity of hDmc1 protein is also stimulated by Ca2+. However, the mechanism of stimulation of hDmc1 protein appears to be different from that of hRad51 protein. In the case of hRad51 protein, Ca2+ acts primarily by inhibiting its ATPase activity, thereby preventing self-conversion into an inactive ADP-bound complex. In contrast, we demonstrate that hDmc1 protein does not self-convert into a stable ADP-bound complex. The results indicate that activation of hDmc1 is mediated through conformational changes induced by free Ca2+ ion binding to a protein site that is distinct from the Mg2+·ATP-binding center. These conformational changes are manifested by formation of more stable filamentous hDmc1·single-stranded DNA complexes. Our results demonstrate a universal role of Ca2+ in stimulation of mammalian DNA strand exchange proteins and reveal diversity in the mechanisms of this stimulation.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In most eukaryotic organisms, meiotic recombination is required for generation of genetic diversity and for accurate segregation of homologous chromosomes (13). Mutations that impair meiotic recombination have been reported to increase non-disjunction in Schizosaccharomyces pombe, Saccharomyces cerevisiae, Caenorhabditis elegans, Drosophila, mice, and humans; malfunction of meiotic recombination is a leading cause of trisomies in humans (4).

The molecular mechanisms of meiotic recombination have been extensively studied, especially in yeast. Meiotic recombination is initiated by DNA double strand breaks introduced in specific regions of chromosomes by a specialized enzyme, Spo11 (5, 6). Consequently, the mechanism of meiotic recombination appears to be closely related to the process of double strand break repair (710). The double-stranded DNA (dsDNA)1 ends are resected to produce an intermediate with a 3'-overhanging single-stranded DNA (ssDNA) tail in a process that involves the Mre11/Rad50/Xrs2 heterotrimer (11). The consequent steps of meiotic recombination require Rad51 and Dmc1 proteins and other members of the Rad52 epistasis group (12). It is known that both Rad51 and Dmc1 can polymerize on the ssDNA tails to form extended nucleoprotein complexes that promote a search for homologous DNA and that perform DNA strand exchange (1317). Rad51 and Dmc1 proteins have significant structural homology, sharing 52% identical amino acid residues, and display similar biochemical properties. However, these proteins may play distinct roles in vivo. Although Rad51 protein is expressed in both mitotic and meiotic cells, Dmc1 is a meiosis-specific protein. In mammals, Rad51 is an essential protein; RAD51–/– knockouts in the mouse cause embryonic lethality. In contrast, DMC1–/– knockouts are viable, but sterile (18, 19).

In vitro, under standard conditions in the presence of ATP and Mg2+, human (h) Dmc1 protein forms a peculiar structure on ssDNA defined as stacks of octameric rings (20) and weakly promotes DNA strand exchange (15, 21). Recently, it was found that KCl at elevated concentrations (100–200 mM) strongly stimulates the DNA strand exchange activity of hDmc1 protein and also promotes the formation of hDmc1·ssDNA helical nucleoprotein filaments (17).

Previously, we demonstrated that Ca2+ activates the DNA strand exchange activity of hRad51 protein (22) and that Ca2+ is required for stimulation of hRad51 protein by hRad54 protein (23). Here, we examine the effect of Ca2+ on the DNA strand exchange activity of hDmc1. The results show that the DNA strand exchange activity of hDmc1 protein is greatly enhanced by Ca2+. Taken together with our previous findings, the results suggest that Ca2+ may play a role in regulation of homologous recombination in vivo. This role of Ca2+ seems especially compelling because (i) Ca2+ is known as a common intracellular regulator (24), and (ii) Ca2+ concentration rises in response to DNA damage (2530) and during meiosis (31), at the time when homologous recombination occurs. We also found that the mechanism of Ca2+-dependent stimulation of the DNA strand exchange activity of hDmc1 protein differs significantly from that of hRad51 protein, in which inhibition of the ATPase activity plays the primary role. Our present data show that Ca2+-dependent stimulation of hDmc1 protein is possibly mediated by conformational changes in hDmc1 protein, leading to the formation of more stable hDmc1·ssDNA nucleoprotein complexes. Similar to the case with KCl (17), stimulation of the DNA strand exchange activity of hDmc1 protein by Ca2+ is accompanied by formation of the hDmc1·ssDNA helical nucleoprotein filaments, indicating an essential role of this structure in DNA strand exchange.



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 1.
Ca2+ stimulates joint molecule (D-loop) formation promoted by hDmc1 protein. A, the scheme of the reaction. The asterisks denote the 32P label. B, analysis of joint molecule formation on 1% agarose gel. The hDmc1 nucleoprotein complexes were formed on ssDNA (90-mer oligonucleotide) at 5 mM Mg2+ (Mg) or 2 mM Ca2+ (Ca). The reactions were initiated by addition of pUC19 dsDNA and carried out for the indicated time periods. C, data from B shown as a graph. D, dependence of joint molecule formation on the concentrations of Ca2+ (open circles) and Mg2+ (open triangles). Experiments were repeated three times, with S.E. values not exceeding 10%.

 

    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Proteins, Chemicals, and DNA—hDmc1 and human replication protein A (RPA) were purified as described previously (32, 33). Restriction endonucleases were purchased from New England Biolabs Inc. Creatine phosphokinase and phosphocreatine were obtained from Sigma (catalog nos. C3755 and P7936, respectively). 32P- and 14C-labeled nucleotides were purchased from PerkinElmer Life Sciences. The 90-mer oligonucleotide used was 5'-CGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGT (54% GC-rich). The oligonucleotide and pUC19 DNA were prepared as described previously (22). {phi}X174 ssDNA and dsDNA were purchased from New England Biolabs Inc. and Invitrogen, respectively. Poly(dT) ssDNA was obtained from Amersham Biosciences. In this study, the DNA concentrations are expressed as moles of nucleotide.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 2.
Ca2+ stimulates DNA pairing by acting during formation of the hDmc1 presynaptic filament. A, analysis of joint molecule formation on 1% agarose gel. Joint molecule formation was carried out as described under "Materials and Methods," except that the concentration of MgCl2 (Mg) was 1 mM. Where indicated, 1 mM CaCl (Ca) was added to the reactions. In the reactions shown in lanes 1–3 2, the nucleoprotein filaments were assembled by incubating ssDNA (90-mer oligonucleotide) with hDmc1 protein under the following conditions: in the absence of CaCl2 for 20 min (ssDNA+ Mg->+ scDNA); in the presence of CaCl2 for 20 min (ssDNA+Mg+Ca->+ scDNA); in the absence of CaCl2 for 10 min, followed by addition of CaCl2 and then by additional incubation for 10 min (ssDNA + Mg->+ Ca->+ scDNA). In these reactions, joint molecule formation was initiated by addition of supercoiled pUC19 dsDNA (scDNA) and carried out for 15 min. In the reaction shown in lane 4 (ssDNA+Mg->+ scDNA ->+ Ca), the nucleoprotein filaments were assembled by incubating ssDNA (90-mer oligonucleotide) with hDmc1 protein in the absence of CaCl2 for 20 min, followed by addition of pUC19 dsDNA, incubation for 5 min, addition of CaCl2, and additional incubation for 15 min. B, data from A represented in a bar graph. Experiments were repeated three times, with S.E. values not exceeding 10%.

 
Joint Molecule (D-loop) Formation—To form nucleoprotein complexes, hDmc1 protein (1.5 µM) was incubated with 32P-labeled ssDNA (90-mer oligonucleotide; 3 µM) in buffer containing 25 mM Tris acetate (pH 7.0), 2 mM ATP or AMP-PNP, 100 µg/ml bovine serum albumin (BSA), 1 mM dithiothreitol (DTT), and the indicated divalent ions for 10 min at 37 °C. Joint molecule formation was initiated by addition of supercoiled pUC19 dsDNA (50 µM). The reaction was terminated by addition of SDS to 1% and proteinase K to 880 µg/ml, followed by incubation for 15 min at 37 °C. 0.1 volume of loading buffer (70% glycerol and 0.1% bromphenol blue) was added, and the samples were analyzed by electrophoresis on 1% agarose gel containing TAE (40 mM Tris acetate (pH 8.0) and 1 mM EDTA). The extent of joint molecule formation was determined using a Storm 840 PhosphorImager as described previously (22). The extent is expressed as a percentage of the total plasmid DNA. The concentrations of free Ca2+ and Mg2+ and their complexes with ATP were calculated using WEBMAXC Version 2.10 (available at www.stanford.edu/~cpatton/webmaxcS.htm) applying the following parameters: temperature of 37 °C, pH 7.0, and ionic strength of 0.05 (34).



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 3.
Ca2+ stimulates three-strand exchange promoted by hDmc1 protein. A, the scheme of DNA strand exchange between {phi}X174 circular ssDNA and linear dsDNA. B, analysis of joint molecule (JM) formation on 1% agarose gel. The reactions were carried out for the indicated time periods at 2 mM Mg2+ (Mg), 2 mM Mg2+ and 1 mM Ca2+ (Ca+Mg), and 2 mM Mg2+ and 1 mM Ca2+ but without ATP (–ATP) or RPA (–RPA). M denotes DNA migration markers (1-kb ladder). C, data from B shown as a graph. Experiments were repeated three times, with S.E. values not exceeding 10%.

 
Three-strand Exchange Reaction—Nucleoprotein filaments were formed by incubating hDmc1 protein (7.5 µM) with {phi}X174 ssDNA (30 µM) in buffer containing 25 mM Tris acetate (pH 7.0), 50 mM NaCl, 2 mM ATP, 100 µg/ml BSA, 1 mM DTT, 2 mM MgCl2, and 1 mM CaCl2 (where indicated) for 5 min at 37 °C. hRPA (2 µM) was then added, and incubation was continued for 5 min. Reactions were initiated by addition of linear {phi}X174 dsDNA (DNA form I cleaved by ApaLI endonuclease; 30 µM). Aliquots (7 µl) were withdrawn, deproteinized by adding stop solution (3 µl) containing 4.8% SDS and 7.3 mg/ml proteinase K, incubated for 15 min at 37 °C, and analyzed by electrophoresis on 1% agarose gel containing TAE. A 1-kb DNA ladder (Invitrogen) was used for DNA migration markers. DNA bands were stained with ethidium bromide and quantified using an Image Station 440CF (Eastman Kodak Co.).

DNA Binding Assay—Nucleoprotein complexes were formed by incubating hDmc1 protein (1.5 µM) with 32P-labeled ssDNA (90-mer oligonucleotide; 6 µM) in buffer containing 25 mM Tris acetate (pH 7.0), 2 mM ATP, 100 µg/ml BSA, NaCl in indicated concentrations, 1 mM DTT, and either 5 mM MgCl2 or 2 mM CaCl2 at 37 °C. After 10 min, reactions were mixed with 0.2 volume of loading buffer and loaded onto running 10% polyacrylamide gels (135 V, 20 mA) in 0.5x buffer containing 45 mM Tris borate (pH 8.3) and 0.25 mM EDTA. Gels were processed and quantified using a Storm 840 PhosphorImager.

hDmc1 ATPase Assay—Reactions were carried out in buffer containing 25 mM Tris acetate (pH 7.0), 2 mM ATP, 3 µCi of [{gamma}-32P]ATP, 50 µM {phi}X174 ssDNA, 100 µg/ml BSA, 1 mM DTT, 5 mM MgCl2 or 2 mM CaCl2, and 3 µM hDmc1 protein at 37 °C. The extent of ATP hydrolysis was determined by TLC using polyethyleneimine-cellulose plates (Selecto Scientific) in 0.3 M KH2PO4 (pH 7.5); the products were visualized and quantified using a Storm 840 PhosphorImager.

Analysis of the Nucleotide Content of hDmc1·ATP/ADP·ssDNA Complexes—ATP hydrolysis was initiated by adding hDmc1 protein (10 µM) to ssDNA (90-mer oligonucleotide; 30 µM) in buffer containing 25 mM Tris acetate (pH 7.0), 100 µM ATP, 6 µCi of [{alpha}-32P]ATP, 100 µg/ml BSA, 1 mM DTT, 5 mM MgCl2 or 2 mM CaCl2, and the ATP regeneration system containing 15 mM phosphocreatine and 10 units/ml creatine phosphokinase at 37 °C. Aliquots (10 µl) were loaded onto nylon filters (Nytran, Schleicher & Schuell) in a Minifold apparatus (Schleicher & Schuell) and quickly washed twice (100 µl each) under vacuum with buffer containing 25 mM Tris acetate (pH 7.0) and either 5 mM MgCl2 or 2mM CaCl2. The hDmc1·ATP/ADP·ssDNA complexes were immediately extracted from the filters by soaking them in buffer (200 µl) containing 25 mM Tris acetate (pH 7.0), 50 mM EDTA, and 1% SDS; aliquots (3 µl) were analyzed by TLC as described above.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 4.
DNA pairing activity of hDmc1 protein depends on free Ca2+ concentration. The efficiency of joint molecule formation by hDmc1 protein was measured at the indicated concentrations of Ca2+ and ATP (A). The reactions were carried out for 15 min. The extent of joint molecule formation (shown in A) is plotted against the concentration of either free Ca2+ ion (B) or Ca2+·ATP complexes (C). The concentrations of free Ca2+ ion and Ca2+·ATP complexes were calculated as described under "Materials and Methods."

 
Kinetics of the Displacement of ADP from hDmc1·ADP·ssDNA Complexes—Nucleoprotein filaments were formed by mixing hDmc1 or hRad51 protein (10 µM) with the 90-mer oligonucleotide (30 µM) in the presence of ADP (100 µM) in buffer containing 25 mM Tris acetate (pH 7.0), 0.1 µCi of [14C]ADP, 100 µg/ml BSA, 1 mM DTT, and 5 mM MgCl2 at 37 °C for 30 min. To initiated ADP displacement, 2 mM ATP was added to the mixtures. At the indicated time points, aliquots (10 µM) were withdrawn, loaded onto Nytran nylon filters in a Minifold apparatus, and quickly washed twice (100 µl each) under vacuum with buffer containing 25 mM Tris acetate (pH 7.0) and 5 mM MgCl2. Filters were dried, and the amount of protein-bound [14C]ADP was determined using a Storm 840 PhosphorImager.

Electron Microscopy—hDmc1·ssDNA complexes were prepared by mixing hDmc1 protein (10 µM) with ssDNA (90-mer oligonucleotide or poly(dT); 15 µM) in buffer containing 25 mM triethanolamine HCl (pH 7.0), 2 mM ATP, and either 2 mM CaCl2 or 5 mM MgCl2 at 37 °C for 30 min (or 5 min for unfixed samples). When KCl was used (17), the nucleoprotein complexes were prepared in buffer containing 2.5 mM MgCl2, 200 mM KCl, and 2 mM ATP at 37 °C for 10 min. RecA·ssDNA filaments were formed by incubating the protein (10 µM) with ssDNA (15 µM) in buffer containing 25 mM triethanolamine (pH 7.0), 1 mM MgCl2, and 1 mM ATP{gamma}S at 37 °C for 30 min. Where indicated, the complexes were fixed with 0.2% glutaraldehyde at 37 °C for an additional 15 min. Samples were spread and stained following the negative staining procedure for electron microscopy (35). Images were recorded at a magnification of x22,000 or x28,000 with a Gatan digital camera installed on a Philips CM100 electron microscope.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Ca2+ Stimulates the DNA Strand Exchange Activity of hDmc1 Protein—Previously, we demonstrated that Ca2+ strongly stimulates the DNA strand exchange activity of hRad51 protein (22). Here, we studied the effect of Ca2+ on the DNA strand exchange activity of hDmc1 protein, a meiosis-specific homolog of hRad51 protein. First, we investigated the effect of Ca2+ on joint molecule (D-loop) formation promoted by hDmc1 protein between ssDNA and supercoiled pUC19 plasmid dsDNA (Fig. 1A). We found that formation of joint molecules was increased ~10-fold when Mg2+ was substituted with Ca2+ (Fig. 1, B and C). The yield of joint molecules was highest at 2 mM Ca2+, approximately stoichiometric to ATP (Fig. 1D); in contrast, no comparable stimulation of joint molecules was observed at 0.1–10 mM Mg2+.

By varying the order of Ca2+ addition, we found that stimulation of hDmc1 protein occurred only when Ca2+ was present during hDmc1·ssDNA complex assembly; stimulation was diminished when Ca2+ was added at later steps, i.e. following dsDNA substrate addition (Fig. 2). Thus, hDmc1 protein shows similarity to hRad51 protein, which is also responsive to Ca2+ stimulation during formation of presynaptic complexes (22).

Using oligonucleotide ssDNA and dsDNA substrates, we also found that Ca2+ was better than Mg2+ as a cofactor of hDmc1 protein in DNA strand exchange, although the increase in the extent of the reaction was ~3–4-fold smaller than in the D-loop assay in Fig. 1C (data not shown).

We then investigated the effect of Ca2+ on DNA strand exchange promoted by hDmc1 protein between circular ssDNA and linearized dsDNA of bacteriophage {phi}X174 as schematized in Fig. 3A. Ca2+ also stimulated the DNA strand exchange activity of hDmc1 protein in this assay (Fig. 3, B, lanes 5–12; and C, open circles). In this reaction, similar to hRad51 protein (22), hDmc1 protein required both Ca2+ and Mg2+. However, although omission of Ca2+ from the reaction mixture obliterated joint molecule formation completely (Fig. 3, B, lanes 1–4; and C, open squares), omission of Mg2+ in the presence of Ca2+ only decreased the efficiency of the reaction (~7–10-fold) (data not shown). Formation of joint molecules also required ATP (Fig. 3B, lanes 13–15) and RPA, an ssDNA-binding protein (lanes 16–18).

Thus, using three different assays, we demonstrated that the DNA strand exchange activity of hDmc1 protein was strongly stimulated by Ca2+. Taken together with our previous findings that Ca2+ is required for DNA strand exchange promoted by hRad51 and hRad54 proteins (22, 23), these results demonstrate that Ca2+ is an important cofactor of human DNA strand exchange proteins.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 5.
Effect of Mg2+ on Ca2+-dependent stimulation of the DNA pairing activity of hDmc1 protein. A, the effect of Mg2+ concentration on the efficiency of join molecule formation by hDmc1 protein was determined in the presence of a constant free Ca2+ ion concentration (~0.275 mM). To maintain a constant free Ca2+ ion concentration while increasing the Mg2+ concentration from 0 to 10 mM, the following total Ca2+ concentrations were used: 1.70, 1.60, 1.50, 1.40, 1.10, 1.26, 0.90, 0.76, 0.70, 0.66, and 0.60 mM at 2 mM ATP (open squares) and 3.20, 2.80, 2.50, 1.80, 1.22, 0.80, 0.58, 0.47, and 0.35 mM at 4 mM ATP (closed circles). B, the extent of joint molecule formation depended on the concentration of free Mg2+ ion. The data from A are plotted against calculated free Mg2+ ion concentrations. C, shown is the effect of a concurrent increase in the concentrations (total) of Mg2+ and ATP (indicated by bars) on the extent of joint molecule formation. The total concentration of Ca2+ was 0.5 mM.

 
Free Ca2+ Ion Is Important for hDmc1 Protein Activation—To gain some insight into the mechanism of hDmc1 protein activation, we determined the optimal Ca2+ concentration for DNA pairing. Using the joint molecule (D-loop) assay, we found that, at any ATP concentration tested (0.5, 2, and 5 mM), the optimal Ca2+ concentration was approximately equimolar to ATP (Fig. 4A). Because ATP chelates Ca2+, the concentration of free Ca2+ ion is low at high ATP/Ca2+ ratios. Therefore, the simplest interpretation of this result would be that free Ca2+ ion is required for hDmc1 activity, but its excess is inhibitory for hDmc1. However, because the concentration of the Ca2+·ATP complex also rises with the increase in total Ca2+ concentration, it is possible that binding of Ca2+·ATP is required for hDmc1 protein activation. We argued that the DNA pairing activity of hDmc1 protein should show a dependence on the concentration of that ligand that is critical for its activity, but not on the other. From the experimental data in Fig. 4A, we calculated the concentrations of free Ca2+ ion and the Ca2+·ATP complex using WEBMAXC STANDARD software and then replotted the extent of joint molecule formation as a function of the calculated concentrations of each ligand. We found that the extent of joint molecule formation showed a dependence on the free Ca2+ ion concentration (Fig. 4B). The DNA pairing activity of hDmc1 protein was initiated at ~5–10 µM free Ca2+ ion (Fig. 4B, inset), reached its maximum at 100–400 µM, and declined at concentrations >700 µM. In contrast, joint molecule formation showed no discernible dependence on the concentration of the Ca2+·ATP complex (Fig. 4C). It should be noted that the apparent independence of hDmc1 protein pairing activity of the Ca2+·ATP concentration does not exclude that hDmc1 binds ATP in the form of the Ca2+·ATP complex; however, it indicates that, at the range of Ca2+ and ATP concentrations tested, binding of free Ca2+ ion represents a critical step in hDmc1 protein activation. Thus, binding of free Ca2+ ion appears to be important for the DNA pairing activity of hDmc1 protein.



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 6.
During ATP hydrolysis, hDmc1 protein accumulates five times less protein-bound ADP than does hRad51 protein. A, Ca2+ inhibits the ATPase activity of hDmc1 protein. B, the scheme of analysis of the ADP content within hDmc1 nucleoprotein complexes. C, retention of hDmc1·[{alpha}-32P]ATP/ADP·ssDNA complexes on a Nytran filter in the presence of 5 mM Mg2+ (Mg) or 2 mM Ca2+ (Ca). D, upper panel, amount of protein-bound ADP determined by TLC after incubation of hDmc1·ssDNA complexes or hRad51·ssDNA complexes for the indicated time periods. Lower panel, data presented as a graph. E, the hDmc1·ssDNA nucleoprotein forms a less stable complex with ADP than does the hRad51·ssDNA nucleoprotein. The kinetics of displacement of [14C]ADP from hDmc1·ssDNA nucleoprotein complexes (closed circles) and hRad51·ssDNA complexes (closed squares) with 20-fold excess ATP were measured by the filter binding assay. The amount of protein-bound ADP before addition of ATP is expressed as 100%. Experiments were repeated three times, with S.E. values not exceeding 10%.

 
Effect of Mg2+ on the DNA Pairing Activity of hDmc1 Protein—Here, we investigated whether Mg2+, another biologically important divalent cation, would interfere with Ca2+-dependent stimulation of Dmc1 protein, e.g. by competing for binding to the protein. Intracellular Mg2+ is present as a free ion and in a complex with ATP, whose concentrations are thought to be in the range of 0.5–1.0 and 4–5 mM, respectively (36). Therefore, we studied the effects of both these species on the efficiency of D-loop formation by varying the concentrations of either Mg2+ or ATP. The concentration of free Ca2+ ion, which strongly affects the activity of hDmc1, was maintained constant.

First, we varied the total Mg2+ concentration while the total ATP concentration was fixed at either 2 or 4 mM. Because Mg2+ displaces Ca2+ from a complex with ATP, to maintain a constant free Ca2+ ion concentration (~0.275 mM), the total Ca2+ concentration was gradually decreased while the Mg2+ concentration was increased. We found that, at each ATP concentration, Mg2+ became inhibitory for D-loop formation at concentrations greater than that of ATP (Fig. 5A). Using these data, we then replotted the extent of joint molecule formation as a function of free Mg2+ ion concentration that was calculated using WEBMAXC STANDARD software. We found that, independent of ATP concentration, the extent of joint molecule formation decreased steadily with the increase in free Mg2+ ion concentration; half-inhibition was observed at ~2 mM free Mg2+ ion (Fig. 5B).

We next investigated the effect of the Mg2+·ATP complex on Ca2+-dependent stimulation of hDmc1 protein. For this purpose, we measured the efficiency of D-loop formation under conditions in which the concentrations of both Mg2+ and ATP were increased concomitantly, elevating the concentration of the Mg2+·ATP complex, while the concentration of free Ca2+ ion was kept at ~0.1–0.2 mM, within the optimal range for hDmc1 protein DNA pairing. We found that increases in both Mg2+ and ATP concentrations up to 10 mM, corresponding to 9.4 mM Mg2+·ATP complex, did not significantly inhibit hDmc1 protein (Fig. 5C).

Therefore, we conclude that free Mg2+ ion (but not the Mg2+·ATP complex) causes inhibition of the Ca2+-dependent DNA pairing activity of hDmc1 protein. However, significant inhibition was observed only at Mg2+ concentrations above the physiological level.

hDmc1 Protein Is Not a Self-inactivating ATPase—Previously, we demonstrated that, in the presence of Mg2+, the hRad51·ATP·ssDNA filament rapidly converts into an inactive ADP-bound form during ATP hydrolysis; inhibition of the ATPase activity by Ca2+ preserves the active filament (22). Because hDmc1 protein is structurally and biochemically similar to hRad51 protein, we tested whether it behaves as a self-inactivating ATPase as well.

First, we measured the ssDNA-dependent ATPase activity of hDmc1 protein (Fig. 6A). In the presence of Mg2+, the kcat of the hDmc1 ATPase was ~0.6 min–1, about twice as high as the ATPase activity of hRad51 protein (kcat = 0.3 min–1) (22). As in the case of hRad51 protein, the ATPase activity of hDmc1 protein was inhibited by Ca2+ (Fig. 6A). We then investigated whether hDmc1 protein converts into an ADP-bound form during ATP hydrolysis. We employed the filter binding assay that we developed earlier (22), in which hDmc1·ssDNA nucleoprotein complexes formed in the presence of [{alpha}-32P]ATP are isolated on nylon filters, and the composition of the nucleoprotein-bound nucleotides are analyzed by TLC (Fig. 6B). To prevent accumulation of ADP in solution during ATP hydrolysis, which would obscure the results due to ADP rebinding to hDmc1 protein, we carried out the reaction in the presence of the ATP regeneration system. As shown in Fig. 6C, hDmc1·[{alpha}-32P]ATP/ADP·ssDNA complexes formed in the presence of either Ca2+ or Mg2+ were efficiently retained on the filters. The amounts of labeled nucleotides in these complexes were nearly equimolar with respect to hDmc1 protein, indicating essentially quantitative recovery of the complexes (data not shown). Surprisingly, we found that hDmc1 behaved differently from hRad51 protein; after 30 min of ATP hydrolysis in the presence of Mg2+, the amount of hDmc1 protein-bound ADP was low, not exceeding 12–14% of the total protein-bound nucleotides (ATP + ADP) (Fig. 6D, upper panel, lanes 6–10; and lower panel, open squares). In the presence of Ca2+, the fraction of ADP bound to Dmc1 was still lower, ~2% (Fig. 6D, upper panel, lanes 1–5; and lower panel, open circles). In contrast, as we previously reported (22), hRad51 protein rapidly accumulated ADP in the presence of Mg2+ and the ATP regeneration system: the fraction of protein-bound ADP rose to ~50% within 2 min of ATP hydrolysis (Fig. 6D, upper panel, lanes 11–15; and lower panel, closed squares).



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 7.
Effect of a non-hydrolyzable ATP analog (AMP-PNP) on the DNA pairing activity of hDmc1 protein. Upper panel, the hDmc1 nucleoprotein complex was formed on ssDNA (90-mer oligonucleotide) in the presence of either 2 mM Ca2+ (Ca) or 5 mM Mg2+ (Mg). The following nucleotide cofactors were used: ATP, AMP-PNP (PNP), and ADP. Joint molecule formation was analyzed on 1% agarose gel. Lower panel, the data are shown graphically. Experiments were repeated three times, with S.E. values not exceeding 10%.

 
The observed difference in accumulation of protein-bound ADP by hDmc1 and hRad51 proteins led us to suggest that, in contrast to hRad51 protein, hDmc1 protein does not form a stable complex with ADP, a product of ATP hydrolysis. Using the filter binding assay described above and [14C]ADP, we tested this by measuring the kinetics of ADP displacement by ATP for hDmc1·ADP·ssDNA and hRad51·ADP·ssDNA complexes. Using a 20-fold excess of ATP, we found that ADP was displaced from the complex with the hDmc1·ssDNA nucleoprotein >20 times as rapidly as from the complex with the hRad51·ssDNA nucleoprotein (Fig. 6E). Thus, in contrast to hRad51 protein, hDmc1 protein does not self-convert into an ADP-bound complex during ATP hydrolysis, likely due to the lower stability of the hDmc1·ADP complex compared with hRad51 protein.

Role of the hDmc1 Protein ATPase Activity in DNA Pairing— Previously, we demonstrated that inhibition of the ATPase activity plays a crucial role in stimulation of the DNA pairing activity of hRad51 protein (22). As we reported above, Ca2+ inhibited the ATPase activity of hDmc1 protein as well. If inhibition of ATP hydrolysis is critical for DNA pairing of hDmc1, one should expect that the protein is active in the presence of non-hydrolyzable ATP analogs in the absence of Ca2+, as we observed for hRad51 protein (22). However, using the joint molecule assay, we found that, in the absence of Ca2+, the DNA pairing activity of hDmc1 protein was relatively weakly supported by non-hydrolyzable ATP analogs such as AMP-PNP (Fig. 7), AMP-PCP, ADP·AlFx, and ADP·BeF3 (data not shown). These results were in accord with the results reported by Sung and co-workers (17). In contrast, in the presence of Ca2+, AMP-PNP fully supported the DNA pairing activity of hDmc1 protein (Fig. 7). Thus, similar to other Rad51/RecA family proteins, hDmc1 does not require ATP hydrolysis for its DNA pairing activity. The observation that Ca2+ was required for the DNA pairing activity of hDmc1 protein even in the presence of non-hydrolyzable ATP analogs indicates that inhibition of the ATPase activity by Ca2+ is insufficient for hDmc1 activation.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 8.
Ca2+ increases the stability of the hDmc1·ssDNA filament. A, the effect of NaCl on hDmc1·ssDNA complexes was analyzed by electrophoresis on 10% polyacrylamide gel. hDmc1 protein (1.5 µM) was incubated with 32P-labeled ssDNA (90-mer oligonucleotide; 6 µM) in the presence of 5 mM Mg2+ (Mg) or 2 mM Ca2+ (Ca) and the indicated concentrations of NaCl. B, the data in A are presented as a graph.

 
Ca2+ Promotes Formation of Stable Dmc1·ssDNA Filaments—We wanted to determine whether Ca2+ affects the stability and structure of the hDmc1·ssDNA nucleoprotein. First, we tested the effect of Ca2+ on the stability of hDmc1·ssDNA nucleoprotein complexes. As a measure of the stability of the hDmc1·ssDNA complexes, we used the resistance of these complexes against dissociation in the presence of elevated salt concentrations. Using a gel retardation assay, we found that the hDmc1·ssDNA complex showed a greater resistance to NaCl in the presence of Ca2+ compared with Mg2+ (Fig. 8A); the salt titration midpoint for hDmc1·ssDNA complexes, which is defined as the NaCl concentration at which one-half of the nucleoprotein complexes were dissociated, was significantly greater in the presence of Ca2+ (200 mM NaCl) compared with Mg2+ (130 mM NaCl) (Fig. 8B).

We then examined the structure of hDmc1·ssDNA complexes by electron microscopy. In the first series, to form the nucleoprotein complexes, we used the same ssDNA oligonucleotide that was used in the D-loop assay (90-mer oligonucleotide); the nucleoprotein complexes were fixed with glutaraldehyde. In the presence of Mg2+ and ATP, these complexes looked similar to the previously observed structure (20), defined as "stacks of rings" (Fig. 9A). However, in the presence of Ca2+, the structure of the complexes looked different and resembled helical filaments (Fig. 9B). To increase the length and stability of the complexes, which may better reveal the structure of hDmc1·ssDNA complexes, we used poly(dT) ssDNA. Indeed, the length of the complexes increased; however, the exact structure of the complexes formed in the presence of Ca2+ was still difficult to discern (Fig. 9C). Because, in the case of RecA·ATP·ssDNA complexes, fixation of the samples by glutaraldehyde was shown to cause the collapse of the nucleoprotein helix, leading to formation of smooth complexes with obscured helicity (35), we omitted fixation. Although the unfixed hDmc1·poly(dT) complexes hardly resisted the spreading and adsorption on the grids, the remaining portions of the complexes formed in the presence of Ca2+ clearly showed the extended helical structure (Fig. 9D). The helical pitch of these filaments ranged from 9 to 11 nm, with a mean of 10.4 nm, comparable with the pitch for the filaments formed by RecA (Fig. 9E), Rad51, and hDmc1 in the presence of KCl (Fig. 9F), in accord with the data reported recently by Sung and co-workers (17). In contrast, in the presence of Mg2+, an intrinsic instability of unfixed hDmc1·poly(dT) complexes prevented unambiguous determination of their structure (data not shown). These results show that Ca2+ stimulates hDmc1 protein binding to ssDNA and promotes formation of the hDmc1·ssDNA helical nucleoprotein filaments.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
hRad51, a key protein of homologous recombination, and hDmc1, its meiosis-specific homolog, display significant structural homology. The proteins have similar biochemical activities; notably, they both promote DNA strand exchange, a basic step of homologous recombination. Remarkably, DNA strand exchange is evolutionarily conserved from bacteria to humans (13, 37, 38). Previously, we demonstrated that the DNA strand exchange activity of hRad51 protein is greatly stimulated by calcium ions (22). Moreover, Ca2+ is essential also for efficient stimulation of hRad51 protein by hRad54 (23), a protein of the SWI2/SNF2 family (39). Our present results demonstrate that Ca2+ stimulates the DNA strand exchange activity of hDmc1 protein as well. Taken together, all these results demonstrate that Ca2+ plays the role of a universal cofactor of human proteins that promote DNA strand exchange.



View larger version (97K):
[in this window]
[in a new window]
 
FIG. 9.
Electron microscopy of hDmc1·ssDNA complexes formed in the presence of Mg2+ and Ca2+. hDmc1 protein formed a stack of rings on ssDNA (90-mer oligonucleotide) in the presence of Mg2+ (A). Filament-like structures were formed by hDmc1 protein on ssDNA (90-mer oligonucleotide) in the presence of Ca2+ (B). The hDmc1 complex formed on poly(dT) ssDNA in the presence of Ca2+ (C). In A–C, the samples were fixed with glutaraldehyde. Helical filaments formed by hDmc1 protein on poly(dT) ssDNA in the presence of Ca2+ (D) or in the presence of Mg2+ and KCl (17) (F) and helical filaments formed by RecA protein on poly(dT) ssDNA (E) were prepared without fixation with glutaraldehyde. ATP and ATP{gamma}S were used as nucleotide cofactors for hDmc1 and RecA, respectively.

 
As in the case of hRad51 protein, Ca2+ exerts its stimulatory effect primarily during hDmc1 presynaptic nucleoprotein complex formation, increasing the stability of the hDmc1·ssDNA complex. However, despite similarities between hRad51 and hDmc1 proteins, the mechanisms of stimulation of these two proteins by Ca2+ appear to be different. Previously, we showed that Rad51 protein behaves in the presence of Mg2+ as a self-inactivating ATPase, forming a stable complex with ADP, which is inactive in DNA pairing (22). In contrast, hDmc1 protein forms a much less stable complex with ADP than does hRad51 protein, and as a consequence, an inactive hDmc1·ADP·ssDNA complex does not accumulate during ATP hydrolysis. Previously, we demonstrated that Ca2+ stimulates DNA pairing of hRad51 protein mainly by inhibiting ATP hydrolysis: in the presence of non-hydrolyzable ATP analogs, Ca2+ becomes dispensable (22). Although the ATPase activity of hDmc1 protein is also inhibited by Ca2+, its DNA pairing activity cannot be fully rescued by the use of non-hydrolyzable ATP analogs in the absence of Ca2+. In contrast, in the presence of Ca2+, the DNA pairing activity of hDmc1 is fully supported by a non-hydrolyzable analog, AMP-PNP. This result indicates that inhibition of the ATPase activity may be necessary but not sufficient for Ca2+-dependent stimulation of hDmc1 protein.

Recently, several crystal structures of eukaryotic and archaeal proteins of the Rad51 family have been solved (40, 41). In these structures, the ATPase site is found at the interface between monomers of the nucleoprotein filament. Therefore, it is very likely that conformational changes affecting the ATPase site would also have an effect on the filament structure. Moreover, it was demonstrated that K+ ions bind archaeal Rad51 protein in the proximity of the ATPase site, causing conformational changes in the protein and affecting its ATPase activity at the same time (42). Our present data show that Ca2+ causes inhibition of the ATPase activity of hDmc1 protein and promotes formation of more stable nucleoprotein complexes than those formed in the presence of Mg2+ alone. Using electron microscopy, we have demonstrated that these complexes have a filamentous structure, resembling filaments previously observed for RecA and Rad51 and recently for hDmc1 protein (17). Therefore, we suggest that binding of Ca2+ ion to hDmc1 protein induces conformational changes that affect the ATPase center and the structure of the nucleoprotein complexes.

The crystal structures of proteins of the Rad51 family indicate that ATP is bound to these proteins in a complex with Mg2+ (40, 41, 43). Therefore, it seemed possible that Ca2+ exerts its stimulatory effect by forming a Ca2+·ATP complex in solution, which binds to the ATP-binding center of hDmc1 protein, instead of Mg2+·ATP. However, our data argue against this mechanism. First, the DNA pairing activity of hDmc1 protein depends on the concentration of free Ca2+ ion, not Ca2+·ATP, indicating that binding of free Ca2+ ion is essential for the protein activation. Second, a very high (~20-fold) excess of the Mg2+·ATP complex over Ca2+ does not cause significant inhibition of DNA pairing, indicating that Ca2+ and the Mg2+·ATP complex are not antagonists in binding to the protein. One possible explanation for stimulation of Dmc1 by Ca2+ is that free Ca2+ ion binds to a specific site(s) on hDmc1 protein, which is different from the site of Mg2+·ATP binding. This binding may induce conformational changes in the protein that enhance its ability to form filamentous structures on ssDNA and that efficiently promote DNA strand exchange. This hypothesis is also consistent with the inhibitory effect of free Mg2+ ion, which can either compete directly with Ca2+ for this tentative metal-binding site or inhibit Ca2+ binding by inducing conformational changes in the protein via specific or nonspecific interactions that remain to be further characterized.

Why are hDmc1 and hRad51, two structurally similar proteins, activated by Ca2+ by different mechanisms? The answer may lie in the evolutionary history of these proteins. The subfamily of DMC1 and RAD51 genes separated early, prior to the divergence between low and high eukaryotes. Because Rad51 protein from S. cerevisiae (the only Rad51 ortholog from low eukaryotes that has been examined) is not stimulated by Ca2+ (22), one may suggest that the mechanisms of Ca2+ stimulation for Rad51 and Dmc1 proteins appeared independently during evolution.

It is thought that, in human cells, the physiological concentrations of free Mg2+ ion are in the range of 0.5–1.0 mM and those of the Mg2+·ATP complex are in the range of 4–5 mM (34, 36). Our present results demonstrate that, at physiological concentrations, Mg2+ does not significantly inhibit Ca2+-dependent stimulation of hDmc1 protein. This observation may indicate the physiological relevance of hDmc1 stimulation by Ca2+. Ca2+ is a versatile regulator of many cellular processes in vertebrates (24). In vitro, Ca2+ is required for DNA pairing promoted by major human proteins of homologous recombination (hRad51 and hDmc1) (this study and Ref. 22), and it is required for stimulation of hRad51 by hRad54 protein (23). Taken together, these findings raise the possibility that the system of homologous recombination in human cells can also be regulated via the Ca2+ signaling pathway.


    FOOTNOTES
 
* This work was supported by the Drexel University Synergy Award, National Institutes of Health Grant CA100839 (to A. V. M.), and Swiss National Foundation Grant 3100A0-103962 (to A. S.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

** To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biology, MS 497, NCB, Rm. 10103, Drexel University College of Medicine, 245 N. 15th St., Philadelphia, PA 19102-1192. Tel.: 215-762-7195; Fax: 215-762-4452; E-mail: avm28{at}drexel.edu.

1 The abbreviations used are: dsDNA, double-stranded DNA; ssDNA, single-stranded DNA; h, human; RPA, replication protein A; AMP-PNP, adenosine 5'-({beta},{gamma}-iminotriphosphate); BSA, bovine serum albumin; DTT, dithiothreitol; ATP{gamma}S, adenosine 5'-O-(thiotriphosphate); AMP-PCP, adenosine 5'-({beta},{gamma}-methylenetriphosphate). Back


    ACKNOWLEDGMENTS
 
We thank P. Sung and M. S. Wold for hRad51 and hRPA expression vectors and S. C. Kowalczykowski, O. M. Mazina, J. Nickels, and S. Weeks for comments and discussion.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Kleckner, N. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 8167–8174[Abstract/Free Full Text]
  2. Paques, F., and Haber, J. E. (1999) Microbiol. Mol. Biol. Rev. 63, 349–404[Abstract/Free Full Text]
  3. Roeder, G. S. (1997) Genes Dev. 11, 2600–2621[Free Full Text]
  4. Lynn, A., Ashley, T., and Hassold, T. (2004) Annu. Rev. Genomics Hum. Genet. 5, 317–349[CrossRef][Medline] [Order article via Infotrieve]
  5. Keeney, S., Giroux, C. N., and Kleckner, N. (1997) Cell 88, 375–384[CrossRef][Medline] [Order article via Infotrieve]
  6. Romanienko, P. J., and Camerini-Otero, R. D. (2000) Mol. Cell 6, 975–987[Medline] [Order article via Infotrieve]
  7. Bishop, D. K., and Zickler, D. (2004) Cell 117, 9–15[CrossRef][Medline] [Order article via Infotrieve]
  8. Masson, J. Y., and West, S. C. (2001) Trends Biochem. Sci. 26, 131–136[CrossRef][Medline] [Order article via Infotrieve]
  9. Haber, J. E. (1998) Curr. Biol. 8, R832–R835[Medline] [Order article via Infotrieve]
  10. Bianco, P. R., Tracy, R. B., and Kowalczykowski, S. C. (1998) Front. Biosci. 3, D570–D603[Medline] [Order article via Infotrieve]
  11. Lee, S. E., Moore, J. K., Holmes, A., Umezu, K., Kolodner, R. D., and Haber, J. E. (1998) Cell 94, 399–409[CrossRef][Medline] [Order article via Infotrieve]
  12. Krogh, B. O., and Symington, L. S. (2004) Annu. Rev. Genet. 38, 233–271[CrossRef][Medline] [Order article via Infotrieve]
  13. Sung, P. (1994) Science 265, 1241–1243[Abstract/Free Full Text]
  14. Hong, E. L., Shinohara, A., and Bishop, D. K. (2001) J. Biol. Chem. 276, 41906–41912[Abstract/Free Full Text]
  15. Li, Z., Golub, E. I., Gupta, R., and Radding, C. M. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 11221–11226[Abstract/Free Full Text]
  16. Mazin, A. V., Zaitseva, E., Sung, P., and Kowalczykowski, S. C. (2000) EMBO J. 19, 1148–1156[CrossRef][Medline] [Order article via Infotrieve]
  17. Sehorn, M. G., Sigurdsson, S., Bussen, W., Unger, V. M., and Sung, P. (2004) Nature 429, 433–437[CrossRef][Medline] [Order article via Infotrieve]
  18. Pittman, D. L., Cobb, J., Schimenti, K. J., Wilson, L. A., Cooper, D. M., Brignull, E., Handel, M. A., and Schimenti, J. C. (1998) Mol. Cell 1, 697–705[CrossRef][Medline] [Order article via Infotrieve]
  19. Yoshida, K., Kondoh, G., Matsuda, Y., Habu, T., Nishimune, Y., and Morita, T. (1998) Mol. Cell 1, 707–718[CrossRef][Medline] [Order article via Infotrieve]
  20. Kinebuchi, T., Kagawa, W., Enomoto, R., Tanaka, K., Miyagawa, K., Shibata, T., Kurumizaka, H., and Yokoyama, S. (2004) Mol. Cell 14, 363–374[CrossRef][Medline] [Order article via Infotrieve]
  21. Masson, J. Y., Davies, A. A., Hajibagheri, N., Van Dyck, E., Benson, F. E., Stasiak, A. Z., Stasiak, A., and West, S. C. (1999) EMBO J. 18, 6552–6560[CrossRef][Medline] [Order article via Infotrieve]
  22. Bugreev, D. V., and Mazin, A. V. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 9988–9993[Abstract/Free Full Text]
  23. Mazina, O. M., and Mazin, A. V. (2004) J. Biol. Chem. 279, 52042–52051[Abstract/Free Full Text]
  24. Berridge, M. J., Bootman, M. D., and Roderick, H. L. (2003) Nat. Rev. Mol. Cell. Biol. 4, 517–529[CrossRef][Medline] [Order article via Infotrieve]
  25. Spielberg, H., June, C. H., Blair, O. C., Nystrom-Rosander, C., Cereb, N., and Deeg, H. J. (1991) Exp. Hematol. 19, 742–748[Medline] [Order article via Infotrieve]
  26. Schieven, G. L., Kirihara, J. M., Gilliland, L. K., Uckun, F. M., and Ledbetter, J. A. (1993) Mol. Biol. Cell 4, 523–530[Abstract]
  27. Negre-Salvayre, A., Fitoussi, G., Reaud, V., Pieraggi, M. T., Thiers, J. C., and Salvayre, R. (1992) FEBS Lett. 299, 60–65[CrossRef][Medline] [Order article via Infotrieve]
  28. Korzets, A., Chagnac, A., Weinstein, T., Ori, Y., Malachi, T., and Gafter, U. (1999) J. Lab. Clin. Med. 133, 362–369[CrossRef][Medline] [Order article via Infotrieve]
  29. Sakai, H., Ito, E., Cai, R. X., Yoshioka, T., Kubota, Y., Hashimoto, K., and Fujishima, A. (1994) Biochim. Biophys. Acta 1201, 259–265[Medline] [Order article via Infotrieve]
  30. Kumasaka, S., Shoji, H., and Okabe, E. (1999) Antioxid. Redox Signal. 1, 55–69[Medline] [Order article via Infotrieve]
  31. Carroll, J., Swann, K., Whittingham, D., and Whitaker, M. (1994) Development (Camb.) 120, 3507–3517[Abstract]
  32. Gupta, R. C., Golub, E., Bi, B., and Radding, C. M. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 8433–8439[Abstract/Free Full Text]
  33. Henricksen, L. A., Umbricht, C. B., and Wold, M. S. (1994) J. Biol. Chem. 269, 11121–11132[Abstract/Free Full Text]
  34. Schmitz, C., Perraud, A. L., Johnson, C. O., Inabe, K., Smith, M. K., Penner, R., Kurosaki, T., Fleig, A., and Scharenberg, A. M. (2003) Cell 114, 191–200[CrossRef][Medline] [Order article via Infotrieve]
  35. Sogo, J., Stasiak, A., DeBernardin, W., Losa, R., and Koller, T. (1987) in Electron Microscopy in Molecular Biology (Sommerville, J., and Scheer, U., eds) pp. 61–79, IRL Press, Oxford
  36. Romani, A. M., and Scarpa, A. (2000) Front. Biosci. 5, D720–D734[Medline] [Order article via Infotrieve]
  37. Bryant, F. R., Riddles, P. W., and Lehman, I. R. (1984) Cold Spring Harbor Symp. Quant. Biol. 49, 535–539[Medline] [Order article via Infotrieve]
  38. Flory, S. S., Tsang, J., Muniyappa, K., Bianchi, M., Gonda, D., Kahn, R., Azhderian, E., Shaner, S., and Radding, C. M. (1984) Cold Spring Harbor Symp. Quant. Biol. 49, 513–523[Medline] [Order article via Infotrieve]
  39. Tan, T. L., Kanaar, R., and Wyman, C. (2003) DNA Repair (Amst.) 2, 787–794[Medline] [Order article via Infotrieve]
  40. Conway, A. B., Lynch, T. W., Zhang, Y., Fortin, G. S., Fung, C. W., Symington, L. S., and Rice, P. A. (2004) Nat. Struct. Mol. Biol. 11, 791–796[CrossRef][Medline] [Order article via Infotrieve]
  41. Wu, Y., He, Y., Moya, I. A., Qian, X., and Luo, Y. (2004) Mol. Cell 15, 423–435[CrossRef][Medline] [Order article via Infotrieve]
  42. Wu, Y., Qian, X., He, Y., Moya, I. A., and Luo, Y. (2005) J. Biol. Chem. 280, 722–728[Abstract/Free Full Text]
  43. Story, R. M., and Steitz, T. A. (1992) Nature 355, 374–376[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
I. Sakane, C. Kamataki, Y. Takizawa, M. Nakashima, S. Toki, H. Ichikawa, S. Ikawa, T. Shibata, and H. Kurumizaka
Filament formation and robust strand exchange activities of the rice DMC1A and DMC1B proteins
Nucleic Acids Res., August 1, 2008; 36(13): 4266 - 4276.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. D. Sheridan, X. Yu, R. Roth, J. E. Heuser, M. G. Sehorn, P. Sung, E. H. Egelman, and D. K. Bishop
A comparative analysis of Dmc1 and Rad51 nucleoprotein filaments
Nucleic Acids Res., July 1, 2008; 36(12): 4057 - 4066.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. Hikiba, K. Hirota, W. Kagawa, S. Ikawa, T. Kinebuchi, I. Sakane, Y. Takizawa, S. Yokoyama, B. Mandon-Pepin, A. Nicolas, et al.
Structural and functional analyses of the DMC1-M200V polymorphism found in the human population
Nucleic Acids Res., July 1, 2008; 36(12): 4181 - 4190.
[Abstract] [Full Text] [PDF]