JBC PeproTech; Our Business is Cytokines!

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M502560200 on June 14, 2005 Originally published In Press as doi:10.1074/jbc.M502560200 on June 13, 2005 Originally published In Press as doi:10.1074/jbc.M502560200 on May 24, 2005

J. Biol. Chem., Vol. 280, Issue 29, 27319-27328, July 22, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/29/27319    most recent
M502560200v3
M502560200v2
M502560200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schnell, R.
Right arrow Articles by Schneider, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schnell, R.
Right arrow Articles by Schneider, G.

Siroheme- and [Fe4-S4]-dependent NirA from Mycobacterium tuberculosis Is a Sulfite Reductase with a Covalent Cys-Tyr Bond in the Active Site*

Robert Schnell{ddagger}, Tatyana Sandalova{ddagger}, Ulf Hellman§, Ylva Lindqvist{ddagger}, and Gunter Schneider{ddagger}

From the {ddagger}Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm S-171 77, Sweden and §Ludwig Institute for Cancer Research, Biomedical Centre, Uppsala S-751 24, Sweden

Received for publication, March 8, 2005 , and in revised form, May 4, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
The nirA gene of Mycobacterium tuberculosis is up-regulated in the persistent state of the bacteria, suggesting that it is a potential target for the development of antituberculosis agents particularly active against the pathogen in its dormant phase. This gene encodes a ferredoxin-dependent sulfite reductase, and the structure of the enzyme has been determined using x-ray crystallography. The enzyme is a monomer comprising 555 amino acids and contains a [Fe4-S4] cluster and a siroheme cofactor. The molecule is built up of three domains with an {alpha}/{beta} fold. The first domain consists of two ferredoxin-like subdomains, related by a pseudo-2-fold symmetry axis passing through the whole molecule. The other two domains, which provide much of the binding interactions with the cofactors, have a common fold that is unique to the sulfite/nitrite reductase family. The domains form a trilobal structure, with the cofactors and the active site located at the interface of all three domains in the center of the molecule. NirA contains an unusual covalent bond between the side chains of Tyr69 and Cys161 in the active site, in close proximity to the siroheme cofactor. Removal of this covalent bond by site-directed mutagenesis impairs catalytic activity, suggesting that it is important for the enzymatic reaction. These residues are part of a sequence fingerprint, able to distinguish between ferredoxin-dependent sulfite and nitrite reductases. Comparison of NirA with the structure of the truncated NADPH-dependent sulfite reductase from Escherichia coli suggests a binding site for the external electron donor ferredoxin close to the [Fe4-S4] cluster.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Mycobacterium tuberculosis, the causative agent of tuberculosis, poses a major threat to human health. Over the last decade, the number of registered cases has been progressively increasing, resulting presently in approximately 2 million deaths per year (statistics available on the World Wide Web at www.who.int). The emergence of multidrug-resistant strains of M. tuberculosis raises serious concerns about future capabilities to control this pathogen. Chemotherapy is further complicated by the ability of M. tuberculosis to persist in the lungs of infected individuals for decades by switching to a dormant or latent phase (1), which also induces tolerance to current antibiotics (2, 3). Estimates by the WHO suggest that about one-third of the world's population is infected with persistent mycobacteria. Reactivation of these dormant bacteria can occur either spontaneously or as the consequence of an immunocompromised state (e.g. HIV infection/therapy), resulting in active tuberculosis. It is thus clear that a successful long term strategy against M. tuberculosis requires antibiotics targeting the bacteria also in the persistent state.

Latency is associated with nonreplicating or very slow growth of M. tuberculosis, and several experimental in vitro models for the dormant phase of the bacilli have been developed (4-7). Comparison of gene expression profiles and proteome analyses of active versus nonreplicating bacteria have identified a number of genes that are up-regulated in the dormant phase. Genes involved in oxidative stress, anaerobic respiration, and the metabolism of sulfur have consistently been identified as up-regulated in response to limited access to oxygen and nutrient starvation (8-11).

One of the genes active in the dormant phase of M. tuberculosis is nirA (Rv2391) (9, 10). Himar1 transposon mutagenesis has further shown that nirA is an essential gene (12). The amino acid sequence, derived from the nirA gene, shows homology to a family of ferredoxin-dependent sulfite/nitrite reductases. These enzymes are found in archaea, bacteria, fungi, and plants (for a review, see Refs. 13 and 14). The sulfite reductases catalyze the reduction of sulfite to sulfide, one step in the biosynthesis of sulfur-containing amino acids and cofactors. Nitrite reductases participate in the assimilation of nitrogen via nitrate in plants and can also act in anaerobic energy metabolism. This class of sulfite/nitrite reductases generally accepts both nitrite and sulfite as substrate, but the particular metabolic function is reflected in pronounced differences in the kinetic parameters. These enzymes contain a unique combination of cofactors, a [Fe4-S4] iron-sulfur cluster and a siroheme (15).

NirA also shows weak amino acid sequence similarity to bacterial NADPH-dependent [Fe4-S4]- and siroheme-containing sulfite reductases (e.g. 23% sequence identity to CysI from Escherichia coli). Unlike the monomeric ferredoxin-dependent enzymes, the NADPH-dependent sulfite reductases are oligomeric complexes consisting of four or eight subunits of the hemoprotein component (CysI) and eight flavoprotein subunits that deliver electrons derived from NADPH to the redox centers of the hemoprotein subunit (16, 17). In the ferredoxin-dependent enzymes, the electron donor binds transiently and delivers electrons to the [Fe4-S4] cluster, one at a time (18). The electrons are then transferred to the siroheme, which coordinates the substrate.

The only available structural information for this enzyme family is the crystal structure of a truncated form of the hemoprotein subunit of NADPH-dependent sulfite reductase from E. coli, CysI, where 73 amino acids at the N terminus had been proteolytically removed before crystallization (19, 20). No three-dimensional structure for a representative of the ferredoxin-dependent sulfite/nitrite reductases is yet available. Here, we show that the nirA gene from M. tuberculosis encodes [Fe4-S4] and siroheme-dependent sulfite reductase. The crystal structure of the mycobacterial enzyme, a potential target for novel drugs against human persistent tuberculosis infection, revealed an unexpected covalent bond between the side chains of Tyr69 and Cys161 in the immediate vicinity of the siroheme cofactor and the substrate binding site. The functional implications of this tyrosyl-cysteine residue in the active site of NirA have been probed by site-directed mutagenesis.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS AND DISCUSSION
 REFERENCES
 
Gene Cloning and Expression Screening—The gene coding for the predicted NirA protein (Rv2391)1 was amplified from M. tuberculosis H37Rv genomic DNA by PCR using Pfu Turbo polymerase (Stratagene) with the appropriate upstream primer GATCCATGGCCACTGCACGTCCCGCCAAG and the downstream primer GATAAGCTTATCGCAGGTCGTCCTCCTCG. The PCR fragments containing upstream NcoI and downstream HindIII sites were cloned into the pMOSBlue vector (Amersham Biosciences), and the nucleotide sequence of the PCR product was verified by DNA sequencing. Extensive expression screening using a series of expression vectors and several E. coli strains at different temperatures, however, only resulted in insoluble protein. Availability of the siroheme cofactor might be limiting for proper folding, and co-expression of cysG, coding for an uroporphyrinogen III C-methyl-transferase active in the biosynthesis of siroheme, has been shown to support the production of soluble siroheme-containing proteins (21, 22). The cysG gene was therefore amplified from Salmonella typhimurium genomic DNA and cloned into the expression vector utilizing the PBAD promoter pACYC origin of replication and compatible with all of our nirA expression constructs. Co-expression of cysG resulted in partially soluble product (up to ~20% of the total amount of NirA produced) using modified pET28a-NirA plasmids containing either a His6 tag (MDVSHHHHHHG) or an IgG-binding ZZ tag (23) inserted into the NcoI site.

Protein Production and Purification—The pET28a expression system was chosen to produce the recombinant His6-NirA enzyme with E. coli BL21(DE3) as expression host. Typically, cells were grown in 2 liters of LB medium at 21 °C and induced in midlog phase by adding 0.1 mM isopropyl 1-thio-{beta}-D-galactopyranoside and 0.01% arabinose and increasing the concentration of FeSO4 to 1 mM. After 24 h, E. coli cells were harvested, resuspended, and disrupted in a buffer (10 mM Tris-HCl, pH 8.0, 300 mM NaCl, and 10 mM imidazol) by lysozyme (0.08 mg/ml) treatment and sonication. The insoluble material was removed by centrifugation. The lysates were added to an Ni2+-nitrilotriacetic acid affinity matrix (Qiagen), and the bound proteins were eluted by an imidazol step-gradient. After desalting on a NAP10 column (Amersham Biosciences), the His6-NirA protein was purified to homogeneity by ion exchange chromatography using a Q-Sepharose column (Amersham Biosciences) and NaCl gradient elution. The protein was concentrated and kept frozen at -80 °C. The yield was ~2.5 mg of protein from 1 liter of culture. Protein concentration was determined according to Bradford (24).

Site-directed Mutagenesis—Site-directed mutagenesis was carried out using the QuikChange kit (Stratagene) following the manufacturer's recommendations. Mutagenic oligonucleotides used were CTTTCGCTGGTGGGGCCTGTTCACCCAGCGTGAGCAGGGC and GCCCTGCTCACGCTGGGTGAACAGGCCCCACCAGCGAAAG for Y69F; CTTTCGCTGGTGGGGCCTGGCCACCCAGCGTGAGCAGGGC and GCCCTGCTCACGCTGGGTCGGCAGGCCCCACCAGCGAAAG for Y69A; CTGCAGACCACCGAGGCGAGCGGTGACTGCCCGCGGGTAG and CTACCCGCGGGCAGTCACCGCTCGCCTCGGTGGTCTGCAG for C161S; and CTGCAGACCACCGAGGCGGCCGGTGACTGCCCGCGGGTAG and CTACCCGCGGGCAGTCACCGGCCGCCTCGGTGGTCTGCAG for C161A. In all cases, the mutant genes were sequenced to verify the absence of unintended mutations. Expression and purification of the mutant enzymes was carried out as for wild-type NirA.

Enzyme Assay—Wild-type and mutant NirA was assayed for sulfite reductase activity using the artificial electron donor methyl viologen (MV),2 which was reduced by sodium dithionite (15). The assay mixtures contained 100 mM Tris-HCl, pH 7.4, 5 mM sodium sulfite, 0.5 mM MV, and 1.5 mM sodium dithionite in a total volume of 0.8 ml at 22 °C. The reaction was started by the addition of sodium dithionite and followed spectrophotometrically as the consumption of reduced MV at 604 nm. The linear parts of the time curves were used to calculate the overall reaction rate for recombinant wild type and mutant enzymes. The background reoxidation rate of reduced methyl viologen was less than 0.1% of the enzymatic reaction. The extinction coefficient used at this wavelength was 1.4 x 104 M-1 cm-1 (25). One unit of sulfite reductase activity is defined as that amount of enzyme that catalyzes the oxidation of 1 µmol of MV/min under assay conditions (15).

The reaction product, sulfide, was initially recognized by the typical smell of the developing H2S. For chemical identification of the product, 1 ml of the assay solution, including wild-type or mutant NirA, was added into the wells of a 24-well microtiter plate. The reaction was started by the addition of sodium dithionite, and the well was immediately sealed with coverslips carrying a hanging drop (3 µl) of 1.0 mM NaOH solution to trap the hydrogen sulfide formed. The latter was identified by the addition of 3.6 mM cadmium chloride or 2 mM N,N-dimethyl-p-phenylenediamine sulfate and 3 mM ferric chloride for the methylene blue assay (26) to the drops.

The assay for nitrite reductase activity consisted of the same mixture as above, except that nitrite (in the range 5-20 mM) was added instead of sodium sulfite. Nitrite reductase activity was monitored by MV oxidation or directly by the consumption of nitrite. For the latter case, the reaction was stopped at various time intervals, and the concentration of the remaining nitrite was determined spectrophotometrically at 540 nm after the addition of 0.02% (w/v) sulfanilamide and 0.002% (w/v) N-(1-naphtyl)ethylenediamine (27). Control experiments verified that components of the assay mixture did not interfere with the determination of nitrite concentration.

Mass Spectrometry—The samples were in-gel digested using porcine sequence grade trypsin (Promega, Madison, WI) (28). The digests were analyzed by matrix-assisted laser dissociation ionization time of flight mass spectrometry on a Bruker Ultraflex TOF/TOF spectrometer (Bruker Daltonics, Bremen, Germany) using {alpha}-cyanohydroxycinnamic acid as matrix and the instrument setting optimized for analytes up to m/z 3500. Internal calibration was achieved with the autolytic fragments of trypsin. Data were analyzed via GPMAW (Lighthouse Data, Odense, Denmark)

Crystallization and Data Collection—Crystals of NirA were obtained by the hanging drop vapor diffusion method. 2 µl of the protein solution (10-14 mg/ml in 25 mM Tris buffer, pH 8.0, 150 mM sodium chloride) were mixed with 2 µl of well solution, containing 0.1 M Tris-HCl, pH range 8.2-8.7, 0.2 M MgCl2, and 30% polyethylene glycol 4000, and equilibrated against 1.0 ml of the well solution. Clusters of needle-shaped, brown crystals appeared after 3 days at room temperature. Rod-shaped single crystals suitable for x-ray structure analysis were obtained by streak seeding of freshly made drops (protein concentration 7 mg/ml) equilibrated for 1 day against the above mother liquor.

X-ray data were collected from crystals after direct transfer into a nitrogen gas stream at 110 K, at station ID14-1, ESRF (Grenoble, France) and beam line ID711 at MAX-lab (Lund, Sweden). The x-ray data were processed and scaled with the programs MOSFLM and SCALA from the CCP4 suit (29). Crystals belong to the monoclinic space group P21, with cell dimensions a = 59.9 Å, b = 83.3 Å, c = 108.8 Å, and {beta} = 102.2°. A second crystal form in the orthorhombic space group P212121 with cell dimensions a = 84.25 Å, b = 115.35 Å, c = 114.7 Å was obtained under identical conditions. In both cases, the asymmetric unit contains two molecules, with a solvent content of ~45%. The statistics of the data sets are given in Table I.


View this table:
[in this window]
[in a new window]
  		TABLE I
Statistics of data collection and refinement

 
Molecular Replacement and Crystallographic Refinement—The structure was solved by molecular replacement using the program MOLREP (30), initially in space group P21. A polyserine model of CysI from E. coli (19) (Protein Data Bank accession code 2gep [PDB] ) with residues 158-172, 200-208, 268-274, and 554-569 omitted was used as a search model. The best solution for the monoclinic NirA data set had a correlation coefficient of 0.266 and an R-factor of 55% with two molecules in the asymmetric unit. Initial rounds of rigid body refinement using Refmac5 (31) resulted in a drop of the R-factor by 5%. The siroheme molecule and the iron-sulfur cluster were excluded from these refinement cycles, and the correctness of the molecular replacement solution was confirmed by electron density for the cofactors appearing at the expected positions.



View larger version (10K):
[in this window]
[in a new window]
  		FIG. 1.
Absorption spectrum of oxidized recombinant NirA from M. tuberculosis. the spectrum was recorded in 25 mM Tris-HCl buffer, 150 mM NaCl, pH 8.0, at an enzyme concentration of 39.4 µM. The asymmetry in the band at 381 nm, observed in all preparations of NirA, could be due to a mixture of two states of the enzyme.

 
Manual rebuilding of the model was carried out with the program O (32), based on {sigma}A weighted 2Fo - Fc and Fo - Fc electron density maps (33), and refinement was continued with the program Refmac5 (31). Tight noncrystallographic symmetry restraints were applied in order to limit the number of parameters, except for a few loop regions with slightly different conformations. The structure determination for the orthorhombic NirA crystal form was carried out in a similar way, except that an initial NirA model from the monoclinic data set was used for the molecular replacement with residues 10-94 excluded from the search model. This stretch of the polypeptide chain was gradually rebuilt during refinement. CNS (34) was employed to calculate composite omit maps at the end of refinement. The protein models were analyzed with PROCHECK (35) in order to monitor the stereochemistry. Details of the refinement are given in Table I.

Sequence alignments were carried out using ClustalW (36). Structural comparisons were done with the programs DALI (37), TOP (38), and the LSQ option in O (32), applying default parameters. Figures were made using BOBSCRIPT (39) and rendered with RASTER3D (40). The atomic coordinates and structure factors for NirA have been deposited with the Protein Data Bank with accession numbers 1zj8 [PDB] (space group P212121) and 1zj9 (space group P21).


   RESULTS AND DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
REFERENCES
 
Characterization of Recombinant NirA—Recombinant NirA from M. tuberculosis has a brown color and shows the characteristic absorption spectrum of [Fe4-S4]- and siroheme-containing sulfite/nitrite reductases in the oxidized state (15, 22, 41) (Fig. 1). Purified recombinant NirA is catalytically active as a sulfite reductase and is able to reduce sulfite to sulfide using the non-physiological electron donor methyl viologen. The reaction product sulfide was chemically identified by the characteristic yellow, insoluble cadmium sulfide and by the methylene blue assay (26). The enzyme has a specific activity of 2.0 units/mg protein, comparable with sulfite reductases from other organisms (13, 15). We could not detect any decrease in the concentration of nitrite in this assay. Reduction of the artificial electron donor methyl viologen by dithionite results in the formation of equimolar amounts of sulfite as a by-product, which will compete with nitrite as a substrate. The failure of the enzyme to reduce nitrite under these conditions, even when added in 10-fold excess over sodium dithionite, shows that NirA has a pronounced preference for sulfite over nitrite as substrate.3



View larger version (57K):
[in this window]
[in a new window]
  		FIG. 2.
Overall structure of NirA. A, ribbon representation of the ferredoxin-dependent sulfite reductase from M. tuberculosis. Blue, parachute domain (the N-terminal segment comprising residues 10-90 is shown in darker blue); green, middle domain; red, C-terminal domain. The [Fe4-S4] cluster and the siroheme molecule are shown as ball-and-stick models. B, folding diagram of the domains of NirA. L, position of an unusual left-handed connection in the {beta}-sheet. The color coding is as in A. C, contribution of the N-terminal segment of NirA (residues 10-90, shown in blue) to active site topology. The location of the active site is shown by the bound chloride ion (green sphere) and the active site residues Tyr69 and Cys161, shown in orange. D, stereo view of the superposition of the N-terminal half (residues 67-312) (green) with the C-terminal half (residues 332-555) (red) of NirA illustrating the internal 2-fold pseudosymmetry indicative of gene duplication.

 
Gel filtration chromatography and dynamic light scattering suggest that NirA is a monomer in solution (data not shown), a finding that is also consistent with the crystallographic analysis (see below).

The Electron Density Map and Quality of the Model—The structure of NirA was solved by molecular replacement in two crystal forms, each containing two molecules in the asymmetric unit (Table I). Most parts of the polypeptide chain, including the iron-sulfur cluster and the siroheme cofactor, are well defined in electron density. The real space correlation to the electron density maps is in the range of 0.87-0.92 for both protein chains and space groups. The N-terminal His tag and the first nine residues of NirA are not seen in the electron density map. Less well defined regions of the polypeptide chain include several surface loops (residues 32-35, 51-55, 192-200, and 487-490). The final model consists of 8643 nonhydrogen protein atoms (two chains comprising residues 10-555) of NirA, two [Fe4-S4] clusters, two siroheme molecules, two chloride ions, and 20 water molecules. The stereochemistry of the model is as expected for this resolution (Table I). Superposition of the refined models of NirA from the two space groups gives an r.m.s. deviation of 0.45 Å, with the deviations mainly located in the weakly defined loop regions.

Overall Structure of M. tuberculosis NirA—In solution and in the crystal, NirA is present as a monomer. The buried accessible surface areas for the enzyme molecules in both crystal forms are on the order of 550 Å2, corresponding to 2% of the total accessible surface area. This value is typical for crystal contacts rather than for a dimer interface.

The NirA molecule consists of three {alpha}/{beta} domains: the parachute (19) domain (residues 1-159 and 331-405), the middle domain (residues 160-330), and the [Fe4-S4]-binding C-terminal domain (residues 406-555) (Fig. 2, A and B). Before entering the core of the parachute domain, the polypeptide chain packs against the surface of the middle domain and interacts through a number of hydrogen bonds and salt bridges with residues from that domain. The core of the parachute domain is built up of two modules with a ferredoxin-like fold (42) related by a pseudo-2-fold symmetry (Fig. 2, B and D) (see below). Each module consists of an antiparallel four-stranded {beta}-sheet, flanked by two helices on one side. The two subdomains interact tightly to form the parachute domain. A major interface region involves residues following the second {beta}-strands in each module, which form an additional antiparallel edge {beta}-strand to the adjacent module ({beta}p3 and {beta}p3', respectively), thus extending each sheet to a total of five {beta}-strands (Fig. 2B). Residues 72-92 of this domain form a long loop between {beta}p1 and {beta}p2, packing against the C-terminal domain. Helix {alpha}p0 and {beta}-strand {beta}p1 limit access to the active site, and {beta}p1 provides residues that are in van der Waals contact to the siroheme cofactor and thus form part of the active site (Fig. 2C).

The middle and C-terminal domains are very similar in structure. Each domain consists of a central five-stranded mixed {beta}-sheet with the fourth strand antiparallel to the others (Fig. 2B). One side of the sheet forms part of the binding site for the cofactor, siroheme, or the [Fe4-S4] cluster, respectively, whereas the other side of the sheet is covered by four {alpha}-helices facing the surface of the molecule. The fold of these domains is unique to the sulfite/nitrite reductase family.

A striking feature of the structure of NirA is the internal pseudo-2-fold symmetry. This feature was also noted in the crystal structure of CysI and led to the proposal that the enzyme has arisen as a result of gene duplication (19). Residues 67-312 of NirA can be superimposed on residues 332-555 with an r.m.s. deviation of 1.95 Å for 162 equivalent C{alpha} atoms (Fig. 2D). The internal pseudo-2-fold symmetry is more pronounced in NirA than in E. coli CysI. A similar superposition of the CysI structure gives only 100 equivalent residues with an r.m.s. deviation value of 1.99 Å. The lower number of equivalent residues is in part due to the proteolytic digestion of the N terminus in CysI, which may have removed {beta}-strand {beta}p1 from the core of the parachute domain. The nirA gene thus also appears to have arisen as a result of gene duplication, although with 17% of identical residues it can barely be recognized at the amino acid sequence level. Of the 27 and 16 residues in NirA and CysI, respectively, that are identical between the N- and C-terminal halves, only four are conserved in both enzymes, Gly103/351, Gln131/378, Gly244/497, and Gly245/498. These residues are located at the N-terminal or C-terminal end of {beta}-strands and appear to be conserved for structural reasons.

Comparison with Sulfite Reductase from E. coli—Despite the low degree of sequence conservation between NirA and CysI (23% identity) (Fig. 3), the overall structures are very similar. Superposition of the two protein models gave an r.m.s. deviation of 1.7 Å, based on 361 equivalent C{alpha} atoms. Significant structural differences are found at the very C terminus of the polypeptide chain and are otherwise confined to several surface loop regions, where either insertions or deletions have occurred (Fig. 3).

A striking difference in structure is the accessibility of the active site. The N-terminal stretch of the polypeptide chain, which had been truncated in CysI and could therefore not be observed in the CysI crystals, folds over the substrate channel in NirA and limits the access to the active site from the solution. In particular, strand {beta}1 (residues 67-72) completes the fold of the ferredoxin-like module 1 of the parachute domain, contributes to the architecture of the active site, and is positioned close to the siroheme cofactor (Fig. 2C). In full-length CysI, the N-terminal 73 residues could fold in a similar way.

Siroheme Binding—Siroheme binds tightly in the cleft formed at the interface between the three domains of NirA (Fig. 2A). The cofactor is buried in the protein interior, and only two oxygen atoms from one of the propionate moieties are accessible to solvent. There are numerous interactions of the siroheme cofactor with protein residues. All siroheme atoms, which can act as donor or acceptor, are engaged in hydrogen bonds or salt bridges (Fig. 4A). Eight basic residues (Arg130, Arg206, Lys207, Lys209, Arg290, Lys424, Arg431, and Arg469) form salt bridges to the carboxylate groups of the siroheme and contribute to charge compensation (residues that are invariant in the NiR-SiR enzyme family are underlined). In addition, several other residues form hydrogen bonds with the siroheme carboxylates (Ser128, Asp129, Asn132, Gln134, His136, Leu247 (main chain atoms), Ser248, Gln379, and Ser418). A crucial interaction is the coordination bond between the iron of the siroheme and the thiolate of Cys467 (Fig. 4B). This invariant cysteine residue is also coordinated to one of the iron ions of the [Fe4-S4] cluster. It thus provides the structural basis for the electronic coupling of the two redox cofactors, shown in previous studies of sulfite/nitrite reductases using a variety of techniques such as Mössbauer (43), EPR (44), 57Fe ENDOR (45), and NMR (46) spectroscopy. Most likely, the thiolate bridge directly participates in electron transfer from the iron-sulfur center to the siroheme (19, 20).



View larger version (55K):
[in this window]
[in a new window]
  		FIG. 3.
Amino acid sequence conservation in the siroheme-dependent sulfite/nitrite reductase family. A structure-based alignment of the amino acid sequences for one representative of each subclass of the SIR/NIR family is shown. NirA is ferredoxin-dependent sulfite reductase from M. tuberculosis, SNiR is ferredoxin-dependent nitrite reductase from spinach, and CysI is NADPH-dependent sulfite reductase from E. coli. The secondary structure of NirA and CysI are shown at the top and bottom, respectively, of the alignment. The nomenclature of the CysI secondary structure elements is as previously defined (19), and the color scheme for the secondary structure elements of NirA is the same as in Fig. 2, a and b. The pattern of sequence identity, based on the alignment of in total 26 sequences of the Sir/Nir family, is color-coded as follows. Yellow background, sequence invariance for ferredoxin-dependent sulfite reductases; green background, invariant residues for the ferredoxin-dependent nitrite reductases; blue shading, invariant residues in the sequences of NADPH-dependent sulfite reductases. Residues binding the siroheme are underlined, and putative substrate binding residues are shown in boldface type in the NirA sequence.

 



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 4.
Cofactor binding sites in NirA from M. tuberculosis. A, stereo view of the surroundings of the siroheme moiety. B, stereo view of the binding site of the [Fe4-S4] cluster. SRM, the siroheme molecule.

 
Iron-Sulfur Cluster Binding—The [Fe4-S4] cluster is bound exclusively by residues from the C-terminal domain and is located at the proximal side of the siroheme (Fig. 2A). Although the cluster is buried in the protein interior, it is rather close to the protein surface. The four iron ions are coordinated via covalent bonds to the thiolates of four conserved cysteine residues, Cys417, Cys423, Cys463, and Cys467 (Fig. 4B). These residues are located on two regions of the polypeptide chain, the end of the first {beta}-strand of the C-terminal domain and the following loop (C417SGIEFC423) and a conserved loop (GC463PNSC467A), part of the left-hand connection between the second and third strand. This loop carries one of the conserved sequence fingerprints of the sulfite/nitrite reductase family (13) and wraps tightly around the cluster, shielding it from the solvent. The side chain of the invariant residue Asn465 is accessible from the outside and could be involved in electron transfer from ferredoxin to the [Fe4-S4] cluster.

The Substrate-binding Site Contains a Covalent Tyr-Cys Bond—The distal face of the siroheme is accessible from the outside through a narrow channel that is dominated by basic residues. The positive electrostatic potential at the entrance of this channel, which extends into the active site, facilitates the encounter of the enzyme with the negatively charged substrate molecules and guides the diffusion of these anions into the interior of the substrate binding cleft (Fig. 5A).

At the distal face of the siroheme cofactor, residual density was observed during refinement, indicating an axial ligand bound to the iron ion (Fig. 5B). We have modeled this electron density as a chloride ion, due to the shape of the density and the fact that chloride anions were present during purification and crystallization in high concentration (400 mM). This anion-binding site is located at the position where substrate and other anions are bound in CysI (19, 20). Residues close to the axial ligand in NirA are Arg97, Arg130, Arg166, Lys207, and Lys209 (Fig. 5C). In CysI, the corresponding residues are involved in binding of the substrate, and both lysine residues might also be involved in proton transfer during catalysis. All of these positively charged residues, with one exception, are conserved in the family of sulfite/nitrite reductases. The substitution of Lys209 by an asparagine has been associated with a switch in substrate preference from sulfite to nitrite (20).

An unexpected feature in the structure of NirA is the covalent bond formed between the thiolate of Cys161 and the C{epsilon} carbon atom of Tyr69 (Fig. 5B). Attempts to verify this covalent link by mass spectrometry were inconclusive. The mass spectrometric analysis of tryptic peptides of NirA showed a fairly good coverage of the sequence (53%). Neither the peptide fragments expected in the absence of the Tyr-Cys bond nor a fragment consistent with the calculated mass of the peptide containing the covalent Tyr-Cys linkage could be identified.

This type of thioether-bridged tyrosyl-cysteine has been found in the active site of another redox enzyme, galactose oxidase (47). The covalently linked amino acids are located adjacent to a redox center, in this case copper ions, and act as a secondary cofactor in the stabilization of tyrosyl radicals (47, 48). The observation of such a covalently modified tyrosine side chain within van der Waals distance to the siroheme redox cofactor in NirA prompted us to further investigate the functional implications of this amino acid modification. The hydroxyl group of Tyr69 is in close proximity to the substrate-binding site, further indicating a possible role of this residue in catalysis. Tyr69 was replaced by phenylalanine and alanine, whereas Cys161 was mutated to serine and alanine. Mass spectrometric analysis of tryptic peptides verified the mutations and gave a fragmentation pattern consistent with the absence of the covalent linkage. The absence of the covalent bond also resulted in the same systematic shift in mobility of the mutant versus wild-type enzyme in SDS-PAGE as observed in galactose oxidase (49).

The absorption spectra of the four mutants showed minor but significant differences (data not shown), indicating that the electronic states of the redox cofactors are influenced by these amino acid substitutions. The mutants were catalytically impaired to various degrees, with the Y69A and C161S mutations being the most deleterious (Fig. 6). The significant decrease in activity indicates that the covalent linkage between these two residues in NirA is of functional importance, although not absolutely crucial for catalysis. It should be kept in mind, however, that the artificial electron donor methyl viologen has been used in the assay, and the situation may well be different in the case of the physiological electron donor. The residual activity of the Y69F mutant further indicates that this residue, albeit within proximity of the bound anion at the substrate-binding site, most likely does not participate in acid/base chemistry.

The Putative Ferredoxin-binding Site—In sulfite/nitrite reductases, the electrons flow from the external electron donor via the [Fe4-S4] cluster to the siroheme (18), and the most likely position for the ferredoxin-binding site is therefore in the vicinity of the iron-sulfur cluster. This redox center is located just beneath the enzyme surface, with the closest atom about 4 Å from the surface. A comparison of the structures of NirA and its NADPH-dependent homologue CysI shows that several of the major structural differences between these two enzymes are located in this region, possibly reflecting the difference in the structure of the external electron donors. In particular, two loop regions at the enzyme surface are involved. The {beta}-hairpin loop, which connects {beta}c3 with {beta}c4 in the C-terminal domain, is considerably longer, whereas the spatially adjacent loop between {beta}m4 and {beta}m5 is shorter in NirA by seven residues (Figs. 3 and 5A). It is noteworthy that the pattern of insertion/deletions for these two loops is also preserved in other bacterial ferredoxin-dependent sulfite/nitrite reductases when compared with CysI. We propose that the putative binding site for the external electron donor is located at the enzyme surface in the vicinity of these two surface loops, which are also close to the invariant surface residue Asn465 in contact with the iron-sulfur cluster. This region is, aside from the substrate channel, the only extended patch on the enzyme surface with a positive electrostatic potential (Fig. 5A). Since all putative ferredoxins from M. tuberculosis are acidic proteins, the preponderance of positively charged residues might facilitate binding of reduced ferredoxin for electron transfer.



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 5.
Active site of NirA. A, surface charge distribution in NirA, showing the markedly positive electrostatic potential extending from the entrance of the substrate binding tunnel to the siroheme cofactor located at the bottom of the active site cleft. The electrostatic potentials are contoured from -10 kT (red) to +10 kT (blue). The figure was generated with the program GRASP (52). The asterisk shows the entrance of the substrate channel. Asn465 is an invariant surface residue, which is in contact with the [Fe4-S4] cluster. L246-252 and L484-488 indicate loop regions proposed to be part of the ferredoxin-binding site. B, part of a composite omit map showing the electron density for the covalent bond between Tyr69 and Cys161 in the active site of NirA. The electron density for an anion coordinated to the iron ion at the distal face of the siroheme cofactor is also shown. The contour level of the electron density map is 1.0{sigma}. c, stereo view of the active site of NirA. The green sphere illustrates the bound chloride ion.

 
Physiological Function of NirA—We have shown here that the nirA gene of M. tuberculosis encodes a [Fe4-S4]- and siroheme-dependent sulfite reductase. It should also be noted that NirA is the only protein sequence of M. tuberculosis that is homologous to CysI of E. coli. This suggests that NirA participates in the assimilation of sulfur for the biosynthesis of sulfur-containing amino acids. A comparison of the localization of some of the cys genes in E. coli and M. tuberculosis also supports this proposal. In E. coli, the genes for the flavoprotein subunit CysJ and the hemoprotein component CysI of sulfite reductase are followed by CysH, encoding adenosyl phospho-sulfate reductase. In M. tuberculosis, NirA is similarly followed by CysH, and no gene corresponding to the flavoprotein subunit cysJ of the NADPH dependent sulfite reductase of E. coli is found at this locus. A BLASTX search (50) of the whole genome of M. tuberculosis (51) for homologues of the cysJ gene from E. coli did not result in any hits, suggesting that in M. tuberculosis, the NADPH-dependent sulfite reductase is replaced by a ferredoxin-dependent homologue. Furthermore, in a gene expression study of dormant M. tuberculosis, not only nirA but also several other genes involved in cysteine biosynthesis were shown to be up-regulated (10). One of these genes is cysG, encoding an enzyme of siroheme biosynthesis, further emphasizing the link between siroheme-dependent NirA and the cysteine biosynthetic pathway.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 6.
Comparison of specific activities of wild-type (WT) and mutant NirA. The specific activities were determined using the non-physiological electron donor methyl viologen and sulfite as substrate.

 
A Sulfite Versus Nitrite Reductase Fingerprint—A sequence alignment of ferredoxin-dependent nitrite/sulfite reductases suggests that these enzymes can be divided into two subfamilies. In one set of amino acid sequences, Tyr69 and Cys161, involved in the covalent linkage, and, in common with the NADPH-dependent sulfite reductases, residues His136 and Lys209, interacting with the siroheme, are invariant. In the other class, these residues are consistently replaced by phenylalanine, glycine, arginine, and asparagine, respectively (Fig. 3). We propose that these two sequence classes correspond to enzymes with a preference for sulfite and nitrite as substrate, respectively. This proposal agrees with available biochemical data on substrate specificity of members of this family (i.e. all established sulfite reductase belong to the first subfamily, whereas nitrite reductases fall within the second subfamily). This finger print could guide annotation of genes of the ferredoxin-dependent nitrite/sulfite reductase family as nir or sir genes.

Conclusions—The crystallographic study of full-length M. tuberculosis NirA provides the first three-dimensional structure of a ferredoxin-dependent sulfite/nitrite reductase. Despite the low degree of sequence conservation, the core of the molecule is similar in structure to the NADPH-dependent sulfite reductase from E. coli. The N-terminal part of the enzyme, comprising the first 90 amino acids, previously unknown in structure, does not form a distinct separate domain but is part of the first ferredoxin-like module of the parachute domain. This segment of the polypeptide chain also contributes to the formation of the active site. It limits access to the distal face of the siroheme and provides residues lining the active site. The covalent bond between the side chains of residues Tyr69 and Cys161 in the active site of NirA facilitates catalysis but is not essential for the enzymatic reaction with artificial electron donors. This situation appears different from that found in copper-dependent galactose oxidase where such a covalent bond is essential for enzyme function (48). We suggest that this structural feature is typical for ferredoxin-dependent sulfite reductases as opposed to nitrite reductases. The putative ferredoxin-binding site is located at a positively charged surface patch of the enzyme, close to the iron-sulfur cluster.


   FOOTNOTES
 
The atomic coordinates and structure factors (code 1zj8 and 1zj9) have been deposited in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NJ (http://www.rcsb.org/).

* This work was supported by European Community Contract QLK2-CT-2002-01682 and the Wallenberg Consortium North. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

To whom correspondence should be addressed: Dept. of Medical Biochemistry and Biophysics, Scheele's väg 2, Karolinska Institutet, Stockholm S-171 77, Sweden. Tel.: 46-8-52487675; Fax: 46-8-327626; E-mail: gunter.schneider{at}mbb.ki.se.

1 There is an annotation ambiguity regarding the exact definition of the open reading frame coding for NirA (Rv2391) in the genome sequence of M. tuberculosis H37Rv. The Swiss-Prot data base entry P71753 [GenBank] assigns the first methionine of the sequence MSAKENPQMTTARPAKARNEG as the N terminus, whereas in the GenBankTM entry AAK46756 [GenBank] the second methionine is defined as start of the NirA protein. The latter appears more likely, since it results in a better Shine-Dalgarno sequence, and therefore a construct starting with the second methionine was chosen for further work. Back

2 The abbreviations used are: MV, methyl viologen; r.m.s., root mean square. Back

3 Members of the SiR/NiR family usually are able to reduce both sulfite and nitrite, albeit at different rates. Absorption spectra of NirA recorded in the presence of nitrite or hydroxylamine, a postulated intermediate in the reduction of nitrite, show the same spectral changes as those described for spinach nitrite reductase (41, 53). This indicated that NirA is able to bind nitrite and hydroxylamine and thus might be able to reduce nitrite although at lower rates than sulfite. Back


   ACKNOWLEDGMENTS
 
We are grateful to Yanmin Hu and Anthony Coates for samples of M. tuberculosis genomic DNA and to Sofia Eriksson for the S. typhimurium genomic DNA. We acknowledge access to synchrotron radiation at beam line 711 (MAX Laboratory, Sweden) and beam line ID14 -1 (ESRF, France) and thank the staff at these facilities for assistance.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 

  1. Bloom, B. R., and McKinney, J. D. (1999) Nat. Med. 5, 872-874[CrossRef][Medline] [Order article via Infotrieve]
  2. Wayne, L. G., and Sramek, H. A. (1994) Antimicrob. Agents Chemother. 38, 807-811
  3. Wallis, R. S., Patil, S., Cheon, S. H., Edmonds, K., Phillips, M., Perkins, M. D., Joloba, M., Namale, A., Johnson, J. L., Teixeira, L., Dietze, R., Siddiqi, S., Mugerwa, R. D., Eisenach, K., and Ellner, J. J. (1999) Antimicrob. Agents Chemother. 43, 2600-2666[Abstract/Free Full Text]
  4. Wayne, L. G., and Hayes, L. G. (1996) Infect. Immun. 64, 2062-2069[Abstract]
  5. Betts, J. C., Lukey, P. T., Robb, L. C., McAdam, R. A., and Duncan, K. (2002) Mol. Microbiol. 43, 717-731[CrossRef][Medline] [Order article via Infotrieve]
  6. Voskuil, M. I., Schnappinger, D., Visconti, K. C., Harrell, M. I., Dolganov, G. M., Sherman, D. R., and Schoolnik, G. K. (2003) J. Exp. Med. 198, 705-713[Abstract/Free Full Text]
  7. Hu, Y., Mangan, J. A., Dhillon, J., Sole, K. M., Mitchison, D. A., Butcher, P. D., and Coates, A. R. (2000) J. Bacteriol. 182, 6358-6365[Abstract/Free Full Text]
  8. Hu, Y., and Coates, A. R. M. (2001) FEMS Microbiol. Lett. 202, 59-65[CrossRef][Medline] [Order article via Infotrieve]
  9. Schnappinger, D., Ehrt, S., Voskuil, M. I., Liu, Y., Mangan, J. A., Monahan, I. M., Dolganov, G., Efron, B., Butcher, P. D., Nathan, C., and Schoolnik, G. K. (2003) J. Exp. Med. 198, 693-704[Abstract/Free Full Text]
  10. Hampshire, T., Soneij, S., Bacon, J., James, B. W., Hinds, J., Laing, K., Stabler, R. A., Marsh, P. D., and Butcher, P. D. (2004) Tuberculosis 84, 228-238
  11. Starck, J., Källenius, G., Marklund, B.-I. Andersson, D. I., and Åkerlund, T. (2004) Microbiology 150, 3821-3829[Abstract/Free Full Text]
  12. Sasetti, C. M., Boyd, D. H., and Rubin, E. J. (2003) Mol. Microbiol. 48, 77-84[CrossRef][Medline] [Order article via Infotrieve]
  13. Crane, B. R., and Getzoff, E. D. (1996) Curr. Opin. Struct. Biol. 6, 744-756[CrossRef][Medline] [Order article via Infotrieve]
  14. Nakayama, M., Akashi, T., and Hase, T. (2000) J. Inorg. Biochem. 82, 27-32[CrossRef][Medline] [Order article via Infotrieve]
  15. Krueger, R. J., and Siegel, L. M. (1982) Biochemistry 21, 2892-2904[CrossRef][Medline] [Order article via Infotrieve]
  16. Siegel, L. M., Davis, P. S., and Kamin, H. (1974) J. Biol. Chem. 249, 1572-1586[Abstract/Free Full Text]
  17. Zeghouf, M., Fontecave, M., and Coves, J. (2000) J. Biol. Chem. 275, 37651-37656[Abstract/Free Full Text]
  18. Knaff, D. B., and Hirasawa M. (1991) Biochim. Biophys. Acta 1056, 93-125[Medline] [Order article via Infotrieve]
  19. Crane, B. R., Siegel. L. M., and Getzoff, E. D. (1995) Science 270, 59-67[Abstract/Free Full Text]
  20. Crane, B. R., Siegel, L. M., and Getzoff, E. D. (1997) Biochemistry 36, 12120-12137[CrossRef][Medline] [Order article via Infotrieve]
  21. Wu, J. Y., Siegel, L. M., and Kredich, N. M. (1991) J. Bacteriol. 173, 325-333[Abstract/Free Full Text]
  22. Curdt, I., Singh, B. B., Jakoby, M., Hachtel, W., and Böhme, H. (2000) Biochim. Biophys. Acta 1543, 60-68[CrossRef][Medline] [Order article via Infotrieve]
  23. Nilsson B., Moks T., Jansson B., Abrahamsen L., Elmblad A., Holmgren E., Henrichson C., Jones T. A., and Uhlen M. (1987) Protein Eng. 1, 107-113[Abstract/Free Full Text]
  24. Bradford, M. (1976) Anal. Biochem. 72, 248-254[CrossRef][Medline] [Order article via Infotrieve]
  25. Asada, K. (1967) J. Biol. Chem. 242, 3646-3654[Abstract/Free Full Text]
  26. Siegel, L. M. (1965) Anal. Biochem. 11, 126-132[CrossRef][Medline] [Order article via Infotrieve]
  27. Snell, F. D., and Snell, C. T. (1949) in Colorimetric Methods of Analysis (van Nostrand, R., ed) Vol. 3, pp. 804-805, Princeton, NJ
  28. Hellman, U. (2000) in Proteomics in Functional Genomics: Protein Structure Analysis (Jollès, P., and Jörnvall, H., eds) pp. 43-54, Birkhauser Verlag AG, Basel, Switzerland
  29. Collaborative Computational Project 4 (1994) Acta Crystallogr. D 50, 760-763[CrossRef][Medline] [Order article via Infotrieve]
  30. Vagin, A., and Teplyakov, A. (1997) J. Appl. Crystallogr. 30, 1022-1025[CrossRef]
  31. Murshudov, G., Vagin, A. A., Dodson, E. J. (1997) Acta Crystallogr. D 53, 240-253[CrossRef][Medline] [Order article via Infotrieve]
  32. Jones, T. A., Zou, J., Cowan, S., and Kjeldgaard, M. (1991) Acta Crystallogr. Sect. A 47, 110-119
  33. Read, R. J. (1986) Acta Crystallogr. Sect. A 42, 140-149[CrossRef]
  34. Brunger, A. T., Adams P. D., Clore G. M., DeLano W. L., Gros P., Grosse-Kunstleve R. W., Jiang J. S., Kuszewski J., Nilges M., Pannu N. S., Read R. J., Rice L. M., Simonson T., and Warren, G. L. (1998) Acta Crystallogr. Sect. D 54, 905-921[CrossRef][Medline] [Order article via Infotrieve]
  35. Laskowski, R. A., MacArthur, M. W., Moss, D. S., and Thornton J. (1993) J. Appl. Crystallogr. 26, 282-291[CrossRef]
  36. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673-4680[Abstract/Free Full Text]
  37. Dietmann, S., Park, J., Notredame, C., Heger, A., Lappe, M., and Holm, L. (2001) Nucleic Acids Res. 29, 55-57[Abstract/Free Full Text]
  38. Lu, G. (2000) J. Appl. Crystallogr. 33, 176-183[CrossRef]
  39. Esnouf, R. M. (1997) J. Mol. Graphics Modelling 15, 133-138
  40. Meritt, E. A., and Murphy, M. E. P. (1994) Acta Crystallogr. D 50, 869-873[CrossRef][Medline] [Order article via Infotrieve]
  41. Kuznetsova, S., Knaff, D.B., Hirasawa, M., Setif, P., and Mattioli, T. A. (2004) Biochemistry 43, 10765-10774[CrossRef][Medline] [Order article via Infotrieve]
  42. Murzin, A. G., Brenner, S. E., Hubbard, T., and Chothia, C. (1995) J. Mol. Biol. 247, 536-540[CrossRef][Medline] [Order article via Infotrieve]
  43. Christner, J. A., Münck, E., Janick, P. A., and Siegel, L. M. (1983) J. Biol. Chem. 258, 11147-11156[Abstract/Free Full Text]
  44. Janick, P. A., and Siegel, L. M. (1982) Biochemistry 21, 3538-3547[CrossRef][Medline] [Order article via Infotrieve]
  45. Cline, J. F., Janick, P. A., Siegel, L. M., and Hoffman, B. M. (1985) Biochemistry 24, 7942-7947[CrossRef][Medline] [Order article via Infotrieve]
  46. Kaufman, J., Spicer, L. D., and Siegel, L. M. (1993) Biochemistry 32, 2853-2867[CrossRef][Medline] [Order article via Infotrieve]
  47. Ito, N., Phillipps, S. E. V., Stevens, C., Ogel, Z. B., McPherson, M. J., Keen, J. N., Yadav, K. D. S., and Knowles, P. F. (1991) Nature 350, 87-90[CrossRef][Medline] [Order article via Infotrieve]
  48. Whittaker, J. W. (2003) Chem. Rev. 103, 2347-2363[CrossRef][Medline] [Order article via Infotrieve]
  49. Whittaker, M. M., and Whittaker, J. W. (2003) J. Biol. Chem. 278, 22090-22101[Abstract/Free Full Text]
  50. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997) Nucleic Acids Res. 25, 3389-3402[Abstract/Free Full Text]
  51. Cole, S. T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C. M., Harris, D. E., and Gordon, S. V., Eiglmeier, K., Gas, S., Barry, C. E., III, Tekaia, F., Badcock, K., Basham, D., Brown, D., Chillingworth, T., Connor, R., Davies, R. M., Devlin, K., Feltwell, T., Gentles, S., Hamlin, N., Holroyd, S., Hornsby, T., Jagels, K., Krogh, A., McLean, J., Moule, S., Murphy, L. D., Oliver, S., Osborne, J., Quail, M. A., Rajandream, M. A., Rogers, J., Rutter, S., Seeger, K., Skelton, S., Squares, S., Squares, R., Sulston, J. E., Taylor, K., Whitehead, S., and Barrell, B. G. (1998) Nature 393, 537-544[CrossRef][Medline] [Order article via Infotrieve]
  52. Nicholls, A., Sharp, K. A., Honig, B. (1991) Proteins Struct. Funct. Genet. 11, 281-296[CrossRef][Medline] [Order article via Infotrieve]
  53. Vega, J. M., and Kamin, H. (1977) J. Biol. Chem. 252, 896-909[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
J. E. Dominy Jr., J. Hwang, S. Guo, L. L. Hirschberger, S. Zhang, and M. H. Stipanuk
Synthesis of Amino Acid Cofactor in Cysteine Dioxygenase Is Regulated by Substrate and Represents a Novel Post-translational Regulation of Activity
J. Biol. Chem., May 2, 2008; 283(18): 12188 - 12201.
[Abstract] [Full Text] [PDF]

Home page
 Biophys. JHome page
C. H. Chang, P. W. King, M. L. Ghirardi, and K. Kim
Atomic Resolution Modeling of the Ferredoxin:[FeFe] Hydrogenase Complex from Chlamydomonas reinhardtii
Biophys. J., November 1, 2007; 93(9): 3034 - 3045.
[Abstract] [Full Text] [PDF]

Home page
 J. Bacteriol.Home page
R. Pinto, J. S. Harrison, T. Hsu, W. R. Jacobs Jr., and T. S. Leyh
Sulfite Reduction in Mycobacteria
J. Bacteriol., September 15, 2007; 189(18): 6714 - 6722.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. R. Simmons, Q. Liu, Q. Huang, Q. Hao, T. P. Begley, P. A. Karplus, and M. H. Stipanuk
Crystal Structure of Mammalian Cysteine Dioxygenase: A NOVEL MONONUCLEAR IRON CENTER FOR CYSTEINE THIOL OXIDATION
J. Biol. Chem., July 7, 2006; 281(27): 18723 - 18733.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/29/27319    most recent
M502560200v3
M502560200v2
M502560200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow