Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M502818200 on May 24, 2005

J. Biol. Chem., Vol. 280, Issue 29, 27013-27021, July 22, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/29/27013    most recent
M502818200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Touroutine, D.
Right arrow Articles by Richmond, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Touroutine, D.
Right arrow Articles by Richmond, J. E.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

acr-16 Encodes an Essential Subunit of the Levamisole-resistant Nicotinic Receptor at the Caenorhabditis elegans Neuromuscular Junction*

Denis Touroutine{ddagger}§, Rebecca M. Fox§, Stephen E. Von Stetina¶, Anna Burdina{ddagger}, David M. Miller, III¶||, and Janet E. Richmond{ddagger}**

From the {ddagger}Department of Biology, University of Illinois, Chicago, Illinois 60607 and the Department of Cell and Developmental Biology, Vanderbilt University, Nashville, Tennessee 37232-8240

Received for publication, March 15, 2005 , and in revised form, May 18, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The Caenorhabditis elegans neuromuscular junction (NMJ) contains three pharmacologically distinct ionotropic receptors: {gamma}-aminobutyric acid receptors, levamisole-sensitive nicotinic receptors, and levamisole-insensitive nicotinic receptors. The subunit compositions of the {gamma}-aminobutyric acid- and levamisole-sensitive receptors have been elucidated, but the levamisole-insensitive acetylcholine receptor is uncharacterized. To determine which of the ~40 putative nicotinic receptor subunit genes in the C. elegans genome encodes the levamisole-resistant receptor, we utilized MAPCeL, a microarray profiling strategy. Of seven nicotinic receptor subunit transcripts found to be enriched in muscle, five encode the levamisole receptor subunits, leaving two candidates for the levamisole-insensitive receptor: acr-8 and acr-16. Electrophysiological analysis of the acr-16 deletion mutant showed that the levamisole-insensitive muscle acetylcholine current was eliminated, whereas deletion of acr-8 had no effect. These data suggest that ACR-16, like its closest vertebrate homolog, the nicotinic receptor {alpha}7-subunit, may form homomeric receptors in vivo. Genetic ablation of both the levamisole-sensitive receptor and acr-16 abolished all cholinergic synaptic currents at the NMJ and severely impaired C. elegans locomotion. Therefore, ACR-16-containing receptors account for all non-levamisole-sensitive nicotinic synaptic signaling at the C. elegans NMJ. The determination of subunit composition for all three C. elegans body wall muscle ionotropic receptors provides a critical foundation for future research at this tractable model synapse.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Nicotinic acetylcholine receptors are a family of highly conserved pentameric channels used extensively in both vertebrate and invertebrate neurotransmission. These receptors have been implicated in memory formation, nociception, and nicotine addiction as well as in various neuronal disorders such as Parkinson disease and epilepsy (1). Most organisms express multiple nicotinic receptor subunits that combine to form receptors with diverse biophysical and pharmacological properties (2), based largely on receptor composition. The molecular mechanisms controlling nicotinic receptor subunit composition, assembly, trafficking, and localization remain to be fully elucidated.

One approach to this question is the application of molecular genetics to the simple organism Caenorhabditis elegans (3, 4). The most experimentally tractable and therefore best studied synapses in C. elegans are the body wall neuromuscular junctions (NMJs)1 (5–7). Individual C. elegans body wall muscles have both cholinergic and GABAergic inputs, which trigger contraction and relaxation, respectively. A single gene (unc-49) encodes the ionotropic GABA receptors present at the C. elegans NMJ (8–10). In contrast, the cholinergic receptors at the NMJ fall into two pharmacologically distinct classes (6). The most extensively studied class is activated by the nematode-specific acetylcholine receptor (AChR) agonist levamisole (4, 11). Through the analysis of levamisole-resistant mutants, the subunit composition of this receptor class has been established. In all, five subunits contribute to the levamisole response, including three essential subunits (UNC-38, UNC-29, and UNC-63) (6, 11, 12) and two nonessential subunits (LEV-1 and LEV-8) (4, 12, 13). Studies of the assembly, trafficking, and localization of C. elegans levamisole-sensitive receptors have provided significant insights into the molecular mechanisms that regulate this receptor (14–18). The second class of nicotinic receptor at the NMJ is levamisole-insensitive, and its subunit composition is unknown. Because this receptor class accounts for a major component of the synaptic response at the C. elegans NMJ, identifying the subunit composition is important for future studies that utilize this accessible model synapse. However, the C. elegans genome contains at least 40 genes that have sequence similarity to nicotinic receptor subunits (19), of which 27 appear to be authentic (20). Therefore, to identify the genes that encode the levamisole-insensitive nicotinic receptor subunits, we adopted a recently developed microarray profiling strategy, MAPCeL (micro-array profiling of C. elegans cells) (21). In summary, the microarray screen identified ACR-16, a nicotinic receptor {alpha}7-like subunit, which we confirmed by electrophysiological and genetic approaches to be an essential subunit of the non-levamisole receptor at the C. elegans NMJ.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Strains
Nematode strains were maintained at 20–25 °C using standard culture methods (3). The strains used in these studies were the wild-type Bristol isolate N2, DP38:unc-119(ed3) III, myo-3::GFP pPD4251- (ccOS4251) I (22), pacr-8::GFP (NC752(wdEx263), NC753(wdEx264)), pacr-16::GFP (NC971(wdEx418), NC972(wdEx419)), ZZ37:unc-63(x37) I, CB407:unc-49(e407) III, RB918:acr-16(ok789) V, and pmyo-3::ACR-16 (SY1023(jaEx1023)). The double mutants SY1024:unc-63(x37);acr-16(ok789), SY1025:unc-49(e407) III;acr-16(ok789) V, and SY1026:unc-63(x37) I;unc-49(e407) III and the triple mutant SY1027:unc-63(x37); unc-49(e407);acr-16(ok789) were generated using standard genetic techniques.

Microarray Analysis of myo-3::GFP-labeled Body Muscle Cells
Detailed descriptions of MAPCeL, including C. elegans cell culture, fluorescence-activated cell sorting (FACS), and the microarray methods used in this work, are provided in Ref. 21. Primary in vitro cultures of C. elegans embryonic cells were established as described previously (23), with the exception that cells were plated on poly-L-lysine-coated surfaces to ease removal for FACS. myo-3::GFP-labeled cells were isolated by FACS after 24 h in culture. Sorting experiments were performed in a FACStar Plus flow cytometer (BD Biosciences). Nonviable cells were excluded by labeling with propidium iodide. Sorting gates were empirically established to achieve ~90% enrichment of myo-3::GFP-labeled muscle cells. 100 ng of RNA from myo-3::GFP cells (micro-RNA isolation kit, Stratagene) was amplified and labeled using the Affymetrix GeneChip eucaryotic small sample target labeling protocol with modifications as described previously (21). The Affymetrix C. elegans GeneChip array was hybridized with 15 µg of labeled mRNA. myo-3::GFP cells were profiled in triplicate. Reference microarray data were obtained from four independent experiments with 24-h cultures of all embryonic cells (from the wild type, N2) after sorting to exclude nonviable cells. Affymetrix hybridization signals were scaled in comparison with a global average value (24). To detect enriched mRNAs, intensity values were normalized by RMA (robust multi-array) analysis and statistically analyzed using SAM (significance analysis of microarrays) software (Stanford University). Muscle enriched AChR subunit transcripts are defined as AChR genes that are ≥1.7-fold elevated versus average expression in all cells at a false discovery rate of ≤1.2%. A comprehensive analysis of the muscle microarray data will be described elsewhere.2

GFP Reporters and Transgenic Animals
pacr-8::GFP—A region 2460 bp upstream of the ATG start site was generated by PCR using with primers acr-8p1 (5'-AAGCTTTGTCAGTCTCTACGATTAC-3') and acr-8p2 (5'-GGATCCGATGAAGCTGGAGTGAGAAG-3'). The acr-8 PCR fragment and an unc-119 minigene (from plasmid pPD#MM051) (25) were subcloned into the GFP vector pPD95.75 to produce vector acr-8::GFP-unc-119. Four independent acr-8::GFP transgenic lines were generated by microparticle bombardment with the acr-8::GFP-unc-119 plasmid into unc-119(ed3) animals.

pacr-16::GFP—GFP reporters were generated using overlap PCR (26). The primers used for amplification of the GFP fragment have been described by Hobert (26). A region extending from 3000 bp upstream of the acr-16 start site to 24 bp into exon 1 was PCR-amplified with primers acr-16p1 (5'-CACCCTTGTGTGTCTGTGAAG-3') and acr-16p3GFP (5'-AGTCGACCTGCAGGCATGCAAGCTTGCGCACGAGATGAGAAG-3'). 15 µl of PCR product was co-injected with 25 ng/µl plasmid pRF4 (rol-6). Five independent lines of acr-16::GFP were generated.

Microscopy
Images of GFP reporter expression were obtained using a Zeiss LSM 510 META confocal microscope. Cultured embryonic cells were photographed using a Zeiss Axiovert inverted microscope.

Tissue-specific Rescue
For Pmyo-3::acr-16 genomic DNA fusion, PCR was used to isolate the genomic version of acr-16. The sequence of the 5'-end PCR primer was aggatccATTCTCATGTCCGTATGTCTG, and the sequence of the 3'-end PCR primer was aggtaccCATTAGGCGACAAGATACGGTG. BamHI and KpnI sites were introduced into the 5'- and 3'-end primers, respectively, for subsequent cloning. The PCR product was cloned into pPD96.52 downstream of the myo-3 promoter. The final product was purified using a QIAprep spin mini prep kit and injected into the gonads of acr-16(ok789) mutants at a concentration of 5 µg/ml along with pmyo-3::GFP (20 µg/ml) as a co-injection marker. Five independent lines were generated. Rescue of the ACR-16 body wall muscle cholinergic response was assessed electrophysiologically.

Deletion Mutants
Break points in acr-8(ok1240) were identified using the following primer pair: CACCAGGCAAGTTGAGTGAA and ACTCAGCCAACATCGTTTCC. The same primers were used for sequencing. Break points in acr-16(ok789) after a 2x outcross, identified by the C. elegans Gene Knockout Consortium, were confirmed using the following primer pair: CAACTGGCTTGGTGCATTGG and TGTCATGTCGAGACCGGTTA. PCR products were cloned and sequenced with the same primer pairs at the University of Illinois Sequencing Facility.

Behavioral Analysis
Behavioral assays were conducted on N2 and the acr-16(ok789), unc-63(x13), and unc-63(x13);acr-16(ok789) mutants. Thrashing behavior (27) for individual worms placed in M9 medium was measured as the number of head thrashes/min averaged over a 5-min period. Locomotion was scored for individual worms placed on an agar plate without a bacterial lawn and allowed to acclimatize for 1 min. The subsequent body bends were counted for the following minute. Head tap assays were also performed on worms acclimatized for 5 min on agar plates lacking bacterial lawns. An eyelash was used to gently tap the worm on the head, and the total number of elicited body bends was counted. Worms were filmed to ensure accurate scoring of body bends. A body bend is described as the movement in which the head of the worm completes a full sinusoid.

Electrophysiology
Body wall muscle recordings were obtained from dissected worms as described previously (6). Briefly, worms were immobilized using a cyanoacrylic glue, and the cuticle was cut open longitudinally, exposing body wall muscles that were treated with collagenase to remove the basement membrane. Anterior ventral medial muscles were whole cell voltage-clamped at a holding potential of -60 mV using an EPC-10 amplifier (HEKA Instruments Inc.). The extracellular solution consisted of 150 mM NaCl, 5 mM KCl, 5 mM CaCl2, 1 mM MgCl2, 10 mM glucose, 5 mM sucrose, and mM 15 HEPES (pH 7.3; ~330 mosM). The patch pipette was filled with 120 mM KCl, 20 mM KOH, 4 mM MgCl2, 5 mM TES, 0.25 mM CaCl2, 4 mM Na2ATP, 36 mM sucrose, and 5 mM EGTA (pH 7.2; ~315 mosM). Ligand applications (acetylcholine (ACh) and levamisole) were applied to voltage-clamped muscles via a pressure-ejection electrode. Evoked synaptic responses were obtained by depolarizing the ventral nerve cord using a stimulating electrode placed anterior to the body wall muscle as described previously (28). Subsequent analysis was carried out using Pulsefit (HEKA Instruments Inc.) and Mini Analysis (Synaptosoft, Inc.) and graphed using IGOR Pro (Wavemetrics, Inc.). All statistically derived values obtained using In-Stat (GraphPad Software) are given as means ± S.E.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Microarray Experiments Identify Muscle Nicotinic AChR Subunit Genes—We used a new microarray technology, MAP-CeL (21), to identify nicotinic receptor subunits preferentially expressed in body wall muscles. Muscle cells, labeled with the myo-3::GFP reporter gene, were obtained from in vitro cultures of C. elegans embryonic cells (Fig. 1). We have shown previously that myo-3::GFP cells differentiate in culture, display a spindle-shaped morphology resembling the body wall muscle cells in vivo, express muscle-specific genes, and exhibit largely normal physiological properties (23). In culture, myo-3::GFP cells constitute ~15% of all cells, which is comparable with their frequency in vivo (81 body muscle cells/550 total embryonic cells = 15%) (23). We used FACS to enrich myo-3::GFP cells to ~90% (Fig. 2). mRNAs from these cells were amplified, labeled, and hybridized to the C. elegans Affymetrix GeneChip array. To identify the subset of genes specifically enriched in body muscle cells, we compared these results with microarray data obtained from all embryonic cells. A total of 945 genes from cultured myo-3::GFP cells were detected at or above a threshold of 1.7-fold enrichment versus an average expression level in all cells.2 Here, we focused on the nicotinic AChR subunit genes in the muscle enriched data set. As shown in Table I, we detected transcripts encoding all five of the known components of the levamisole-sensitive AChR, i.e. unc-29, unc-38, unc-63, lev-1, and lev-8. Two additional transcripts, acr-8 and acr-16, were also enriched.


View this table:
[in this window]
[in a new window]
  		TABLE I
Summary of the seven nicotinic receptor subunits identified by MAPCeL

 



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 1.
Muscle profiling strategy. Intact embryos are released from synchronized populations of adult myo-3::GFP hermaphrodites by treatment with hypochlorite solution. Eggshells are degraded by chitinase treatment, and embryos are dissociated by filtration. The resultant blastomeres are cultured in vitro for 24 h. myo-3::GFP muscle cells are enriched by FACS. RNA is isolated for application to the C. elegans Affymetrix GeneChip array.

 



View larger version (50K):
[in this window]
[in a new window]
  		FIG. 2.
FACS isolation of GFP-labeled body wall muscle cells. A, shown is a fluorescence scatter plot of wild-type (non-GFP) cells. Propidium iodide (PI)-labeled cells are shown in red. The sorting gate in the lower right-hand corner excludes autofluorescent gut cells in the GFP channel. B, shown is a fluorescence scatter plot of cultured cells from myo-3::GFP embryos. Note the abundant GFP-labeled cells (green). C, GFP-positive cells were also gated within the circumscribed area (purple) to exclude large cell clumps and small debris. D, embryonic cells are shown after 24 h in culture and prior to FACS. E, myo-3::GFP cells in culture (~15%) were enriched to ~90% after sorting. Scale bars = 5 µm.

 
To confirm expression of ACR-8 and ACR-16 in body wall muscles, we generated transgenic lines with acr-8::GFP and acr-16::GFP fusions. In both cases, we detected GFP signals in body wall muscles (Fig. 3). acr-8::GFP was strongly expressed in all body muscle cells as well as in anal and vulval muscles and ventral cord motor neurons (Fig. 3A). acr-16::GFP was detected in all body wall muscle cells (but not vulval or anal muscles) and was also present in a subset of neurons, notably the DB motor neurons in the ventral nerve cord (Fig. 3, B and C). Expression of both acr-8::GFP and acr-16::GFP was visible in the embryo.

The AChR {alpha}7-Like Subunit ACR-16 Is Expressed in Body Wall Muscle and Contributes to the Synaptic Response—Based on the microarray data and expression patterns, we considered ACR-8 and ACR-16 to be potential subunits of the body wall muscle AChRs. To determine whether either of these subunits contributes to the levamisole-insensitive channel, we obtained deletion mutants of acr-8(ok1240) and acr-16(ok789) from the C. elegans Gene Knockout Consortium. The deletion break points and predicted protein disruption of acr-8(ok1240) and acr-16(ok789) are shown in Fig. 4.



View larger version (51K):
[in this window]
[in a new window]
  		FIG. 3.
GFP reporters for acr-8 and acr-16 are expressed in body wall muscle cells. A, head region showing acr-8::GFP expression in body muscle cells. B, combined differential interference contrast and GFP images of acr-16::GFP expression in body muscle cells. The spiral disposition of the body muscle cells is due to the Rol-6 transgenic marker. C, ventral view of the midbody region. acr-16::GFP was expressed in body muscles and in DB motor neurons (arrowheads) in the ventral nerve cord. All images are confocal projections. Scale bars = 10 µm.

 
To establish whether ACR-8 or ACR-16 contributes to the ACh response of the body wall muscles, we compared the ACh (5 x 10-4 M) response amplitudes of voltage-clamped body wall muscles in acr-8 and acr-16 mutants with that in the wild type. acr-8(ok1240) mutants exhibited wild-type responses to ACh (Fig. 5A). In contrast, the ACh response of acr-16(ok789) was reduced by 85% compared with that of the wild type (284 ± 29 pA (n = 9) for acr-16(ok789) versus 1898 ± 206 pA (n = 7) for N2; p < 0.0001) (Fig. 5A). To examine whether the levamisole receptors were affected in acr-16(ok789) mutants, we recorded muscle levamisole responses. Levamisole-induced currents in acr-16(ok789) mutants were, however, indistinguishable from those in the wild type (Fig. 5B). This result suggests that ACR-16 is a required component of the levamisole-insensitive AChR in the ventral body wall muscles. Because acr-8(ok1240) mutants showed no reduction in either ACh or levamisole responses, ACR-8 is unlikely to contribute to either of the two electrophysiologically identified AChR classes in body muscle.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 4.
acr-16 and acr-8 encode predicted ionotropic receptor subunits. A and C, genomic organization of acr-16 and acr-8, respectively. Shaded boxes represent predicted coding regions. Open boxes represent deleted regions in acr-16(ok789) and acr-8(ok1240). Predicted protein structures of ACR-16 (B) and ACR-8 (D). TM1–TM4 represent the four transmembrane domains, the open boxes indicate the deleted regions in the acr-16(ok789) mutant (amino acids 165–329) (B) and the acr-8(ok1240) mutant (an early stop codon at amino acid 152) (D).

 
To determine the extent to which ACR-16 contributes to the synaptic response at the NMJ, we recorded evoked responses in acr-16(ok789) mutants. The evoked response was reduced by 83% in acr-16(ok789) mutants compared with wild-type worms (Fig. 6A), indicating that ACR-16 is present at postsynaptic sites and contributes to the synaptic response of the body wall muscles.

To confirm that the defects observed in acr-16(ok789) mutants are specifically due to loss of ACR-16 in body wall muscles, we expressed acr-16 genomic DNA fused to the muscle-specific promoter Pmyo-3 along with a Pmyo-3::GFP co-injection marker in acr-16(ok789) mutants. Transgenic lines were generated in which the expression of ACR-16 and the GFP co-injection marker was mosaic. Muscle cells that inherited the acr-16 rescuing construct could then be detected as GFP-positive cells. GFP-fluorescing muscles exhibited robust responses to both pressure-ejected ACh (Fig. 6B, right trace) and evoked stimulation (Fig. 6C, right trace), whereas non-fluorescing cells showed responses typical of acr-16(ok789) mutants (Fig. 6, B and C, left traces). These data indicate that the reduced muscle ACh and evoked responses of acr-16(ok789) mutants are due to the deletion of the acr-16 gene locus in muscles and rule out the possibility that a background mutation in the acr-16(ok789) strain produced the electrophysiological phenotype.

ACR-16 Is an Essential Subunit of the Body Wall Muscle Levamisole-resistant Nicotinic AChR—The ACh and levamisole current amplitudes of acr-16(ok789) mutants are very similar (285 ± 25 pA (n = 10) for ACh versus 243 ± 35 pA (n = 6) for levamisole), suggesting that, in acr-16 mutants, only the levamisole-sensitive receptors are still functional. To test this hypothesis, we generated unc-63(x37);acr-16(ok789) double mutants. unc-63 encodes an essential {alpha}-subunit of the levamisole-sensitive receptor; we have shown previously that the levamisole response is abolished in unc-63(x37) mutants (12). The muscle ACh current in unc-63(x37);acr-16(ok789) double mutants was eliminated (Fig. 7A). Therefore, we can conclude that the nicotinic receptors on body wall muscle activated by pressure-ejected ACh contain either UNC-63 (levamisole-sensitive) or ACR-16 (levamisole-insensitive) subunits. Thus, unc-63(x37) and acr-16(ok789) mutants can be used to genetically isolate the two muscle AChR subtypes. We have shown previously that, in the absence of levamisole-sensitive AChRs, desensitization of the remaining muscle ACh response is faster, suggesting that the two receptor subtypes have different kinetic properties (12). We confirmed this observation by examining the rates of desensitization to 1-s ACh pulses in unc-63(x37) and acr-16(ok789) mutant muscles. The levamisole-sensitive receptors present in acr-16(ok789) mutants were shown to desensitize at a much slower rate than the levamisole-insensitive receptors present in unc-63 mutants (Fig. 7B). Together, these data indicate that the two muscle receptor subtypes have different subunit compositions, pharmacology, and kinetics.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 5.
acr-16(ok789) mutants reduce levamisole-resistant muscle ACh responses. A, the representative current traces of voltage-clamped body wall muscle ACh responses (100-ms pulses of 5 x 10-4 M ACh) demonstrate that acr-16(ok789) mutants, but not acr-8(ok1240) mutants, reduced ACh current amplitudes compared with the wild type (WT). Plots of the average ACh current amplitude of acr-16(ok789) mutants demonstrate a reduction of ~85% in current amplitude compared with the wild type (n = 10 for acr-16 and n = 10 for the wild type (p < 0.0001) and n = 3 for acr-8(ok1240)). B, shown are the responses to 100-ms pulses of 5 x 10-4 M levamisole (Lev). Levamisole current amplitudes were unaffected in acr-8(ok1240) and acr-16(ok789) mutants. ***, p ≤ 0.0002.

 



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 6.
Cholinergic synaptic activity reduced in acr-16(ok789) is rescued by muscle-specific expression of ACR-16. A, the evoked synaptic current elicited in voltage-clamped muscle cells by ventral nerve cord depolarization was reduced in acr-16(ok789) mutants by 83% as shown in representative traces and average evoked amplitudes (n = 4 for acr-16 and n = 10 for the wild type (WT); p = 0.0005). B and C, transgenic lines expressing ACR-16 under the control of the muscle-specific myo-3 promoter rescued the responses to both pressure-ejected ACh (5 x 10-4 M) (n = 10 for acr-16 and n = 5 for Pmyo-3::acr-16; p < 0.0001) and evoked release (n = 4 for acr-16 and n = 4 for Pmyo-3::acr-16; ***, p = 0.0001), respectively.

 



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 7.
Exogenous ACh responses are eliminated in unc-63;acr-16 double mutants. Levamisole-insensitive receptor currents exhibited faster desensitization than levamisole-sensitive receptor currents. A, the representative voltage-clamped muscle recordings demonstrate that the residual inward current elicited by 100-ms applications of ACh (5 x 10-4 M) in acr-16 mutants was abolished in unc-63(x37);acr-16(ok789) double mutants. The average current amplitudes are plotted in the bar graph (n = 10 for the wild type (WT), n = 10 for acr-16(ok789), n = 4 for unc-63(x37);acr-16(ok789); acr-16(ok789) versus unc63(x37);acr-16(ok789); ***, p < 0.0001). B, shown are the current responses to 1-s applications of 5 x 10-4 M ACh in acr-16(ok789) versus unc-63(x37) mutants. The bar graphs represent the average current amplitude remaining after 1 s of exposure to ACh expressed as a percentage of the peak current amplitude (n = 3 for acr-16(ok789) and n = 3 for unc-63(x37); ***, p < 0.0001).

 
Exogenous ACh application allowed us to define two classes of nicotinic receptors on the muscle membrane. This analysis did not address whether these two receptors account for all cholinergic synaptic current at the NMJ. To specifically examine the post-synaptic nicotinic receptors, we needed to first isolate the cholinergic synaptic responses from GABAergic synaptic events also present at the C. elegans NMJ. We have shown previously that all GABAergic synaptic currents at the NMJ are eliminated in the GABA receptor null mutant unc-49(e407) (6). Furthermore, in unc-49(e407) mutants, all remaining synaptic activity is blocked by the nicotinic receptor antagonist D-tubocurare and is therefore likely to be cholinergic. To examine the contribution of ACR-16-dependent receptors to cholinergic synaptic activity, we generated unc-49(e407);acr-16(ok789) double mutants. unc-49(e407);acr-16(ok789) mutants exhibited prominent reductions in both endogenous and evoked cholinergic transmission at the NMJ (Fig. 8) compared with unc-49(e407) single mutants. We also examined the impact of removing the levamisole-sensitive receptors by making unc-63(x37);unc-49(e407) double mutants. The evoked and endogenous responses were not significantly reduced in unc-63(x37);unc-49(e407) double mutants (Fig. 8) compared with unc-49(e407) alone. To examine whether all cholinergic synaptic activity could be eliminated in the absence of both nicotinic receptor types, we generated unc-63(x37);unc-49(e407); acr-16(ok789) triple mutants. The endogenous miniature synaptic currents and evoked responses were completely abolished in unc-63(x37); unc-49(e407);acr-16(ok789) triple mutants (Fig. 8). Thus, we conclude that, in combination with UNC-63-containing receptors, ACR-16-containing receptors account for all cholinergic ionotropic synaptic responses in these muscles.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 8.
Cholinergic synaptic currents are eliminated in unc-63(x37);acr-16(ok789) double mutants. A and B, shown are the representative endogenous miniature cholinergic synaptic events and the representative evoked cholinergic responses at the NMJs of unc-63(x37), acr-16(ok789), and unc-63(x37);acr-16(ok789) all in the GABA receptor null mutant background unc-49(e407), respectively. C, the frequency of cholinergic miniature synaptic events was not significantly reduced in unc-63(x37);unc-49(e407) double mutants (n = 11), but was reduced by 76% in unc-49(e407);acr-16(ok789) double mutants (n = 9) compared with unc-49(e407) alone (n = 4; ***, p = 0.004) and was eliminated in unc-63(x37);unc-49(e407);acr-16(ok789) triple mutants (n = 3; ***, p < 0.0001). D, the average evoked cholinergic currents were not significantly reduced in unc-63(x37);unc-49(e407) double mutants (n = 5) compared with unc-49(e407) mutants (n = 3). unc-49(e407);acr-16(ok789) double mutants (n = 4) were reduced by 88% compared with unc-49(e407) alone (***, p < 0.0001), and evoked release was abolished in unc-63(x37); unc-49(e407);acr-16(ok789) triple mutants (n = 3; ***, p = 0.0002).

 
These data suggest that both levamisole-sensitive and levamisole-insensitive receptors contribute to the excitability of body wall muscles in C. elegans. Therefore, we predict that unc-63(x37);acr-16(ok789) double mutants would have a more severe locomotory defect than the two single mutants. Several behavioral assays were conducted to test this prediction. In all assays, unc-63(x37);acr-16(ok789) double mutants exhibited more severe locomotory defects than unc-63(x37) mutants alone (Fig. 9), demonstrating that both receptors contribute to C. elegans locomotion.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Using a newly designed microarray profiling strategy (MAP-CeL) combined with reverse genetics and in situ electrophysiological analysis, we have identified and characterized ACR-16 as an essential subunit of the levamisole-insensitive nicotinic receptor at the C. elegans NMJ. This study highlights the utility of microarray profiling to identify novel genes of interest in C. elegans. In this study, genetic ablation of acr-16 produced no overt behavioral phenotype (Fig. 9). This observation explains why acr-16 mutants have not been isolated in previous genetic screens that selected for uncoordinated or pharmacological phenotypes. By selectively profiling body muscle cells, we narrowed our search for components of the levamisole-insensitive receptor from ~40 potential subunit genes to only two candidates, acr-8 and acr-16. The acr-8 deletion had no affect on either the levamisole-sensitive or levamisole-insensitive components of the muscle ACh response. Therefore, we ruled out ACR-8 as an essential subunit of either nicotinic receptor class in the ventral body wall muscles assayed in this study. Examination of the pore-forming M2 domain of ACR-8 in which a highly conserved glutamic acid is replaced by histidine suggested that this subunit may actually contribute to an anion-selective channel of yet unknown function (20). This finding left only one remaining candidate, ACR-16, which we have now demonstrated is an essential subunit of the body wall muscle levamisole-insensitive AChR. With the identification of acr-16, we can genetically ablate any of the three neurotransmitter receptor components that contribute to the synaptic readout at the NMJ. Thus, we can now study the physiology and regulation of each receptor class in isolation.

Our finding that ACR-16 is the only muscle enriched subunit that is required for levamisole-insensitive nicotinic responses leads to the possibility that ACR-16 assembles into a homomeric receptor in C. elegans body wall muscles. ACR-16 is an {alpha}-subunit with 47% homology to the vertebrate nicotinic receptor {alpha}7-subunit (29). The vertebrate {alpha}7-subunit is capable of forming functional homomeric nicotinic receptors in several cells, including Xenopus oocytes, PC12 cells, and rat brain (30–32). Similarly, ACR-16 (previously termed Ce21) has been shown to form functional nicotinic receptors when expressed in Xenopus oocytes (29). By identifying ACR-16 as an essential subunit of the body wall muscle levamisole-insensitive receptor, we are now able to directly compare previous heterologous expression data with those of the native ACR-16-containing receptor. The pharmacological profile of heterologously expressed ACR-16 receptors closely resembles that of the native receptor in situ. Specifically, both heterologously expressed and native ACR-16-dependent receptors are activated by nicotine and ACh, but not levamisole, and maximal responses to nicotine are smaller than those to ACh (in situ data not shown), suggesting that nicotine acts as a partial agonist of ACR-16 receptors. Furthermore, both the heterologously expressed and native ACR-16-dependent ACh responses are potently inhibited by dihydro-{beta}-erythroidine (6, 29). Although we cannot fully exclude the possibility that other subunits contribute to the native ACR-16-containing receptor, the present data suggest that ACR-16 may function as a homomeric nicotinic receptor {alpha}7-like subunit in the C. elegans body wall muscles.



View larger version (48K):
[in this window]
[in a new window]
  		FIG. 9.
acr-16(ok789) exacerbates the behavioral deficits of unc-63(x37) mutants. A, representative frames from movies used to measure the number of reversed body bends to head taps of the wild type and acr-16(ok789), unc-63(x37), and unc-63(x37);acr-16(ok789) mutants. The upper panels show the eyelash tapping the head of the worm. The lower panels show the extent of backward motion away from the starting point (marked by asterisks) after 5 s, at which time backward motion was complete. B–D, behavioral parameters measured for the four genotypes. B, average thrashing rate in M9 medium; C, average body bends during locomotion off food; D, average body bends elicited by head tapping. *, p < 0.025; ***, p ≤ 0.0002.

 
Vertebrate {alpha}7-subunit-containing nicotinic receptors are present in diverse areas of the human brain (33) and are involved in higher cognitive functions, including learning and memory (34–36). Alterations in {alpha}7-subunit-containing nicotinic receptor signaling have been linked to several neuropathologies, including Parkinson disease and epilepsy (1) and Alzheimer disease (37). {alpha}7-Subunit-containing nicotinic receptors are localized presynaptically and postsynaptically (38, 39) in a variety of synapses, yet the molecular mechanisms responsible for this targeted expression remain to be elucidated. Agonist-dependent trafficking of these receptors appears to be regulated by several pathways both on a short time scale via SNARE (soluble NSF attachment protein receptor) protein-mediated endocytosis (40) and on longer time scales (41, 42). By identifying a homologous receptor in C. elegans, it is anticipated that mutations that disrupt the localization and trafficking of ACR-16 will provide insights into the regulation of vertebrate nicotinic receptors, including the {alpha}7-subunit-containing receptors.

ACR-16-dependent receptors account for 85% of both the muscle exogenous ACh response and the evoked response elicited by ventral nerve cord stimulation. Surprisingly, acr-16 null mutants show no obvious behavioral phenotype. This is in contrast to mutants of the levamisole-sensitive receptor subunits, unc-29, unc-38, and unc-63, which exhibit defective locomotion and exaggerated body bends. Because the double mutants have a more severe locomotory phenotype than either unc-63 or acr-16 alone, we can conclude that both receptor subtypes contribute to neuromuscular transmission. However, these data establish that the levamisole-sensitive receptors play a greater functional role in locomotion. The predominant role of the levamisole-sensitive receptor in locomotion could reflect the observed differences in desensitization rates of the levamisole-sensitive receptor (slower) compared with the ACR-16-dependent receptor (faster). This difference may enable levamisole-sensitive receptors to be more efficiently coupled to the excitation-contraction machinery downstream of AChR activation. For example, the levamisole-sensitive receptors may be more effective in activating voltage-gated calcium channels or releasing calcium from intracellular stores.

Although cholinergic synaptic activity is eliminated at the NMJs of unc-63(x37);acr-16(ok789) double mutants, these worms exhibit residual movement as seen in thrashing assays and locomotion off food. This suggests that some muscle contraction persists in the absence of nicotinic responses. The source of this excitatory input has yet to be identified and could reflect muscarinic, peptidergic, co-transmitter signaling, or myogenic activity.

In summary, we have relied upon microarray results derived from body muscle cells to demonstrate that ACR-16 is a subunit of the levamisole-insensitive nicotinic receptor that functions at C. elegans NMJs. We have shown that genetic ablation of this subunit abolishes the non-levamisole cholinergic response in body wall muscles. The identification of this receptor subunit provides new avenues of exploration for the differential trafficking and regulation of two distinctly targeted nicotinic receptors within the same muscle cells in a genetically tractable organism.


   FOOTNOTES
 
* This work was supported by National Institutes of Health Grants R01 NS26115 and P01 DK58212 (to D. M. M.), F31 NS046923 (to R. M. F.), F31 NS043068 (to S. E. V.), R01 NS41477 (to J. E. R.), P30 CA68485, P60 DK20593, P30 DK58404, HD15052, P30 EY08126, and Grant 1 P01 HL6744-01. Additional support for microarray experiments was provided by DK58749 (to A. L. George). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§ Both authors contributed equally to this work. Back

|| To whom correspondence concerning the microarray profiling should be addressed. Tel.: 615-343-3447; E-mail: david.miller{at}vanderbilt.edu. ** To whom all other correspondence should be addressed: Dept. of Biology, Bldg. SEL, Rm. 4311, University of Illinois, 840 W. Taylor St., Chicago, IL 60607. Tel.: 312-413-2513; Fax: 312-996-2805; E-mail: jer{at}uic.edu.

1 The abbreviations used are: NMJs, neuromuscular junctions; GABA, {gamma}-aminobutyric acid; AChR, acetylcholine receptor; GFP, green fluorescent protein; FACS, fluorescence-activated cell sorting; TES, N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic acid; ACh, acetylcholine. Back

2 R. M. Fox, S. E. Von Stetina, K. L. Olszewski, J. McDermott, T. Brodigan, W. C. Spencer, M. Krause, D. M. Miller III, manuscript in preparation. Back


   ACKNOWLEDGMENTS
 
We thank Cathy Alford and Jim Price (Vanderbilt University Flow Cytometry Special Resource Center) and Susan Barlow for generating the N2 reference data set, Kathie Watkins for microinjecting the acr-16::GFP construct, David Pilgrim for providing plasmid pPD#MM051, Andy Fire for providing GFP expression vectors pPD95.75 and pPD96.52, and Millet Treinin and members of the Miller laboratory for comments on the manuscript. We thank the C. elegans Gene Knockout Consortium for providing the acr-16(ok789) and acr-8(ok1240) deletion mutants.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Gotti, C., and Clementi, F. (2004) Prog. Neurobiol. 74, 363-396[CrossRef][Medline] [Order article via Infotrieve]
  2. Millar, N. S. (2003) Biochem. Soc. Trans. 31, 869-874[CrossRef][Medline] [Order article via Infotrieve]
  3. Brenner, S. (1974) Genetics 77, 71-94[Abstract/Free Full Text]
  4. Lewis, J. A., Wu, C. H., Berg, H., and Levine, J. H. (1980) Genetics 95, 905-928[Abstract/Free Full Text]
  5. Jorgensen, E. M., and Nonet, M. L. (1995) Semin. Dev. Biol. 6, 207-220
  6. Richmond, J. E., and Jorgensen, E. M. (1999) Nat. Neurosci. 2, 791-797[CrossRef][Medline] [Order article via Infotrieve]
  7. Francis, M. M., Mellem, J. E., and Maricq, A. V. (2003) Trends Neurosci. 26, 90-99[CrossRef][Medline] [Order article via Infotrieve]
  8. Bamber, B. A., Beg, A. A., Twyman, R. E., and Jorgensen, E. M. (1999) J. Neurosci. 19, 5348-5359[Abstract/Free Full Text]
  9. Bamber, B. A., Twyman, R. E., and Jorgensen, E. M. (2003) Br. J. Pharmacol. 138, 883[CrossRef][Medline] [Order article via Infotrieve]
  10. Bamber, B. A., Richmond, J. E., Otto, J. F., and Jorgensen, E. M. (2005) Br. J. Pharmacol., 144, 502-509[Medline] [Order article via Infotrieve]
  11. Fleming, J. T., Squire, M. D., Barnes, T. M., Tornoe, C., Matsuda, K., Ahnn, J., Fire, A., Sulston, J. E., Barnard, E. A., Sattelle, D. B., and Lewis, J. A. (1997) J. Neurosci. 17, 5843-5857[Abstract/Free Full Text]
  12. Culetto, E., Baylis, H. A., Richmond, J. E., Jones, A. K., Fleming, J. T., Squire, M. D., Lewis, J. A., and Sattelle, D. B. (2004) J. Biol. Chem. 279, 42476-42483[Abstract/Free Full Text]
  13. Towers, P. R., Edwards, B., Richmond, J. E., and Sattelle, D. B. (2005) J. Neurochem. 93, 1-9[CrossRef][Medline] [Order article via Infotrieve]
  14. Kim, J., Poole, D. S., Waggoner, L. E., Kempf, A., Ramirez, D. S., Treschow, P. A., and Schafer, W. R. (2001) Genetics 157, 1599-1610[Abstract/Free Full Text]
  15. Waggoner, L. E., Dickinson, K. A., Poole, D. S., Tabuse, Y., Miwa, J., and Schafer, W. R. (2000) J. Neurosci. 20, 8802-8811[Abstract/Free Full Text]
  16. Schafer, W. R. (2002) J. Neurobiol. 53, 535-541[CrossRef][Medline] [Order article via Infotrieve]
  17. Halevi, S., McKay, J., Palfreyman, M., Yassin, L., Eshel, M., Jorgensen, E., and Treinin, M. (2002) EMBO J. 21, 1012-1020[CrossRef][Medline] [Order article via Infotrieve]
  18. Gally, C., Eimer, S., Richmond, J. E., and Bessereau, J. L. (2004) Nature 431, 578-582[CrossRef][Medline] [Order article via Infotrieve]
  19. Bargmann, C. I. (1998) Science 282, 2028-2033[Abstract/Free Full Text]
  20. Mongan, N. P., Baylis, H. A., Adcock, C., Smith, G. R., Sansom, M. S., and Sattelle, D. B. (1998) Receptors Channels 6, 213-228[Medline] [Order article via Infotrieve]
  21. Fox, R. M., Von Stetina, S. E., Barlow, S. J., Shaffer, C., Olszewski, K. L., Moore, J. H., Dupuy, D., Vidal, M., and Miller, D. M., III (2005) BMC Genomics 2005, 6: 42[CrossRef][Medline] [Order article via Infotrieve]
  22. Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C. (1998) Nature 391, 806-811[CrossRef][Medline] [Order article via Infotrieve]
  23. Christensen, M., Estevez, A., Yin, X., Fox, R., Morrison, R., McDonnell, M., Gleason, C., Miller, D. M., III, and Strange, K. (2002) Neuron 33, 503-514[CrossRef][Medline] [Order article via Infotrieve]
  24. Hill, A. A., Brown, E. L., Whitley, M. Z., Tucker-Kellogg, G., Hunter, C. P., and Slonim, D. K. (2001) Genome Biology http://genomebiology.com/2001/2/12/research/0055
  25. Maduro, M., and Pilgrim, D. (1995) Genetics 141, 977-988[Abstract]
  26. Hobert, O. (2002) BioTechniques 32, 728-730[Medline] [Order article via Infotrieve]
  27. Miller, K. G., Alfonso, A., Nguyen, M., Crowell, J. A., Johnson, C. D., and Rand, J. B. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 12593-12598[Abstract/Free Full Text]
  28. Richmond, J. E., Davis, W. S., and Jorgensen, E. M. (1999) Nat. Neurosci. 2, 959-964[CrossRef][Medline] [Order article via Infotrieve]
  29. Ballivet, M., Alliod, C., Bertrand, S., and Bertrand, D. (1996) J. Mol. Biol. 258, 261-269[CrossRef][Medline] [Order article via Infotrieve]
  30. Couturier, S., Bertrand, D., Matter, J. M., Hernandez, M. C., Bertrand, S., Millar, N., Valera, S., Barkas, T., and Ballivet, M. (1990) Neuron 5, 847-856[CrossRef][Medline] [Order article via Infotrieve]
  31. Seguela, P., Wadiche, J., Dineley-Miller, K., Dani, J. A., and Patrick, J. W. (1993) J. Neurosci. 13, 596-604[Abstract]
  32. Drisdel, R. C., and Green, W. N. (2000) J. Neurosci. 20, 133-139[Abstract/Free Full Text]
  33. Dominguez del Toro, E., Juiz, J. M., Peng, X., Lindstrom, J., and Criado, M. (1994) J. Comp. Neurol. 349, 325-342[CrossRef][Medline] [Order article via Infotrieve]
  34. Broide, R. S., and Leslie, F. M. (1999) Mol. Neurobiol. 20, 1-16[Medline] [Order article via Infotrieve]
  35. Levin, E. D. (2002) J. Neurobiol. 53, 633-640[CrossRef][Medline] [Order article via Infotrieve]
  36. Drago, J., McColl, C. D., Horne, M. K., Finkelstein, D. I., and Ross, S. A. (2003) CMLS Cell. Mol. Life Sci. 60, 1267-1280
  37. Chu, L. W., Ma, E. S., Lam, K. K., Chan, M. F., and Lee, D. H. (2005) Dement. Geriatr. Cogn. Disord. 19, 106-112[Medline] [Order article via Infotrieve]
  38. Fabian-Fine, R., Skehel, P., Errington, M. L., Davies, H. A., Sher, E., Stewart, M. G., and Fine, A. (2001) J. Neurosci. 21, 7993-8003[Abstract/Free Full Text]
  39. Levy, R. B., and Aoki, C. (2002) J. Neurosci. 22, 5001-5015[Abstract/Free Full Text]
  40. Liu, Z., Tearle, A. W., Nai, Q., and Berg, D. K. (2005) J. Neurosci. 25, 1159-1168[Abstract/Free Full Text]
  41. Messing, A. (1982) Brain Res. 232, 479-484[CrossRef][Medline] [Order article via Infotrieve]
  42. Stollberg, J., and Berg, D. K. (1987) J. Neurosci. 7, 1809-1815[Abstract]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Proc. Natl. Acad. Sci. USAHome page
Q. Liu, G. Hollopeter, and E. M. Jorgensen
Graded synaptic transmission at the Caenorhabditis elegans neuromuscular junction
PNAS, June 30, 2009; 106(26): 10823 - 10828.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
Y. Biala, J. F. Liewald, H. C. Ben-Ami, A. Gottschalk, and M. Treinin
The Conserved RIC-3 Coiled-Coil Domain Mediates Receptor-specific Interactions with Nicotinic Acetylcholine Receptors
Mol. Biol. Cell, March 1, 2009; 20(5): 1419 - 1427.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. A. Margeta, G. J. Wang, and K. Shen
Clathrin adaptor AP-1 complex excludes multiple postsynaptic receptors from axons in C. elegans
PNAS, February 3, 2009; 106(5): 1632 - 1637.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
T. Boulin, M. Gielen, J. E. Richmond, D. C. Williams, P. Paoletti, and J.-L. Bessereau
Eight genes are required for functional reconstitution of the Caenorhabditis elegans levamisole-sensitive acetylcholine receptor
PNAS, November 25, 2008; 105(47): 18590 - 18595.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
E. O. Gracheva, A. O. Burdina, D. Touroutine, M. Berthelot-Grosjean, H. Parekh, and J. E. Richmond
Tomosyn Negatively Regulates CAPS-Dependent Peptide Release at Caenorhabditis elegans Synapses
J. Neurosci., September 19, 2007; 27(38): 10176 - 10184.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
D. Rayes, M. Flamini, G. Hernando, and C. Bouzat
Activation of Single Nicotinic Receptor Channels from Caenorhabditis elegans Muscle
Mol. Pharmacol., May 1, 2007; 71(5): 1407 - 1415.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
H. Qian, R. J. Martin, and A. P. Robertson
Pharmacology of N-, L-, and B-subtypes of nematode nAChR resolved at the single-channel level in Ascaris suum
FASEB J, December 1, 2006; 20(14): 2606 - 2608.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
D. S. Matthies, P. A. Fleming, D. M. Wilkes, and R. D. Blakely
The Caenorhabditis elegans choline transporter CHO-1 sustains acetylcholine synthesis and motor function in an activity-dependent manner.
J. Neurosci., June 7, 2006; 26(23): 6200 - 6212.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/29/27013    most recent
M502818200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Touroutine, D.
Right arrow Articles by Richmond, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Touroutine, D.
Right arrow Articles by Richmond, J. E.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement