Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M502541200 on May 11, 2005

J. Biol. Chem., Vol. 280, Issue 29, 27035-27043, July 22, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
280/29/27035    most recent
M502541200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mohamed, H. A.
Right arrow Articles by Byrne, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mohamed, H. A.
Right arrow Articles by Byrne, J. H.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

cAMP-response Elements in Aplysia creb1, creb2, and Ap-uch Promoters

IMPLICATIONS FOR FEEDBACK LOOPS MODULATING LONG TERM MEMORY*{boxs}

Habib A. Mohamed, Weizhe Yao, Diasinou Fioravante, Paul D. Smolen, and John H. Byrne{ddagger}

From the Department of Neurobiology and Anatomy, W. M. Keck Center for the Neurobiology of Learning and Memory, the University of Texas Medical School, Houston, Texas 77030

Received for publication, March 8, 2005 , and in revised form, May 6, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The Aplysia genes encoding for cAMP-response element-binding protein 1 (CREB1), CREB2, and ubiquitin C-terminal hydrolase (Ap-uch) have been implicated in the formation of long term memory. However, nothing is known about the promoter regions of these genes or the transcription factors that regulate them. We cloned the promoter regions of creb1, creb2, and Ap-uch and identified a canonical cAMP-response element (CRE) in the promoter region of creb1. Variants of the canonical CRE were identified in all three promoters. TATA boxes and C/EBP-binding motifs are also present in the promoter regions of these genes. Promoter immunoprecipitation assays and chromatin immunoprecipitation assays indicated that CREB1 and CREB2 bind to the promoter regions of creb1 and creb2, suggesting that feedback loops modulate the formation of long term memory. In a positive feedback loop, phosphorylated CREB1 might induce its own gene via CREs. In support of this suggestion, treatment with serotonin enhanced binding of CREB1 to its promoter region and increased mRNA levels of creb1. Levels of Ap-uch mRNA also increased in response to serotonin; however, binding of CREB1 or CREB2 to the promoter region of Ap-uch was not detected. The finding that the promoter region of creb2 has a CRE raises the intriguing possibility that its expression is regulated by CREB1 and/or CREB2. CREB2 may repress its own gene, forming a negative feedback loop, and CREB2 up-regulation via CREB1 may limit the activity of the CREB1-mediated positive feedback loop.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Memory storage has at least two distinct forms, short term and long term. Whereas short term memory lasts for only several minutes, and involves covalent modifications of preexisting proteins, long term memory (LTM)1 lasts for at least 24 h and involves the synthesis of new mRNAs and proteins (1). Characterization of the genes involved in the induction and consolidation of LTM is essential for elucidating the mechanisms of memory formation. The gene family of the cAMP-response element-binding protein (CREB) transcription factors is important for LTM in both vertebrates and invertebrates (2-6). Immediate-early genes coding for CCAAT enhancer-binding protein (C/EBP) and Aplysia ubiquitin C-terminal hydrolase (Ap-uch) are also essential for LTM (7-11).

The marine mollusc Aplysia has served for more than 35 years as a model organism for studying learning and memory (12). The simple nervous system of Aplysia has facilitated the study of changes in specific synapses and has allowed their correlation with particular learned behaviors (13, 14). Long term sensitization requires gene induction by cAMP (2) and depends on long term strengthening (facilitation) of sensory-motor synapses. These synaptic changes depend on a balance of gene induction and repression regulated by transcription factors such as the CREBs (15-17).

In Aplysia, two CREBs have been identified, CREB1 and CREB2. CREB1, which is homologous to mammalian CREB, is a transcription activator necessary for long term facilitation (LTF) (18, 19). Bartsch et al. (19) found that creb1 mRNA was increased in the CNS after exposure of the whole animal to serotonin (5-HT), a transmitter thought to mediate LTF. However, the induction mechanism of creb1 is not well understood, and its promoter region has not been characterized. Aplysia CREB2, which is homologous to vertebrate CREB2 (ATF4) (20), functions as a transcriptional repressor that may pose inhibitory constraints on memory formation (17, 21). This constraint can be regulated through phosphorylation (17, 22). However, the regulation of expression of creb2 has not been investigated previously, and the promoter region has not been characterized.

The canonical CRE motif, 5'-TGACGTCA-3', is required for gene induction by CREB (23-26). CREB binds to the canonical CRE or to close variants. Most interestingly, mammalian creb has CREs in its promoter region (27). It is not known whether Aplysia creb1 has CREs in its promoter region. If so, then CREB1 could enhance its own transcription, forming a positive feedback loop that might help to maintain gene activation essential for consolidation of LTF. It is also not known whether Aplysia creb2 has CREs in its promoter region. CREs have been identified in the promoter region of c/ebp (7, 17), which encodes a transcription factor regulated by 5-HT and is necessary for LTF.

Ap-uch is induced by 5-HT and is necessary for LTF (8). Increased Ap-uch levels enhance hydrolysis and disassembly of multiubiquitin conjugates, increasing protein degradation via the ubiquitin-proteasome pathway (28). In particular, the degradation of the regulatory (R) subunit of PKA is enhanced, resulting in increased levels of free, autonomously active catalytic (C) subunits (29-31). This increased PKA activity could, in turn, maintain phosphorylation of CREB1 (32) and further induction of Ap-uch. However, the promoter region of Ap-uch has not yet been characterized. Regulation of Ap-uch by CREB1 or CREB2 has not been examined, and the plausibility of the Ap-uch feedback loop has not been assessed.

We report the cloning and sequencing of the promoter regions of creb1, creb2, and Ap-uch in Aplysia. We have identified putative CRE sequences, TATA boxes and C/EBP-binding motifs within each promoter region. We showed in a promoter immunoprecipitation assay that CREB1 and CREB2 proteins bind to their own gene promoter regions but not to the Ap-uch promoter region. These findings were confirmed and extended using in vivo chromatin immunoprecipitation (ChIP) assays. Finally, we report the induction of creb1 and Ap-uch in pleural ganglia following 5-HT treatment.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Aplysia Genome Walking
Aplysia genomic DNA was isolated, digested with PvuII and StuI (Promega), and ligated with the GenomeWalker adaptor DNA (Universal GenomeWalker kit, Clontech). The genomic fragments were used as templates for PCR with an adaptor primer (AP1, 5'-GTAATACGACTCACTATAGGGC-3', or AP2, 5'-ACTATAGGGCACGCGTGGT-3') and a gene-specific primer (see below). The PCR product (<1 kbp) was subjected to electrophoresis, extracted from agarose gel, and subcloned into pCR 2.1 TOPO TA vector (Invitrogen). The cloned fragment was sequenced by the automated DNA sequence analyzer (ABI model 7000) at the DNA Core Facility, Department of Microbiology and Molecular Genetics, University of Texas Medical School, Houston, using M13 universal primers. The following gene-specific primers were used in the genome walks: for creb1, first genomic walk, 65TGCTGCAATCGGAGTGGATAAATTTGC39 (based on Ref. 19); for the second genomic walk, -44AGAACTATGTTCTATTGCGGACTTAGTG-71 (based on the sequence from the first genomic walk) (see supplemental Fig. S1). This primer was also used as the gene-specific primer for creb1 in the PCR step of the promoter immunoprecipitation assay. The following sequences were used: for creb2, 226CCAGTTGAAAATCTTCGCTCCAAAGGT200 ((21), GenBankTM accession number U40851 [GenBank] ) (see supplemental Fig. S2); for Ap-uch, 78TTCAAGAGGGATCCATCTCTGTTCTGA52 ((8), GenBankTM accession number U90177 [GenBank] ) (see supplemental Fig. S3). The genomic DNA sequences were analyzed for promoter sequence homology to CREB-binding motifs, TATA boxes, and C/EBP-binding motifs using the Transcription Element Search System software (TESS; URL, www.cbil.upenn.edu/tess) that surveyed the TRANSFAC eukaryotic data base using default settings. Annotated sequences of the promoter regions of the three genes were obtained using a minimum log likelihood ratio (ta) of 6.0 and a maximum log likelihood deficit (td) of 8.0 (default; combined query option).

5'RACE
Because only a portion of the exon I (5'-untranslated region (5'UTR)) is published for Aplysia creb1, we performed 5'RACE by using a SMART RACE cDNA amplification kit (Clontech) to obtain the remaining portion of the 5'UTR. 5'RACE PCR was performed using the adaptor primer provided in the kit and the gene-specific primer from the first creb1 genome walk. The PCR product was subcloned into pCR 2.1 TOPO TA vector, and the cloned fragment was sequenced as mentioned above. We also performed 5'RACE for creb2 and Ap-uch using the same primers given above for the respective genome walking assays.

QRT-PCR Analysis of creb1, creb2, and Ap-uch mRNA
Naive animals were anesthetized by injection of isotonic MgCl2 equal to one-half of the body weight, and the two pairs of pleural-pedal ganglia were surgically removed. Each pair of ganglia was randomly assigned to either a control or a 5-HT group. Following trimming of the connective tissue sheath in isotonic MgCl2:ASW (1:1 v/v), ganglia in both groups were rinsed with L15:ASW (1:1 v/v) and rested at 18 °C for 1-2 h. Subsequently, groups were treated with five 5-min pulses of either vehicle (L15:ASW) or 50 µM 5-HT with an interpulse interval of 20 min. At the end of the treatment, ganglia were rinsed with L15:ASW, rapidly frozen on dry ice, and stored at -80 °C until further processing. The composition of ASW and modified L15 has been published elsewhere (33, 34). Total RNA was isolated from frozen ganglia by the Trizol method (Invitrogen) and treated with RNase-free DNase I to remove any contaminating genomic DNA. The quantification of the mRNAs was done by QRT-PCR, conducted in the Quantitative Genomics Core Laboratory of the Department of Integrative Biology and Pharmacology, University of Texas Medical School, Houston, using a 7700 Sequence Detector (Applied Biosystems, CA) and following published procedures (35). Specific assays for creb1, creb2, and Ap-uch mRNAs and for 18 S rRNA were developed with Primer Express software (Applied Biosystems). The following sequences of primers and synthetic DNAs (sDNAs) were used: 18 S rRNA, GenBankTM accession number X94268 [GenBank] (36), 1047CGATGCCAACTAGCGATCC1065, 1115CACTTTGGTTTCCCGGAAG1097; sDNA 18 S rRNA, CGATGCCAACTAGCGATCCGCAGGAGTTGCTTTGATGACTCTGCGGGCAGCTTCCGGGAAACCAAAGTG; creb1, from Bartsch et al. (19), exon II, 2CATGTCAGAAGGCAGTGGT20, 63TTGATATGCCCTGGTTGC46; sDNA-creb1, ACATGTCAGAAGGCAGTGGTCCTGGCACAGCTGACCTTGAAAATGCAACCAGGGCATATCAATG; creb2, GenBankTM accession number U40851 [GenBank] (21), 407TCGGCTCTTTTCTGGATGC425, 469AAGTTGACTCGAACGGATGC450; sDNA-creb2, ATCTCGGCTCTTTTCTGGATGCTTTGGGTGACAACCATGAGCGGCTGCATCGTTCGAGTCAAACTTG; Ap-uch, GenBankTM accession number U90177 [GenBank] (8), 587GAAAGGAAGCACCTGTTGTCC607, 656ACAACTTCAGCAGCGTCCTC637; sDNA-Ap-uch, GGATGGGAGAAAGGAAGCACCTGTTGTCCATGGAACGACCTCAGCAGACACATTTCTTGAGGACGCTGCTGAAGTTGT.

Cloning, Expression, and Purification of CREB Proteins
The cDNAs for creb1 and creb2 were cloned from total RNA extracted from Aplysia pleural ganglia, using RT-PCR with primers made according to the published sequences: for creb1 (based on Ref. 19), 1ATGTCAGAAGGCAGTGGTCCTGGC24, 816TCATGCATCCTTTTGACAATAGAG793; for creb2 (based on Ref. 21), 190ATGGAGCTGGACCTTTGGAGCGAA213, 1326CTATTTAAGCTGAATACCTTTCGC1303.

The amplicons were subcloned into pCR 2.1 TOPO vector and sequenced to confirm their identity. The inserts were then separately cloned into the pGEX-4T-1 expression vector (which codes for glutathione S-transferase (GST)) at the EcoRI site (Amersham Biosciences). Recombinant fusion proteins were produced in Escherichia coli BL21 following standard procedures (37) and purified through GST affinity columns. The GST moiety was cleaved from the fusion proteins using thrombin (20 units per ml of PBS, incubated for 30 min at 22 °C) (Amersham Biosciences).

Affinity-purified Antibodies against CREB Proteins
The CREB1 and CREB2 peptides and the antibodies were raised by a commercial vendor (Genemed Synthesis, Inc., South San Francisco, CA).

Antibodies for CREB1—Rabbit polyclonal antibodies were raised against the Ser85-phosphorylated (underlined) and the unphosphorylated versions of the bovine serum albumin-conjugated CREB1 peptide KKRREILTRRPSYRK. Each antibody was purified through affinity columns made with the respective peptide. The phospho-specific CREB1 antibody was further purified through a second affinity column with a nonphosphorylated peptide.

Antibodies for CREB2—By using the same approach as for CREB1, we raised polyclonal antibodies against the phosphorylated and the unphosphorylated versions of a CREB2 hybrid peptide constructed to juxtapose the sequences immediately surrounding two putative MAPK phosphorylation sites. The peptide sequence is SPPDSPEQGPSSPET, with phosphate groups chemically added on Ser152 (1st underline) and Ser237 (2nd underline) for the phospho-peptide. Purification of the two CREB2 antibodies was performed following the same procedure as for CREB1 antibodies.

Promoter Immunoprecipitation Assay
Cloned promoters and either recombinant CREB or CNS lysate were used in an assay modified from Guan et al. (17). The promoter fragments were isolated from the pCR 2.1 vector by digestion with restriction enzymes and separated by electrophoresis. These cloned fragments included the 5'UTRs of creb2 and Ap-uch; creb1 promoter fragments were constructed with or without the 5'UTR to examine the effect of the canonical CRE within the 5'UTR (Fig. 1A2) on the binding of CREB proteins. Approximately 10 ng of DNA was incubated for 3 h at 22 °C with 5 µg of purified recombinant CREB protein (or 200 µg of protein from total CNS) in 100 µl of PBST (PBS containing 0.05% of Tween 20). At the end of incubation, 5 µl of total CREB1 antibody and 5 µl of phospho-CREB1 antibody (or total CREB2 and phospho-CREB2 antibody) were added together to the reaction mixture, to maximize the immunoprecipitation, and incubated for 18 h at 4 °C. In control experiments, 10 µl of preimmune rabbit sera replaced the specific antibodies. Protein A-Sepharose (50% slurry in PBST; 25 µl) was added to the mixture, which was then incubated for at least 2 h at 4 °C, followed by centrifugation at 5000 x g for 5 min. The pellet was washed in PBST to remove any unbound material and was resuspended in 25 µl of PBST. Two µl of this washed material was used for PCR (30 cycles) using gene-specific primers and Adaptor Primer 2 (see Aplysia genome walking section).

Protein amounts were estimated by a modified Lowry method (DC protein assay, Bio-Rad). Total RNA was estimated by measuring the absorbance at 260 nm using a Beckman DU 530 spectrophotometer.

Chromatin Immunoprecipitation (ChIP) Assay
ChIP assays were as described in Weinmann et al. (38). Briefly, pleural-pedal ganglia were isolated and treated with 5 pulses of 5-HT or vehicle, as described above. Immediately after the treatment, the ganglia were treated with 1% formaldehyde for 30 min at room temperature with rotation to cross-link proteins to DNA. The reaction was quenched by the addition of glycine (final concentration, 0.125 M). Following cell lysis (in 400 µl of lysis buffer: 10 mM HEPES, 85 mM KCl, 0.5% Nonidet P-40) in the presence of protease inhibitors, nuclei were recovered by low speed centrifugation, resuspended in sonication buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8.1) containing protease inhibitors, and sonicated six times for 10 s each time on ice to shear the genomic DNA to lengths of 0.3-1.3 kb. The lysates were then diluted with ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl, 167 mM NaCl, and protease inhibitors, pH 8.1). A portion of diluted lysate was kept for input control. Subsequently, the lysate was precleared with salmon sperm DNA/protein A-agarose beads for 1 h at 4 °C, followed by brief centrifugation to pull down the beads. Two µg of anti-tCREB1 (or anti-tCREB2) were added to the supernatant fraction and incubated overnight at 4 °C with rotation. For the negative control, preimmune serum replaced the specific antibody. Immune complexes were recovered by the addition of 60 µl of salmon sperm DNA/protein A-agarose slurry for 1 h at 4 °C with rotation. The beads were washed sequentially with low salt washing buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, 150 mM NaCl, pH 8.0), high salt washing buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, 500 mM NaCl, pH 8.0), LiCl washing buffer (0.25 M LiCl, 1% Nonidet P-40, 1% sodium deoxycholate, 1 mM EDTA, 10 mM Tris-HCl, pH 8.0), and 1x TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). After washing, the immune complexes were eluted by two 15-min incubations with 150 µl of freshly made elution buffer (1% SDS and 50 mM NaHCO3). The two fractions of eluates were combined, and cross-linking was reversed by addition of NaCl (final concentration, 0.3 M) followed by overnight incubation at 65 °C. After treatment with proteinase K for 2 h at 45 °C, DNA was recovered by phenol/chloroform extraction and ethanol precipitation. DNA was resuspended in H2O, and a small aliquot was analyzed by PCR using primers specific for the various promoter regions containing CREs. The PCR primer sequences (5' to 3' direction) were as follows: for creb1, forward primer 1 (fp1), CTATAAATATATCCCTCACGCGTCAGC, and reverse primer 1 (rp1), GAATACGTAGTGGCCACGTCAAAAGTC; fp2, AATGTCTAAAGCCACTAAGCAAGCC, and rp2, CATCAATACAAACTGCTCGAAGTTAG; fp3, TATTCATTAAGTACCGGTACCAAG, and rp3, AATTCTTTCAAGTCCGTGCCACAAC; for creb2, fp, CTAGATCTGTCAGGTGGCCTATCAC, and rp, GAGATTGAGATATTCCCGATTGAAGG; for Ap-uch, fp, GCATTAAAGACTAGACTCTAGACTC, and rp, AGATTCTAGATCTACCGGCAAGTAC.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
The creb1, creb2, and Ap-uch Promoter Regions Each Contain Variant CRE Sequences, and creb1 Contains a Canonical CRE—We cloned and sequenced 736 bp upstream of exon I using a gene-specific primer in the middle of the published sequence of exon I (19) (see supplemental Fig. S1; GenBankTM accession number DQ028783 [GenBank] ). Two rounds of genome walking to obtain the sequence of the creb1 promoter region were followed by 5'RACE analysis to establish the putative TSS. Analysis of the genomic sequence of creb1 upstream of the TSS by the TESS program (see "Materials and Methods") revealed three variant CREs: TGATGTCA at -79 bp, TGA GTCA at -465 bp, and TGCACGTG at -606 bp. Downstream of the TSS, a canonical CRE, TGACGTCA, was identified at +141 bp as well as a variant CRE, TGACGTGG, at +265 bp in exon I. Variant CREs have asymmetrical or partial sequences that differ from the canonical sequence (5'-TGACGTCA-3') by single or multiple nucleotide deletions or substitutions (39, 40) and commonly suffice for induction by cAMP (41). Putative TATA boxes were identified at -190 bp (Figs. 1A and supplemental S1) and at other locations further upstream. Putative C/EBP-binding motifs were identified throughout the promoter region (not shown).

By employing the same strategy, we cloned the promoter regions of creb2 and Ap-uch, using primers downstream of the Met initiation codons. The creb2 promoter region has a single variant CRE, TGACGACC, at -331 bp, and a TATA box at -243 bp (Figs. 1B and supplemental S2; GenBankTM accession number DQ028784 [GenBank] ). The Ap-uch promoter region has a variant CRE, TGATGTCA, at -717 bp and a TATA box at -226 bp (Figs. 1C and supplemental S3; GenBankTM accession number DQ028785 [GenBank] ). Both promoter regions have putative TATA boxes further upstream and putative C/EBP-binding motifs (not shown).

The nearest TATA box for creb1 is at -190 bp from the putative TSS. Whether this TATA box is functional is not clear at this time, as most mammalian genes have TATA boxes at around -30 bp. However, lower eukaryotic genes can have TATA boxes farther away than -30 bp (42). For creb2 and Ap-uch, we could not successfully sequence the 5'RACE product to identify accurately the TSS, possibly because of complex DNA secondary structure. Therefore, we numbered the promoter regions of these genes starting from the translation initiation site (+1 for A in ATG). However, based on the size of the 5'RACE product (200 bp), the TSS for creb2 and Ap-uch probably lie within ~200 bp of the translation start sites (data not shown). Therefore, the TATA boxes at -243 bp for creb2 and at -226 bp for Ap-uch may be appropriately placed to regulate transcription initiation. CREs and C/EBP-binding motifs can control the transcription of various genes regardless of their position in the promoter region (43). A comparison of the cloned sequences of the promoter regions of creb1, creb2, and Ap-uch using the BLAST2 program from the National Center for Biotechnology Information (NCBI; URL: www.ncbi.nlm.nih) showed that there is no significant similarity among them.

Development of Antibodies Specific for the Phosphorylated and Total Forms of CREB1 and CREB2—Polyclonal antibodies were raised against Aplysia CREB1 and CREB2 peptides. Two CREB1 antibodies were produced. The first termed anti-pCREB1 was raised against a CREB1 peptide with the target residue for protein kinase A (PKA), Ser85, phosphorylated (see "Materials and Methods"). The second antibody, termed anti-tCREB1, was raised against this peptide with unphosphorylated Ser85. Anti-tCREB1 recognized protein bands at 33 and 66 kDa in pleural ganglia extracts (Fig. 2A, arrowheads). The 33-kDa protein band was somewhat higher than the calculated molecular mass of CREB1, which is 29 kDa. To investigate this discrepancy, we cloned, expressed, and purified recombinant full-length Aplysia CREB1 protein (rec-CREB1). Western blot analysis revealed that rec-CREB1 also showed an apparent molecular mass of 33 kDa (Fig. 2A), suggesting that the 33-kDa protein band in the pleural ganglia extracts was the native CREB1 monomer. The minor shift in electrophoretic mobility might be due to post-translational modifications (e.g. phosphorylation). The 66-kDa protein band is most likely a dimer of CREB1 that persisted despite the denaturing conditions of the SDS gel. CREB1 readily forms homo-and heterodimers in vivo (21, 19, 39), and some protein complexes, such as the SNAREs, have been reported not to dissolve in the presence of denaturing agents (44, 45).



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 1.
Schematic organization of cis-regulatory elements in the promoter regions of creb1, creb2, and Ap-uch, deduced from sequences of the genomic clones isolated from Aplysia. A1, the position and sequence of putative CREs and a TATA box (the one closest to the TSS) identified in the promoter region of creb1. A2, schematic representation of the promoter region and 5'UTR of creb1. B1, same as in A1 but for creb2. B2, same as in A2 but for creb2. C1, same as in A1 but for Ap-uch. C2, same as in A2 but for Ap-uch. The gray boxes represent the translated regions. For creb1, the numbering of regulatory elements is with reference to the TSS (+1). For creb2 and Ap-uch, the numbering of regulatory elements is with reference to the translation start site (ATG, +1).

 
To investigate the specificity of the anti-tCREB1 antibody, we performed preabsorption experiments. Preincubation of anti-tCREB1 with rec-CREB1 protein blocked the signal of both the 33- and the 66-kDa protein bands in pleural ganglia extracts (Fig. 2A), suggesting that this antibody reacts with CREB1 and supporting the hypothesis that the 66-kDa protein band is a CREB1 dimer. The anti-pCREB1 antibody also recognized two protein bands in pleural ganglia extracts (Fig. 2C, arrowheads). To test the specificity of anti-pCREB1, the effect of treatment of recombinant GST-CREB1 with protein phosphatase on anti-pCREB1 immunoreactivity was investigated (Fig. 2D). Recombinant proteins produced in bacteria can undergo extensive phosphorylation (46). By taking advantage of this finding, GST-CREB1 was analyzed by SDS-PAGE, transblotted to nitrocellulose membranes, and treated with {lambda}-protein phosphatase (2000 units/ml; New England Biolabs, Beverly, MA). The membranes were then incubated with anti-pCREB1, which was visualized through ECL (Amersham Biosciences). Subsequently, membranes were stripped and reprobed with anti-tCREB1, followed by ECL. Treatment with phosphatase diminished immunoreactivity of anti-pCREB1 (Fig. 2D), suggesting that this antibody binds preferentially to phospho-CREB1. However, the immunoreactivity of anti-tCREB1 was unaffected by phosphatase treatment, suggesting that this antibody recognizes both nonphosphorylated and phosphorylated CREB1.

Two CREB2 antibodies were similarly produced. The first, termed anti-pCREB2, was raised against a CREB2 hybrid peptide comprised of sequences surrounding two putative mitogen-activated protein kinase (MAPK) target residues, Ser152 and Ser237, with both residues phosphorylated (see "Materials and Methods"). The second antibody, termed anti-tCREB2, was raised against this same peptide with unphosphorylated serines. Anti-tCREB2 recognized a single protein band with apparent molecular mass of 50 kDa in Western blot analyses of extract of pleural ganglia (Fig. 2B), similar to the reported molecular mass for CREB2 (21). The position of this band corresponded well with the position of purified rec-CREB2. Preabsorption of anti-tCREB2 with rec-CREB2 protein blocked the 50-kDa band in pleural ganglia extracts, providing further evidence that the antibody reacts with CREB2 (Fig. 2B). The anti-pCREB2 antibody also recognized a 50-kDa band (Fig. 2C). Treatment with phosphatase, in the same manner as in Fig. 2D, diminished the immunoreactivity of anti-pCREB2, whereas the immunoreactivity of anti-tCREB2 was unaffected (Fig. 2E). These results suggest that anti-pCREB2 binds to phospho-CREB2 and that anti-tCREB2 recognizes both non-phosphorylated and phosphorylated CREB2.



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 2.
Characterization of CREB antibodies. A, the total CREB1 antibody (anti-tCREB1) recognized two protein bands with apparent molecular masses of 66 and 33 kDa in extract of pleural ganglia (arrowheads). The lower protein band at 33 kDa corresponded well to purified recombinant full-length CREB1 (rec-CREB1). Preabsorption with rec-CREB1 (10 mol of protein per mol of antibody, incubated for 24 h at 4 °C) blocked immunoreactivity to both bands in extract of pleural ganglia, indicating that the antibody is specific for CREB1. B, the total CREB2 antibody (anti-tCREB2) immunoreacted with a single protein band of 50 kDa in extract of pleural ganglia. The position of this band corresponded well with that of rec-CREB2. Preabsorption with rec-CREB2 (performed as described above) blocked immunoreactivity of anti-total CREB2 to the 50-kDa band. C, both the phospho-CREB1 and phospho-CREB2 antibodies (anti-pCREB1 and anti-pCREB2) showed immunoreactivity to extracts of pleural ganglia. Arrowheads indicate the 66- and 33-kDa protein bands detected by the anti-pCREB1 antibody. D, treatment of GST-CREB1 fusion protein with {lambda}-protein phosphatase (PPase) specifically reduced anti-pCREB1 signal without affecting anti-tCREB1 signal. The two lanes in each treatment constitute replications. E, treatment of GST-CREB2 fusion protein with {lambda}-protein phosphatase specifically reduced anti-pCREB2 signal.

 
CREB1 and CREB2 Proteins Each Bind to the Cloned Promoter Regions of creb1 and creb2, but not of Ap-uch, in Vitro— The presence of CREs in the promoter regions of creb1, creb2, and Ap-uch raised the intriguing possibility that these genes may be regulated by CREB proteins. By using immunoprecipitation assays, we investigated whether CREB1 and/or CREB2 could bind to the cloned promoter regions. We used the cloned fragment of the creb1 promoter region that extended from -736 bp to +313 bp, which included variant CREs as well as the canonical CRE at +141 bp (Fig. 1, A1 and A2). For creb2, the cloned fragment that was used extended from -682 bp to +37 bp (Fig. 1, B1 and B2) and contained a variant CRE only. For Ap-uch, the cloned fragment that was used extended from -937 bp to +33 bp (Fig. 1, C1 and C2) and contained a single variant CRE. The antibodies against the total CREB and phospho-CREB peptides were used together to maximally immunoprecipitate complexes of CREB1 and/or CREB2 with the cloned promoter regions. Following immunoprecipitation, interaction of CREB proteins with the promoter regions was detected via PCR of any immunoprecipitated DNA, using gene-specific primer and adaptor primer 2 (see "Materials and Methods").

Separation of PCR products by electrophoresis indicated that CREB1 and CREB2 proteins each bound to both the creb1 and creb2 promoter regions (Fig. 3, A and B). However, neither CREB1 nor CREB2 bound to the Ap-uch promoter region (Fig. 3, A and B). This result suggests that the interaction of CREBs with the creb1 and creb2 promoter regions is not because of nonspecific DNA binding of CREB proteins. Similar results were obtained when total protein extract (200 µg of protein per 100 µl) from Aplysia CNS was used in place of recombinant CREB proteins (Fig. 3, C and D). To investigate further the specificity of this promoter immunoprecipitation assay, the requirement for protein-promoter complex formation was examined by omitting the recombinant protein. In the absence of CREB protein, the antibodies did not immunoprecipitate any DNA, as indicated by the lack of PCR product (data not shown).

The presence of CREs in the 5'UTR of creb1 raised the issue whether CREB proteins can bind to this region. To address this issue, we made a truncated fragment of the creb1 promoter region, extending from -736 bp to -44 bp. This fragment contained all the putative regulatory elements noted above except for the canonical CRE and one variant CRE. CREB1 bound to this fragment, but CREB2 did not (Fig. 3E). These observations suggest that CREB2 may bind to the CREs in the 5'UTR of creb1, whereas CREB1 binds to one or more of the variant CREs upstream from the TSS. CREB1 also binds to the CREs in the 5'UTR of creb1 (see below). Putative CREs located downstream of the TSS have also been identified for other genes (47).

CREB1 and CREB2 Each Bind to the Promoter Regions of creb1 and creb2, but Not Ap-uch, in Vivo—The binding of CREB1 and CREB2 to the creb1, creb2, and Ap-uch promoter regions in vivo was investigated using ChIP assays. Pleural-pedal ganglia from Aplysia were treated with five pulses of 5-HT or vehicle, followed by formaldehyde treatment to cross-link the DNA-protein complexes. After sonication, chromatin complexes were immunoprecipitated with our anti-tCREB1 and anti-tCREB2 antibodies. The immunoprecipitated DNA was recovered and amplified through PCR, using primers specific for creb1, creb2, and Ap-uch promoter regions containing CREs. To study the binding of CREB1 to the creb1 promoter region, the primer set fp1-rp1, which covers the canonical CRE site in the 5'UTR (see "Materials and Methods" for details; Fig. 1A), was used. Similar results (not shown) were obtained with the other two primer sets (fp2-rp2 and fp3-rp3), which cover other variant CREs in the creb1 promoter region. To study the binding of CREB2 to the creb1 promoter region, only the fp1-rp1 primer set was used, based on our finding that CREB2 did not bind to the truncated creb1 promoter region lacking the 5'UTR CREs (see in vitro promoter immunoprecipitation assays above; Fig. 3E).

Under basal conditions, both anti-tCREB1 and anti-tCREB2 immunoprecipitated creb1 promoter fragments (Fig. 4, A and B), suggesting that both CREB1 and CREB2 bind to the creb1 promoter region. The specificity of the immunoprecipitation was demonstrated by replacing the primary antibodies with preimmune sera, in which case no chromatin complexes were immunoprecipitated (as indicated by lack of detectable PCR product; data not shown). Immediately following 5-HT treatment, the CREB1 antibody immunoprecipitated more creb1 promoter fragments compared with vehicle-treated controls, suggesting that more CREB1 was recruited to the creb1 promoter region. In contrast, the CREB2 antibody did not immunoprecipitate any creb1 promoter fragments following exposure to 5-HT, suggesting that 5-HT may down-regulate the affinity of CREB2 for the creb1 promoter region.



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 3.
CREB1 and CREB2 bind to the creb1 and creb2 promoter regions but not to the Ap-uch promoter region. Results were replicated at least once for each experiment. A, promoter immunoprecipitation assays using recombinant CREB1 protein. rec-CREB1 was incubated with the promoter region of creb1, creb2, or Ap-uch. Addition of phospho-CREB1 and total CREB1 antibodies followed by immunoprecipitation and PCR (see "Materials and Methods" for details) showed that rec-CREB1 specifically bound to the promoter regions of creb1 and creb2 but not to the Ap-uch promoter region. Addition of preimmune sera in lieu of CREB1 antibodies failed to pull down the CREB1-promoter region complexes. Note that for creb1, the gene-specific primer used in the PCR step following immunoprecipitation started at -44 bp (see supplemental Fig. S1); therefore, the resulting product was 693 bp and not 1049 bp. B, immunoprecipitation assays using recombinant CREB2 protein. rec-CREB2 was incubated with the promoter regions of creb1, creb2, or Ap-uch. Phospho-CREB1 and total CREB2 antibodies were added, followed by immunoprecipitation and PCR. rec-CREB2 specifically bound to the promoter regions of creb1 and creb2 but not to the Ap-uch promoter region. Preimmune sera failed to pull down the CREB2-promoter region complexes. C, same as A except CNS extract replaced rec-CREB1. D, same as B except CNS extract replaced rec-CREB2. E, promoter immunoprecipitation assay using rec-CREB1 or rec-CREB2 and the truncated promoter fragment of CREB1 (CREB1trunc, -736 to -44 bp) that does not include the canonical CRE. Protein-DNA complexes were immunoprecipitated with total and phospho-CREB1 antibodies or total and phospho-CREB2 antibodies, followed by PCR. rec-CREB1 co-immunoprecipitated with CREB1trunc, which indicates that CREB1 protein bound to at least one of the variant CREs in creb1. However, rec-CREB2 did not interact with CREB1trunc, indicating that CREB2 bound to the region downstream of the TSS that contains the canonical CRE and a variant CRE. Preimmune sera failed to pull down any complexes.

 
Binding of CREB1 and CREB2 to the creb2 promoter region was also observed in the ChIP assay under basal conditions (Fig. 4, A and B). These interactions did not appear to change after 5-HT treatment, because no detectable difference was observed in the amount of chromatin complexes immunoprecipitated by our antibodies following 5-HT treatment.

The Ap-uch promoter region has a variant CRE site (Fig. 1C). However, neither CREB1 nor CREB2 was observed to bind to this promoter region under basal conditions, confirming our in vitro results (see above). Moreover, no detectable binding was observed immediately after 5-HT treatment (Fig. 4, A and B).

creb1 and Ap-uch Are Induced by Exposure to Spaced 5-HT Pulses, but creb2 Does Not Appear to Be Induced—To test the hypothesis that 5-HT protocols that induce LTF also regulate creb1, creb2, and Ap-uch, paired ganglia were exposed to five 5-min pulses of either 5-HT or vehicle (L15:ASW). This 5-HT treatment, which is commonly used to induce LTF (48, 49), was predicted to increase expression of creb1, creb2, and Ap-uch, given that all these genes have CREs in their promoter regions. Following treatment, ganglia were collected and frozen either immediately or 1, 2, or 5 h after the last 5-HT pulse. The tissue was processed for QRT-PCR analysis of mRNA levels. Five hours after the last pulse of 5-HT, creb1 and Ap-uch mRNA levels in pleural ganglia increased nearly 2-fold compared with untreated controls (creb1 at 5 h, 183.88 ± 21.98% (mean ± S.E.), t6 = -2.7, p < 0.05; Ap-uch at 5 h, 166.28 ± 28.1%, t6 = -3.148, p < 0.05) (Fig. 5). For creb1 and Ap-uch, there were no significant differences in mRNA levels between 5-HT-treated and control-treated samples at any other time point examined (immediately (imm), 1 and 2 h) (creb1, pimm = 0.2, p1 = 0.38, p2 = 0.29; Ap-uch, pimm = 0.32, p1 = 0.63, p2 = 0.1; n = 7 for all groups). For creb2, a trend of increase in transcription was evidenced at 1 and 5 h, but it was not statistically significant (pimm = 0.27, p1 = 0.1, p2 = 0.41, p5 = 0.67; n = 7 for all groups) (Fig. 5).



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 4.
Chromatin immunoprecipitation analysis of CREB1 and CREB2 binding to creb1, creb2, and Ap-uch promoter regions in ganglia treated with 5-HT or vehicle. Chromatin immunoprecipitations from equal volume lysates from 5-HT-treated or untreated ganglia were performed using antibodies against Aplysia CREB1 (A) and CREB2 (B). The immunoprecipitated chromatin was analyzed using primers specific for creb1, creb2, and Ap-uch promoter regions, as indicated under "Materials and Methods" and "Results." Sheared chromatin of total lysates was used as input control (C). Representative results of three independent experiments are shown.

 



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 5.
Long term treatment with 5-HT up-regulates Ap-uch and creb1 mRNA at 5 h post-treatment but not creb2. Following five 5-min pulses of vehicle or 5-HT, pleural ganglia were collected either immediately or after 1, 2, or 5 h. By using QRT-PCR, levels of Ap-uch, creb1, and creb2 mRNA were quantified and normalized to 18 S RNA. Significant increases from untreated controls were observed for Ap-uch and creb1 mRNA at the 5-h time point (*, Student's t test for paired samples, p < 0.05). For creb2, a trend of increase in transcription was evidenced at 1 and 5 h but was not significantly different from respective ASW-treated controls.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Phosphorylation of transcription factors of the CREB family, and induction of genes with CREs in their promoter regions, are critical events for the formation of LTM in organisms as diverse as Aplysia (21, 2), Drosophila (50, 51), and mammals (3, 6, 16, 26, 52-56). Vertebrate genes that have CREs in their promoter regions, and that are up-regulated during LTM formation, include c/ebp (9), c-fos (57), BDNF (58, 59), and zif268 (60). Each of these genes is important for the induction of some forms of vertebrate LTM or long term synaptic potentiation (BDNF (61); zif268 (62); c/ebp (10); c-fos (63)). We therefore examined whether CREs are present in Aplysia creb1, creb2, and Ap-uch, three genes necessary for LTF and LTM.

Putative CRE Sequences in the Promoter Regions of creb1, creb2, and Ap-uch—We sequenced the promoter regions of creb1, creb2, and Ap-uch (Fig. 1 and supplemental Figs. S1-S3). A comparison of these sequences revealed no significant homology among them, suggesting that the promoter regions are gene-specific. The promoter region of creb1 has several variant CREs, one canonical CRE, and several putative TATA boxes and C/EBP-binding motifs. The promoter region of creb2 has one variant CRE as well as several putative TATA boxes and C/EBP-binding motifs; and the promoter region of Ap-uch has one variant CRE as well as numerous putative TATA boxes and C/EBP-binding motifs.

Promoter immunoprecipitation assays using our specific antibodies to CREB1 and CREB2 peptides revealed that recombinant Aplysia CREB1 and CREB2 each bound to the cloned creb1 promoter region (Fig. 3). In vivo binding of CREB1 and CREB2 to the creb1 promoter region was confirmed by ChIP assays (Fig. 4). These results suggest that the CREs in this promoter region can function in vivo. The finding that CREB1 bound to the truncated promoter region of creb1, which contained only variant CREs, suggests that these variant CREs may be functional in vivo (Fig. 3E). Most interestingly, CREB2 did not bind to the region of the creb1 promoter that contains the variant CREs, but it did bind to a region downstream of the TSS that contains a canonical CRE (at +141 bp) and a variant CRE (at +265 bp) (Fig. 3A). Binding of CREB2 to this region is likely to modulate the dynamics of induction of creb1. CREB2 bound to the CREs in the 5'UTR could repress creb1 expression by hindering the progression of RNA polymerase II through this region. Activation of kinases to phosphorylate CREB2 may be required to promote dissociation of CREB2 from these CREs, thus facilitating the activation of creb1 by phosphorylated CREB1 protein.

The promoter region of human creb also has three variant CREs, spread over nearly 800 bp (25), and that of mouse creb has one variant CRE (64). Neither region has a canonical CRE. Unlike human and mouse creb genes, which have no TATA box, Aplysia creb1 has more than one TATA box, as well as many putative C/EBP-binding motifs (Fig. 1A). We have not examined the functionality of these motifs.

The promoter immunoprecipitation assay also showed that both CREB1 and CREB2 bound to the promoter region of creb2. In vivo binding of CREB1 and CREB2 was confirmed by ChIP assays (Fig. 4), suggesting that the creb2 CRE at -331 bp may be functional. Similarly, human creb2 (ATF4) has a variant CRE (but no TATA box).2

Promoter immunoprecipitation assays did not show binding of rec-CREB1 or rec-CREB2 protein to the region in the Ap-uch promoter that contains a variant CRE (Fig. 3, A and B). Endogenous CREB proteins also did not bind to the promoter region of Ap-uch when CNS lysate was used instead of the recombinant proteins (Fig. 3, C and D). Implications of this observation are discussed below.

5-HT Treatment Enhances Recruitment of CREB1, but Abolishes the Binding of CREB2, to the creb1 Promoter Region—Our results from the ChIP assays suggested that 5-HT promotes the recruitment of CREB1 to the creb1 promoter region (Fig. 4) and induces creb1 transcription (Fig. 5). Therefore, it is plausible that CREB1 can induce its own transcription. We also found that 5-HT treatment decreased binding of CREB2 to the creb1 promoter region (Fig. 4). Relief of transcriptional repression because of removal of CREB2 may play an important role in the induction of creb1 in response to 5-HT.

Although CREB1 and CREB2 bind to the creb2 promoter region under basal conditions, 5-HT exposure did not appear to modulate this binding (Fig. 4). Levels of creb2 mRNA also do not appear to be significantly affected by 5-HT (Fig. 5). These results suggest that the induction of creb2 is not regulated by CREB1 or CREB2 in response to 5-HT. Nonetheless, it is plausible that creb2 induction is modulated at later time points (beyond 5 h).

Although Ap-uch has a CRE in its promoter region and is known to be up-regulated in response to 5-HT, no detectable binding of CREB1 and CREB2 was observed in vivo, either under basal conditions or immediately after the end of 5-HT exposure (Figs. 3 and 4). One possibility is that binding takes place at a time point later than we assayed, although the lack of basal binding would argue against this. Another possibility is that the 5-HT-induced regulation of Ap-uch may involve transcription factors other than CREB1 and CREB2. C/EBP is a potential candidate regulating Ap-uch expression in response to 5-HT. Indeed, the promoter region of Ap-uch contains consensus binding motifs for this transcription factor. However, basal levels of C/EBP are very low and therefore unlikely to contribute significantly to 5-HT-induced gene regulation (7). Following 5-HT treatment, levels of C/EBP mRNA and protein are increased (7), but the newly synthesized C/EBP probably does not regulate the 5-HT-induced up-regulation of Ap-uch because this up-regulation does not depend on new protein synthesis (8).

CRE Sequences May Generate Feedback Loops That Regulate Formation of LTF and LTM—The presence of CRE motifs in the creb1 promoter region suggests a positive feedback mechanism that may facilitate the formation of LTM (Fig. 6). Binding of phospho-CREB1 to the creb1 CREs, and consequent creb1 induction, would tend to increase levels of both total CREB1 protein and, by mass action, phospho-CREB1. This increase would further induce creb1, creating a positive feedback loop. Consistent with this hypothesis, we found that creb1 mRNA levels in pleural ganglia were increased nearly 2-fold 5 h after 5-HT treatment (Fig. 5). A similar increase in creb1 expression was observed previously when the whole animal was exposed to 5-HT, and the total CNS was analyzed for creb1 mRNA and protein (19). However, that study did not determine whether the 5-HT exposure induced LTF or LTM and whether creb1 mRNA was increased in the sensory neuron-containing pleural ganglia specifically, which are important sites of plasticity in Aplysia.



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 6.
A model of putative feedback loops operating during induction of creb1 and creb2. 5-HT increases levels of cAMP. Binding of cAMP to PKA results in the dissociation of the PKA catalytic subunit (C) from the regulatory subunit (R). The C subunit then phosphorylates CREB1 (CREB1-P), which binds to CRE sites in the promoter regions of creb1 and creb2, activating transcription of these genes. A positive feedback loop is constituted by induction of creb1, consequent increased levels of CREB1 protein, binding of CREB1 to the creb1 promoter region, and further creb1 induction. A negative feedback loop is constituted by induction of creb2, increased levels of CREB2 protein, binding of CREB2 to the creb2 promoter region, and consequent creb2 repression.

 
Positive feedback loops in biochemical or genetic pathways create the potential for multistability (i.e. multiple stable states of biochemical concentrations and reaction rates) (65, 66). Therefore, the putative positive feedback loop involving creb1 could be important in allowing a stimulus protocol of limited duration (such as repeated 5-HT applications) to induce a state of enhanced gene expression that lasts for many hours. Such an increase could be important for inducing genes involved in the consolidation of late phases of LTF and LTM.

Another positive feedback loop that has also been suggested to be important for LTF involves Ap-uch. Exposure to 5-HT results in increased levels of Ap-uch (8), which promotes degradation of the regulatory subunit of PKA via the ubiquitin-proteasome pathway. This action of Ap-uch results in increased levels of free, autonomously active catalytic subunits (30). This increased PKA activity could, in turn, maintain phosphorylation of CREB1 and further induction of Ap-uch. Prolonged CREB1 phosphorylation might be necessary for expression of late phases of LTF. This putative feedback loop has been noted previously (15, 32). However, our promoter immunoprecipitation and ChIP assays did not detect any binding of CREB1 or CREB2 to the Ap-uch promoter region. This result would suggest that Ap-uch induction is regulated by yet unidentified transcription factors, and therefore the putative CREB-Ap-uch feedback loop may not be operative in vivo.

Although variant CRE and C/EBP-binding motifs are present in the promoter region of creb2, this gene was not induced within 5 h after 5-HT treatment (Fig. 5). However, if creb2 was induced at a time later than we measured, accumulation of CREB2 could repress expression of creb1, c/ebp, and possibly other targets important for LTF via interaction with their CREs. Such repression could help terminate any positive feedback loops relying on induction of creb1 or c/ebp. Furthermore, the variant CREs in the creb1 promoter region are likely to have lower affinities for CREB1 than would a canonical CRE. For mammalian creb, Meyer et al. (27) speculated that a low affinity of variant CREs for CREB helps to limit the strength and duration of positive feedback. It is plausible that this constraint also limits the induction of Aplysia creb1. The induction of creb2, in turn, may be limited by a negative feedback loop (Fig. 6). In this loop, CREB2 accumulation would result in increased binding of CREB2 to the variant CRE in the creb2 promoter region, repressing creb2 expression.

Because the mouse and human creb promoters have variant CREs, a positive feedback loop in which CREB induces its own gene might facilitate synaptic strengthening and LTM consolidation in mammals. Further analysis of feedback loops involved in the regulation of key molecules, such as transcription factors, is likely to be important for understanding the induction and consolidation of LTM.


   FOOTNOTES
 
* This work was supported by DARPA Contract N00014-01-1-1031 and National Institutes of Health Grant NS19895. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{boxs} The on-line version of this article (available at http://www.jbc.org) contains Figs. S1–S3. Back

{ddagger} To whom correspondence should be addressed: Dept. of Neurobiology and Anatomy, W. M. Keck Center for the Neurobiology of Learning and Memory, the University of Texas Medical School, P. O. Box 20708, Houston, TX 77030. Tel.: 713-500-5602; Fax: 713-500-0623; E-mail: John.H.Byrne{at}uth.tmc.edu.

1 The abbreviations used are: LTM, long term memory; CREB, cAMP-response element-binding protein; Ap-uch, Aplysia ubiquitin C-terminal hydrolase; CRE, cAMP-response element; C/EBP, CCAAT enhancer-binding protein; LTF, long term facilitation; PKA, protein kinase A; 5-HT, 5-hydroxytryptamine; GST, glutathione S-transferase; TSS, transcriptional start site; MAPK, mitogen-activated protein kinase; ChIP, chromatin immunoprecipitation; PBS, phosphate-buffered solution; RACE, rapid amplification of cDNA ends; UTR, untranslated region; ASW, artificial seawater; rec, recombinant; CNS, central nervous system; sDNAs, synthetic DNAs; QRT, quantitative real time. Back

2 K. Barlow, GenBankTM accession number AL022312 [GenBank] , unpublished observations. Back


   ACKNOWLEDGMENTS
 
We thank James Brock for technical assistance and P. Dash, R-Y. Liu, E. Antzoulatos, and G. Phares for comments on an earlier draft of the manuscript.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Kandel, E. R. (2001) Science 294, 1030-1038[Abstract/Free Full Text]
  2. Dash, P. K., Hochner, B., and Kandel, E. R. (1990) Nature 345, 718-721[CrossRef][Medline] [Order article via Infotrieve]
  3. Guzowski, J. F., and McGaugh, J. L. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 2693-2698[Abstract/Free Full Text]
  4. Lamprecht, R., Hazvi, S., and Dudai, Y. (1997) J. Neurosci. 17, 8443-8450[Abstract/Free Full Text]
  5. Casadio, A., Martin, K. C., Giustetto, M., Zhu, H., Chen, M., Bartsch, D., Bailey, C. H., and Kandel, E. R. (1999) Cell 99, 221-237[CrossRef][Medline] [Order article via Infotrieve]
  6. Kida, S., Josselyn, S. A., de Ortiz, S. P., Kogan, J. H., Chevere, I., Masushige, S., and Silva, A. J. (2002) Nat. Neurosci. 5, 348-355[CrossRef][Medline] [Order article via Infotrieve]
  7. Alberini, C. M., Ghirardi, M., Metz, R., and Kandel, E. R. (1994) Cell 76, 1099-1114[CrossRef][Medline] [Order article via Infotrieve]
  8. Hegde, A. N., Inokuchi, K., Pei, W., Casadio, A., Ghirardi, M., Chain, D. G., Martin, K. C., Kandel, E. R., and Schwartz, J. H. (1997) Cell 89, 115-126[CrossRef][Medline] [Order article via Infotrieve]
  9. Taubenfeld, S. M., Wiig, K. A., Monti, B., Dolan, B., Pollonini, G., and Alberini, C. M. (2001) J. Neurosci. 21, 84-91[Abstract/Free Full Text]
  10. Taubenfeld, S. M., Milekic, M. H., Monti, B., and Alberini, C. M. (2001) Nat. Neurosci. 4, 813-818[CrossRef][Medline] [Order article via Infotrieve]
  11. Chen, A., Muzzio, I. A., Malleret, G., Bartsch, D., Verbitsky, M., Pavlidis, P., Yonan, A. L., Vronskaya, S., Grody, M. B., Cepeda, I., Gilliam, T. C., and Kandel, E. R. (2003) Neuron 39, 655-669[CrossRef][Medline] [Order article via Infotrieve]
  12. Byrne, J. H., and Kandel, E. R (1996) J. Neurosci. 16, 425-435[Abstract/Free Full Text]
  13. Frost, W., Castellucci, V. F., Hawkins, R. D., and Kandel, E. R (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 8266-8269[Abstract/Free Full Text]
  14. Cleary, L. J., Lee, W. L, and Byrne J. H (1998) J. Neurosci. 18, 5988-5998[Abstract/Free Full Text]
  15. Abel, T., Martin, K. C., Bartsch, D., and Kandel, E. R. (1998) Science 279, 338-341[Abstract/Free Full Text]
  16. Mayford, M., and Kandel, E. R. (1999) Trends Genet. 15, 463-470[CrossRef][Medline] [Order article via Infotrieve]
  17. Guan, Z., Giustetto, M., Lomvardas, S., Kim, J. H., Miniaci, M. C., Schwartz, J. H., Thanos, D., and Kandel, E. R. (2002) Cell 111, 483-493[CrossRef][Medline] [Order article via Infotrieve]
  18. Dash, P. K., and Moore, A. N. (1996) Brain Res. Mol. Brain Res. 39, 43-51[Medline] [Order article via Infotrieve]
  19. Bartsch, D., Casadio, A., Karl, K. A., Serodio, P., and Kandel, E. R. (1998) Cell 95, 211-223[CrossRef][Medline] [Order article via Infotrieve]
  20. Karpinski, B. A., Morle, G. D., Huggenvik, J., Uhler, M. D., and Leiden, J. M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 4820-4824[Abstract/Free Full Text]
  21. Bartsch, D., Ghirardi, M., Skehel, P., Karl, K., Herder, S., Chen, M., Bailey, C., and Kandel, E. R. (1995) Cell 83, 979-992[CrossRef][Medline] [Order article via Infotrieve]
  22. Guan, Z., Kim, J. H., Lomvardas, S., Holick, K., Xu, S., Kandel, E. R., and Schwartz, J. H. (2003) J. Neurosci. 23, 7317-7325[Abstract/Free Full Text]
  23. Montminy, M. R., Sevarino, K. A., Wagner, J. A., Mandel, G., and Goodman, R. H. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 6682-6686[Abstract/Free Full Text]
  24. Gilchrist, C. A., Orten, D. J., and Hinrichs, S. H. (1996) J. Biomed. Sci. 3, 293-306[CrossRef][Medline] [Order article via Infotrieve]
  25. Mayr, B., and Montminey, M. (2001) Nat. Rev. Mol. Cell Biol. 2, 599-609[CrossRef][Medline] [Order article via Infotrieve]
  26. Lonze, B. E., and Ginty, D. D. (2002) Neuron 35, 605-623[CrossRef][Medline] [Order article via Infotrieve]
  27. Meyer, T., Waeber, G., Lin, J., Beckmann, W., and Habener, J. (1993) Endocrinology 132, 770-780[Abstract/Free Full Text]
  28. Hegde, A. N., and DiAntonio, A. (2002) Nat. Rev. Neurosci. 3, 854-861[CrossRef][Medline] [Order article via Infotrieve]
  29. Hegde, A. N., Goldberg, A. L., and Schwartz, J. H. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 7436-7440[Abstract/Free Full Text]
  30. Chain, D. G., Casadio, A., Schacher, S., Hegde, A. N., Valbrun, M., Yamamoto, N., Goldberg, A. L., Bartsch, D., Kandel, E. R., and Schwartz, J. H. (1999) Neuron 22, 147-156[CrossRef][Medline] [Order article via Infotrieve]
  31. Zhao, Y., Hegde, A. N., and Martin, K. C. (2003) Curr. Biol. 2, 887-898
  32. Pettigrew, D. B., Smolen, P., Baxter, D. A., and Byrne, J. H. (2005) J. Comput. Neurosci. 18, 163-181[CrossRef][Medline] [Order article via Infotrieve]
  33. Phares, G. A., Antzoulatos, E. G., Baxter, D. A., and Byrne, J. H. (2003) J. Neurosci. 23, 8392-8401[Abstract/Free Full Text]
  34. Zhang, F., Endo, S., Cleary, L. J., Eskin, A., and Byrne, J. H. (1997) Science 275, 1318-1320[Abstract/Free Full Text]
  35. Wall, S. M., Hassell, K. A., Royaux, I. E., Green, E. D., Chang, J. Y., Shipley, G. L., and Verlander, J. W. (2003) Am. J. Physiol. 284, F229-F241
  36. Winnepenninckx, B., Steiner, G., Backeljau, T., and DeWachter, R. (1998) Mol. Phylogenet. Evol. 9, 55-63[CrossRef][Medline] [Order article via Infotrieve]
  37. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  38. Weinmann, A. S., Bartley, S. M., Zhang, T., Zhang, M. Q., and Farnham, P. J. (2001) Mol. Cell. Biol. 21, 6820-6832[Abstract/Free Full Text]
  39. Habener, J. F., Miller, C. P., and Vallejo, M. (1995) Vitam. Horm. 51, 1-57[Medline] [Order article via Infotrieve]
  40. Craig, J. C., Schumacher, M. A., Mansoor, S. E., Farrens, D. L., Brennan, R. G., and Goodman, R. H. (2001) J. Biol. Chem. 276, 11719-11728[Abstract/Free Full Text]
  41. Foulkes, N. S., and Sassone-Corsi, P. (2002) in Eukaryotic Gene Transcription, (Goodbourn, S., ed) pp. 59-100, IRL Press at Oxford University Press, Oxford
  42. Struhl, K. (1989) Annu. Rev. Biochem. 58, 1051-1057[CrossRef][Medline] [Order article via Infotrieve]
  43. Ptashne, M. (1988) Nature 335, 683-689[CrossRef][Medline] [Order article via Infotrieve]
  44. Hayashi, T., McMahon, H., Yamasaki, S., Binz, T., Hata, Y., Sudhof, T. C., and Niemann, H. (1994) EMBO J. 13, 5051-5061[Medline] [Order article via Infotrieve]
  45. Otto, H., Hanson, P. I., and Jahn, R. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 6197-6201[Abstract/Free Full Text]
  46. Kennelly, P. J. (2002) FEMS Microbiol. Lett. 206, 1-8[CrossRef][Medline] [Order article via Infotrieve]
  47. Yin, L., Li, L. M., Lin, M., Zhu, H., Lin, M., Cheng, L., Wang, Y., Zhou, Z., and Sha, J. (2002) Reprod. Fertil. Dev. 14, 185-189[CrossRef][Medline] [Order article via Infotrieve]
  48. Montarolo, P. G., Goelet, P., Castellucci, V. F., Morgan, J., Kandel, E. R., and Schacher, S. (1986) Science 234, 1249-1254[Abstract/Free Full Text]
  49. Mauelshagen, J., Sherff, C. M., and Carew, T. J. (1998) Learn. Mem. 5, 246-256[Abstract/Free Full Text]
  50. Tully, T., Preat, T., Boynton, S., and Del Vecchio, M. (1994) Cell 79, 35-47[CrossRef][Medline] [Order article via Infotrieve]
  51. Yin, J., Wallach, J., Wilder, E., Klingensmith, J., Dang, D., Perrimon, N., Zhou, H., Tully, T., and Quinn, W. (1995) Mol. Cell. Biol. 15, 5123-5130[Abstract]
  52. Frank, D. A., and Greenberg, M. E. (1994) Cell 79, 5-8[CrossRef][Medline] [Order article via Infotrieve]
  53. Silva, A. J., Kogan, J. H., Frankland, P. W., and Kida, S. (1998) Annu. Rev. Neurosci. 21, 127-148[CrossRef][Medline] [Order article via Infotrieve]
  54. Barth., A. L., McKenna, M., Glazewski, S., Hill, P., Impey, S., Storm, D., and Fox, K. (2000) J. Neurosci. 20, 4206-4216[Abstract/Free Full Text]
  55. Josselyn, S. A., Shi, C., Carlezon, W. A., Neve, R. L., Nestler, E. J., and Davis, M. (2001) J. Neurosci. 21, 2404-2412[Abstract/Free Full Text]
  56. Pittenger, C., Huang, Y. Y., Paletzki, R. F., Bourtchouladze, R., Scanlin, H., Vronskaya, S., and Kandel, E. R. (2002) Neuron 34, 447-462[CrossRef][Medline] [Order article via Infotrieve]
  57. Sheng, M., McFadden, G., and Greenberg, M. E. (1990) Neuron 4, 571-582[CrossRef][Medline] [Order article via Infotrieve]
  58. Tao, X., Finkbeiner, S., Arnold, D. B., Shaywitz, A. J., and Greenberg, M. E. (1998) Neuron 20, 709-726[CrossRef][Medline] [Order article via Infotrieve]
  59. Hall, J., Thomas, K. L., and Everitt, B. J. (2000) Nat. Neurosci. 3, 533-535[CrossRef][Medline] [Order article via Infotrieve]
  60. Davis, S., Vanhoutte, P., Pages, C., Caboche, J., and Laroche, S. (2000) J. Neurosci. 20, 4563-4572[Abstract/Free Full Text]
  61. Patterson, S. L., Pittenger, C., Morozov, A., Martin, K. C., Scanlin, H., Drake, C., and Kandel, E. R. (2001) Neuron 32, 123-140[CrossRef][Medline] [Order article via Infotrieve]
  62. Bozon, B., Kelly, A., Josselyn, S. A., Silva, A. J., Davis, S., and Laroche, S. (2003) Philos. Trans. R. Soc. Lond. B. Biol. Sci. 358, 805-814[Abstract/Free Full Text]
  63. Fleischmann, A., Hvalby, O., Jensen, V., Strekalova, T., Zacher, C., Layer, L. E., Kvello, A., Reschke, M., Spanagel, R., Sprengel, R., Wagner, E. F., and Gass, P. (2003) J. Neurosci. 23, 9116-9122[Abstract/Free Full Text]
  64. Cole, T. J., Copeland, N. G., Gilbert, D. J., Jenkins, N., Schutz, G., and Ruppert, S. (1992) Genomics 13, 974-982[CrossRef][Medline] [Order article via Infotrieve]
  65. Smolen, P., Baxter, D. A., and Byrne, J. H. (2000) Neuron 26, 567-580[CrossRef][Medline] [Order article via Infotrieve]
  66. Hasty, J., McMillen, D., Isaacs, F., and Collins, J. J. (2001) Nat. Rev. Genet. 2, 268-279[Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Physiol. Rev.Home page
C. M. Alberini
Transcription Factors in Long-Term Memory and Synaptic Plasticity
Physiol Rev, January 1, 2009; 89(1): 121 - 145.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
K.-O. Lai, Y. Zhao, T. H. Ch'ng, and K. C. Martin
Importin-mediated retrograde transport of CREB2 from distal processes to the nucleus in neurons
PNAS, November 4, 2008; 105(44): 17175 - 17180.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
D. Fioravante, R.-Y. Liu, and J. H. Byrne
The Ubiquitin-Proteasome System Is Necessary for Long-Term Synaptic Depression in Aplysia
J. Neurosci., October 8, 2008; 28(41): 10245 - 10256.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
R.-Y. Liu, D. Fioravante, S. Shah, and J. H. Byrne
cAMP Response Element-Binding Protein 1 Feedback Loop Is Necessary for Consolidation of Long-Term Synaptic Facilitation in Aplysia
J. Neurosci., February 20, 2008; 28(8): 1970 - 1976.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurophysiol.Home page
J. Chin, R.-Y. Liu, L. J. Cleary, A. Eskin, and J. H. Byrne
TGF-beta1-Induced Long-Term Changes in Neuronal Excitability in Aplysia Sensory Neurons Depend on MAPK
J Neurophysiol, May 1, 2006; 95(5): 3286 - 3290.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
280/29/27035    most recent
M502541200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mohamed, H. A.
Right arrow Articles by Byrne, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mohamed, H. A.
Right arrow Articles by Byrne, J. H.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement