JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M411975200 on November 1, 2004

J. Biol. Chem., Vol. 280, Issue 3, 2084-2091, January 21, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/3/2084    most recent
M411975200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Di Giovanni, S.
Right arrow Articles by Faden, A. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Di Giovanni, S.
Right arrow Articles by Faden, A. I.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

In Vivo and in Vitro Characterization of Novel Neuronal Plasticity Factors Identified following Spinal Cord Injury*

Simone Di Giovanni{ddagger}§||, Andrea De Biase§, Alexander Yakovlev{ddagger}, Tom Finn{ddagger}, Jeanette Beers{ddagger}, Eric P. Hoffman§, and Alan I. Faden{ddagger}**

From the {ddagger}Department of Neuroscience, Georgetown University Medical Center, Washington D. C. 20057 and the §Center for Genetic Medicine, Children's National Medical Center, Washington D. C. 20010

Received for publication, October 21, 2004 , and in revised form, November 1, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Following spinal cord injury, there are numerous changes in gene expression that appear to contribute to either neurodegeneration or reparative processes. We utilized high density oligonucleotide microarrays to examine temporal gene profile changes after spinal cord injury in rats with the goal of identifying novel factors involved in neural plasticity. By comparing mRNA changes that were coordinately regulated over time with genes previously implicated in nerve regeneration or plasticity, we found a gene cluster whose members are involved in cell adhesion processes, synaptic plasticity, and/or cytoskeleton remodeling. This group, which included the small GTPase Rab13 and actin-binding protein Coronin 1b, showed significantly increased mRNA expression from 7–28 days after trauma. Overexpression in vitro using PC-12, neuroblastoma, and DRG neurons demonstrated that these genes enhance neurite outgrowth. Moreover, RNAi gene silencing for Coronin 1b or Rab13 in NGF-treated PC-12 cells markedly reduced neurite outgrowth. Coronin 1b and Rab13 proteins were expressed in cultured DRG neurons at the cortical cytoskeleton, and at growth cones along with the pro-plasticity/regeneration protein GAP-43. Finally, Coronin 1b and Rab13 were induced in the injured spinal cord, where they were also co-expressed with GAP-43 in neurons and axons. Modulation of these proteins may provide novel targets for facilitating restorative processes after spinal cord injury.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Traumatic injury to the spinal cord induces delayed biochemical responses that affect both cell loss and subsequent repair. Modulation of reparative processes includes factors involved in either facilitating or inhibiting neurite outgrowth, which are often regulated at the gene and protein levels after injury. Collectively, these factors likely determine in part the degree of anatomical and functional recovery after injury.

Regeneration-associated proteins (RAGs) appear to play a role in plasticity and regeneration following SCI.1 These include transcription factors (c-Jun), cytoskeletal components (T{alpha}1), microtubule-associated proteins, growth-associated proteins (GAP-43, CAP-23), cell adhesion molecules (N-CAM, L1, TAG1), neurotrophic factors, cytokines, and extracellular matrix components (SNAP25, munc13, and cpg15/neuritin) (1–10). In some cases, these factors share common molecular pathways. GAP-43 and CAP-23 bind downstream to the cofactor PI(4,5)P(2), at plasmalemmal rafts, contributing to the regulation of actin and modulating neurite outgrowth in neuronal-like cell lines (11, 12). In other instances, a common downstream effector, such as neurotrophin-dependent intracellular cAMP, may serve to facilitate axonal regeneration by overcoming inhibition from factors such as myelin-associated glycoprotein (MAG) (13–15).

Microarray technology provides a powerful tool for identifying molecular pathways involved in either endogenous neurotoxicity or regeneration/plasticity after SCI (16–19). It allows concurrent analysis of thousands of genes and the identification of clusters of coordinately regulated transcripts sharing similar functions.

Previously we reported early changes following spinal cord injury in rats, showing induction of specific cell cycle genes (gadd45a, c-myc, cyclin D1, and cdk4, pcna, cyclin G, Rb, and E2F5) that were closely associated with post-traumatic apoptosis (18). Here, we focused on later time points to identify genes potentially associated with neuronal plasticity and neurite outgrowth after SCI by evaluating temporal gene profiles that were coordinately regulated with expression profiles of known pro-plasticity factors. A stringent temporal correlation analysis of the profiles and subsequent functional classification allowed identification of six genes belonging to a specific gene cluster, which was overexpressed between 7 and 28 days after injury, and whose members are involved in neuronal plasticity, neurite outgrowth, and synaptogenesis. Overexpression of these genes in PC-12, SH-SY5 neuroblastoma cell lines, or DRG neurons in vitro significantly promoted neurite outgrowth. Novel members of this cluster: Coronin 1b and Rab13, were further characterized in vivo, and in vitro, and their role in neuronal differentiation and neurite outgrowth was studied using RNA interference (RNAi) gene silencing. Based upon these in vitro and in vivo observations, we propose a role for these genes in neuronal plasticity after injury.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Experimental Spinal Cord Injury and Expression Profiling
Mild contusion spinal cord injury was performed in rats, as previously described (18). Briefly, male Sprague-Dawley rats (275–325 gm) were anesthetized with sodium pentobarbital (65 mg/kg, intraperitoneal). Injury was induced using a weight drop method (10 g dropped from 17.5 mm). Animals with this injury level show mild motor impairment on the Basso, Beattie, Breshnahan scale, averaging 12 ± 1, 14 ± 1, and 17 ± 1, respectively at 7, 14, and 28 days after injury. Animals were fully anesthetized with sodium pentobarbital (67 mg/kg) during the operative procedures, and experiments complied fully with the principles set forth in the "Guide for the Care and Use of Laboratory Animals" prepared by the Committee on Care and Use of Laboratory Animals of the Institute of Laboratory Resources, National Research Council (DHEW pub. no. (NIH) 85-23, 2985).

A 1-cm section of the spinal cord, centered at T-9, was dissected, and immediately frozen in liquid nitrogen. Spinal cords were collected from 4 injured and 2 sham-operated rats (receiving only laminectomy) for each time point (4 h, 24 h, 7 days, 14 days, and 28 days (3 animals) and two naïve controls (rats that did not undergo any surgical procedure) for a total of 31 animals. Seven micrograms of total RNA was used for complementary DNA (cDNA) and biotinylated complementary RNA (cRNA) synthesis. Expression profiling analysis was performed using the Affymetrix rat U34 A, B, and C arrays. Each genechip was used for a single hybridization with RNA isolated from one spinal cord sample from a single animal. Total number of samples was 31.

Expression profiling was performed as described previously (18). Briefly, RNA was extracted from each cord sample individually using TRIzol reagent (Invitrogen) and processed for chip hybridization using the manufacturer's protocol (Affymetrix).

Microarray (Genechip) Quality Control and Normalizations
We employed stringent quality control methods as previously published and detailed on our website: (pepr.cnmcresearch.org/browse.do). Expression profiles utilized for analysis fulfilled all quality control measures as detailed in previous reports (18, 21). We used two normalization processes: one for chip-chip comparisons (scaling factors), and one for temporal analysis (normalization to the average of the naïve signal intensities for each gene). The scaling factors determinations were done using default Affymetrix algorithms (MAS 5) with a target intensity of chip sector fluorescence to 800. Both pre-amplification (s1) and post-amplification with streptavidin/phycoerythrin (s2) scans were done, and the scans compared by scatter plots and correlation coefficients. Those probe sets showing evidence of saturation of the PMT in s2 were flagged.

Data Scrubbing and Statistical Analysis
We have recently shown that use of Affymetrix MAS 5.0 signal intensity values, together with a "present call" noise filter achieves an excellent signal/noise balance relative to other probe set analysis methods (dchip, RMA) (39). Data analyses were limited to probe sets that showed one or more "present" (P "calls") in the 79 gene chip profiles in our complete dataset. Experiment normalization was performed by normalizing gene chips from injured and sham controls to the mean of the two chips from naïve animals considered as the baseline gene expression level. Normalized data were then compared for differential gene expression analysis across time points between sham and injured groups. Genes that showed a Welch analysis of variance t test p value <0.05 between sham and injured groups for at least one time point were retained for further analysis. Initial data analysis also included a fold change filter of >1.5 (50% difference) increase or decrease relative to sham operated animals (Affymetrix MAS 5.0). While a p value of <0.05 alone would give many false positives, the combination of present call filters, fold change thresholds, and p values thresholds, eliminates most false positives that are obtained with only p < 0.05.

Real Time RT-Multiplex-PCR
We studied selected transcripts by real time PCR using cDNAs extracted from cords of rats subject to spinal cord trauma and sham controls in parallel experiments, at the time point 14 days, to validate our microarrays findings. Fluorophore-labeled LUX primers (forward) and their unlabeled counterparts (reverse) were provided by Invitrogen. LUX primers were designed matching the probe sets sequences for Ninjurin, Rap1b, Rab13, and Coronin 1b and all primers were designed using the software called LUX Designer (Invitrogen, www.invitrogen.com/lux). Each primer was chosen matching the target probe set sequence for the gene of interest. More in detail, primer sequences were: Ninjurin (forward: caccttTCCTGTTCACAGCCCAAGG5G), reverse: (TCTTCATGGCTTTGCATCCAG), Rab13 (forward: cacactgAGACAAGTGCCAAATCCAGTG5G), (reverse: TCAGTGCTTGAGGGCTTGCT), Rap1b (forward: cacgaCTCCCTTGCTTGCTCG5G), (reverse: TTCCCACATTCACATCCACA), and Coronin 1b (forward: caccaTAGAGGACTGCACTGTCATGG5G), (reverse: GCACATTTCGGGCTGTGG). We performed multiplex PCR using each experimental gene with the housekeeping gene GAPDH. For each sample, as previously detailed, 50-µl PCR contained 2 µl of cDNA, 10 µM of each gene-specific primer (two pairs for multiplex PCR) and 1x Platinum Quantitative PCR SuperMix-UDG (Invitrogen). Reactions containing fluorogenic LUX primers included 1x SuperMix and were incubated at 25 °C for 2 min, 95 °C for 2 min, and then cycled (45x) using 95 °C for 15 s, 55 °C for 30 s, and 72 °C for 30 s, and reactions were incubated at 40 °C for 1 min and then ramped to 95 °C over a period of 19 min followed by incubation at 25 °C for 2 min (ramp for melting curve analysis). Reactions were conducted in a 96-well spectrofluorometric thermal cycler (ABI PRISM 7700 Sequence detector system, Applied Biosystems). Fluorescence was monitored during every PCR cycle at the annealing or extension step and during the post-PCR temperature ramp. Fold changes were calculated following the manufacturer's instructions (Invitrogen).

Immunoblotting
Cords used for immunoblotting included samples from three injured and two sham spinal cords at the time points 7 and 14 days after injury. For E14 DRGs, 500–600 DRG were isolated for each time point, and cultured in six well plates. Frozen tissues were washed once with ice-cold phosphate-buffered saline (PBS) and lysed on ice in a solution containing 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, 0.5% Nonidet P-40, 0.25% SDS, leupeptin (5 µg/ml), and aprotinin (5 µg/ml). After removal of cell debris by centrifugation, the protein concentration of the cell lysate was determined with the Bio-Rad protein assay reagent. A portion of the lysate (30–50 µg of protein) was then resolved by SDS-PAGE, and the separated proteins were transferred to a nitrocellulose filter. The filter was stained with Ponceau S to confirm equal loading and transfer of samples and was then probed with specific antibodies. Immune complexes were detected with appropriate secondary antibodies and chemiluminescence reagents (Pierce). {beta}-Actin protein abundance was used as control for gel loading and transfer.

The following primary antibodies were used: rabbit polyclonal anti-Coronin 1b (1:1000, custom antibody from Bethyl Laboratories), and rabbit polyclonal anti-Rab13 (1:1000, custom antibody from Bethyl Laboratories). Omission of the primary antibodies or their replacement by preimmune sera was used for control experiments. Immunocomplexes were visualized with ECL chemiluminescence (Amersham Biosciences).

Immunocytochemistry
Spinal Cords—12-µm frozen sections from three injured and two sham spinal cords were collected between 0.4 and 0.5 cm below or above the injury site epicenter, as previously reported (18). Sections were incubated under the same coverslip and processed for immunocytochemistry. They were first dried at room temperature, fixed in 4% paraformaldehyde, rinsed in PBS and incubated with 10% normal serum and 0.2% Triton X in PBS (goat or rabbit depending on the secondary antibodies used) for 60 min to mask nonspecific adsorption sites. Sections were then incubated overnight at 4 °C with one or more of the following primary antibodies: rabbit polyclonal anti-coronin 1b (1:100, custom antibody from Bethyl Laboratories), and rabbit polyclonal anti-rab13 (1:100, custom antibody from Bethyl Laboratories).

Omission of the primary antibodies or their replacement by preimmune sera was used for control experiments. After several rinses in PBS, the sections were incubated with the appropriate rhodamine, Alexa 488-, 568-, or 647-coupled secondary antibodies (goat anti-mouse or goat anti-rabbit) for 1 h at room temperature and washed in PBS before mounting the slides with aqueous medium. Double labeling was also performed combining mouse monoclonal anti-rat neuN (1:100, Chemicon, Temecula, CA), mouse monoclonal anti-rat {beta}-III tubulin (1:200, Promega, Madison, WI), or mouse monoclonal or rabbit polyclonal anti-GFAP (1:200, Chemicon); mouse monoclonal anti-rat myelin/oligodendrocyte O4 (1:100, US Biological); mouse anti-rat CD11b (1:100, Serotec, Oxford, UK), and mouse monoclonal or rabbit polyclonal anti-GAP-43 (1:200, Chemicon), with each of the above antibodies. Immunofluorescence was detected using confocal microscopy (Zeiss Inc.).

Dorsal Root Ganglia (DRG) Neurons—E14 dorsal root ganglia cells cultured in Neurobasal medium onto glass coverslips (circular, 13 mm in diameter) coated with poly-D-lysine and laminin (Biomedical Technologies Inc.) in 24-well plates at a density of 2.5 x 104 cells/well, were fixed after 3, 5, 7, 9, and 14 days in culture, and processed for immuncytochemistry as described above for spinal cord tissue.

Primary antibodies used included Coronin 1b, and Rab13, (same dilutions as above). Each one of them was combined in double immunostaining experiments with either mouse monoclonal or rabbit polyclonal GAP-43 or with Alexa Fluor 568 phalloidin for detection of F-actin (Molecular Probes). The same secondary antibodies used for spinal cord sections were employed in these experiments. Immunofluorescence was detected using deconvolution microscopy (Zeiss Inc.).

Clones and Transfection Experiments
Ninjurin, Rab13, Rap1b, Synaptogyrin, Synaptotagmin, and Coronin 1b, full-length cDNA expression constructs in pCMV SPORT6 were purchased from Invitrogen Inc. (respectively, IMAGE LLAM clones 2596463; 3908502; 6150381; 5173992; and GATEWAY Human clones CSODG004YH12; CSODD003YH09).

PC-12 and SH-SY5 neuroblastoma cells were cultured in Dulbecco's modified Eagle's medium plus 10% fetal bovine serum. Embryonic day 14 DRG neurons were removed and dissociated as previously described (40). Briefly, E14 embryos were collected and placed in cold L-15 medium, the head and tail removed, and skin overlaying the spinal cord cut. The spinal cord with DRG attached was removed using fine curved forceps, the ganglia isolated, and excess meninges trimmed. Ganglia were suspended in L-15 medium containing 0.25% trypsin and incubated at 37 °C for 15 min, fetal bovine serum was added to 10% final concentration, washed, then dissociated by titration with a fire-polished pipette. DRG neurons were cultured in Neurobasal medium (Invitrogen, Life Technologies, Inc.) supplemented with B-27, 2 mM L-glutamine, 50 units penicillin-streptomycin, and 50 µg/ml of NT3. Some cultures were treated with 1 x 10–5 flurodeoxyuridine, 1 x 10–5 uridine 24 h after plating for 2 days to reduce non-neuronal cells. Cells were transfected after 7 days in culture. For transfection, cells were seeded onto glass coverslips (circular, 13 mm in diameter) coated with poly-D-lysine and laminin (Biomedical Technologies Inc.) in 24-well plates at a density of 2.5 x 104 cells/well and cultured for 72 h. Transfection experiments were performed using the NeuroPORTER transfection kit (Sigma) for DRGs, and using Lipofectamine 2000 for PC-12 and SH-SY5 cells (Invitrogen). Recombinant plasmid DNA encoding GFP was included in transfections to monitor transfected cells. Cells were stained with both {beta}-III tubulin and GAP-43 (Chemicon) antibodies to identify both cell body and processes of neurons undergoing plasticity. Neurite outgrowth was evaluated measuring the neurite length of the longest neurite per cell counting only processes positive for GFP, {beta}-III tubulin, and GAP-43 for DRGs, and measuring the number of PC-12 and SH-SY5 cells with neurites at least 2 times the length cell body. Measurements were conducted in three different experiments by two different operators. Cells were viewed using a CCD camera and analyzed with image analysis software AxioVision 3.1 (Zeiss).

RNA Interference Experiments
Complementary hairpin oligonucleotides were designed using the "siRNA Converter" Internet tool (Ambion), annealed, and cloned between BamHI and HindIII restriction sites in pSilencerTM 3.1-H1/neo (Ambion) according to the manufacturer's recommendations. The oligonucleotide sequences were as follows (sense and antisense, respectively): rat Coronin 1b 5'-GATCCCAAGTTGTGCGGCAGAGCAATTCAAGAGATTGCTCTGCCGCACAACTTTTTTTTGGAAA A-3' and 5'-GCTTTTCCAAAAAAAAGTTGTGCGGCAGAGCAATCTCTTGAATTGCTCTGCCGCACAACTTGG-3'; and rat Rab13 5'-GATCCCGATCCGAACTGTGGAAATATTCAAGAGATATTTCCACAGTTCGGATCTTTTTTGGAAA-3', and 5'-AGCTTTTCCAAAAAAGATCCGAACTGTGGAAATATCTCTTGAATATTTCCACAGTTCGGATCGG-3'. Oligonucleotides were transfected along with eGFP plasmid DNA using Lipofectamine 2000 (Invitrogen) for experimental samples, and with eGFP plus naked DNA for control cells. We also employed scrambled siRNA sequences to control for the specificity of the silencing effect (data not shown, SilencerTM Negative Control, Ambion). Inhibitory effect of RNA interference on expression of Coronin 1b was tested in transiently transfected PC-12 cells during NGF treatment (50 ng/ml) by Western blotting and immunofluorescence staining using anti-rat Coronin antibodies (custom antibodies, Bethyl Laboratories). Cells positive for eGFP and negative for Coronin or Rab13 staining were compared with control cells positive for both eGFP and Coronin or Rab13, and were selected for evaluation of neurite outgrowth, measuring the length of the longest neurite per cell as detailed in previous section.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Identification of Putative Pro-plasticity Gene Cluster Induced between 7 and 28 Days following SCI—Approximately 24,000 probe sets were examined using Affymetrix high density oligonucleotides arrays (U34 A, B, and C chips) at 4 h, 24 h, 7 days, 14 days, or 28 days after SCI. We applied a present call noise filter (1 in 79 arrays), fold change thresholds (>1.5), and a p value of less than 0.05 as our initial data set for preliminary analysis and pathway identification. This analysis led to further consideration of about 6000 transcripts, of which 5% would be expected to be false positives. Files from all 79 arrays are available from our website, including *.dat, *.cel, and *.txt files (pepr.cnmcresearch.org/browse.do). This website includes an on-line time series query tool of this data set (pepr.cnmcresearch.org/jsp/searchForm.jsp). The spreadsheets showing all genes profiling preliminary analysis criteria are also available on the website. A more complete analysis of the global gene changes has also been previously reported by us (18).

Among the significantly altered transcripts, we searched for transcripts previously implicated in neuronal-axonal repair and plasticity after injury. We identified a transcript corresponding to Ninjurin (nerve injury-induced protein), a cell adhesion molecule that is up-regulated after axotomy in neurons and in Schwann cells surrounding the distal nerve segment, and promotes neurite extension of dorsal root ganglion neurons in vitro (20). We then used Ninjurin as an "anchor gene" to fish out a cluster of temporally correlated genes that could potentially have a similar function that is involved in neuronal plasticity after SCI. We used the gene array analysis software GeneSpring (as previously detailed, Refs. 18 and 21) that allows identification of gene profiles with similar temporal regulation, and identified a cluster of temporally correlated genes (correlation coefficient, R2 = 0.98) overexpressed between 7 and 28 days after injury, that included 20 transcripts. Functional classification showed that this group of genes was variably associated with immune response, cell adhesion, axon migration, polarity, growth, guidance, dendrite elaboration, plasticity, and synapse formation (Table I). To further narrow the field to identify a more specific group of temporally correlated transcripts, we performed a more stringent correlation analysis using both Standard and Pearson correlation (R2 = 0.99), which identified five genes other than Ninjurin: Coronin 1b, Rab13, Synaptogyrin, and Synaptotagmin (Fig. 1). Synaptic vesicles associated proteins Synaptotagmin and Synaptogyrin have been localized at the synaptic terminals in several neuronal types and in PC-12 cells, and play a role in synaptic plasticity, neurotransmitter release and neurite outgrowth (for review, see Refs. 22–24). Rap1 is a small GTPase involved in several signal transduction pathways, and is induced by NGF in PC12 cells and is necessary for neurite outgrowth (25, 26). Coronin 1b is an actin-binding protein involved in cytoskeleton remodeling (for review, see Ref. 27), Rab13 is another small GTPase, belonging to the rab family of proteins, which plays a role also in cytoskeleton dynamics and vesicle transport (for review, see Ref. 28). Analogs of Coronin 1b (cilpin C) and a Rab family member (Rab8) have also been localized at cellular protrusions, and neurite tips in PC-12 and SH-SY5 cells (29, 30). Therefore, based upon their temporal co-regulation with the other members of the cluster, and upon their known or putative biological function, Coronin 1b, and Rab13 appeared to be factors involved in neurite outgrowth and differentiation.


View this table:
[in this window]
[in a new window]
  		TABLE I
Comparison of expression levels between sham and injured cords for Ninjurin cluster transcripts induced 14 days after SCI

These transcripts represent genes that are temporally co-regulated with Ninjurin gene based upon a standard correlation coefficient R2 of 0.98. GenBankTM gene names, fold changes, and p values are reported for each transcript.

 



View larger version (44K):
[in this window]
[in a new window]
  		FIG. 1.
Dendogram showing temporally co-regulated transcripts induced between 7 and 28 days after SCI. Shown is a dendogram (gene tree) obtained using Ninjurin as anchor gene to nucleate co-regulated transcripts based upon a correlation coefficient R2 of 0.99 (both Standard and Pearson correlation). Expression levels in sham and injured cords at different time points after SCI are represented with a specific color code. Bar graph on the right shows the color code for gene expression level from low (blue) to high (red). These transcripts are up-regulated between 7 and 28 days after SCI (asterisk indicates a Welch t test p value <0.05 between sham and injured at the corresponding time point).

 
Real Time PCR Confirmed Microarray Results—Real time PCR experiments using cDNAs from a parallel set of animals at 14 days after SCI was performed on several members of the gene cluster to validate results obtained by microarrays. The transcripts included Ninjurin, Rap1b, Synaptotagmin, Coronin 1b, and Rab13. PCR experiments confirmed that all mRNAs were increased after injury (Table II). Gene changes ranged between about 1.5- and 2.6-fold changes in microarray experiments, whereas a wider range of changes was present after real time PCR, because of the extreme sensibility of this technique, from about 2–7.6-fold changes.


View this table:
[in this window]
[in a new window]
  		TABLE II
Comparison of mRNA changes by Affymetrix and real time RT-PCR for several transcripts up-regulated 14 days following SCI

 
In Vitro Overexpression of Selected Gene Cluster Members in PC-12, SH-SY5 Neuroblastoma, and DRG Cells Promotes Neurite Outgrowth—In order to evaluate whether gene cluster members Ninjurin, Rap1b, Synaptogyrin, Synaptotagmin, Coronin 1b, and Rab13 were involved in neuronal plasticity, we tested them using in vitro assays. We transfected plasmid cDNAs for each gene and overexpressed them in the neuronal-like cell lines PC-12, and SH-SY5 neuroblastoma cells, as well as in rat primary DRGs, evaluating neurite outgrowth by measuring the longest neurite per cell, and the number of neurite branches. Percentage of cells with neurites lengths at least two times the cell bodies were evaluated in PC-12 and SH-SY5 neuroblastoma cells. Neurite length as percentage of length in control cells was measured in DRG-transfected cells. Transfected genes promoted neurite outgrowth in the two cell lines (Fig. 2, panels A and B), as well as in DRGs (Fig. 2, panel C). These data confirmed and extended previous findings for Ninjurin, Rap1, Synaptotagmin, and Synaptogyrin, which suggested a possible role for these factors in neurite extension and neuronal differentiation; they also suggested a novel function for Coronin 1b, and Rab13 in neurite outgrowth. The greatest effect on neurite outgrowth was achieved with Ninjurin, Rab13, and Coronin 1b. Ninjurin increased the number of cells with extended neurites by 2.3-fold in PC-12 cells and by 5.2-fold in SH-SY5 neuroblastoma cells. Rab13 overexpression resulted in 2.7- and 9-fold increase, respectively, in PC-12 and SH cells. Coronin 1b induced a 2.4-fold increase in PC-12 and 5.4 in SH cells. Experiments in primary neuronal cells, such as DRGs, also confirmed the significant effect of these genes on neurite outgrowth. Ninjurin increased neurite length by 52%, Rab13 by 54%, and Coronin 1b by 63% (Fig. 2). The number of neurite branches was not affected by transfections.



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 2.
Overexpression of Ninjurin cluster members in PC-12, neuroblastoma SH-SY5 cells, and DRG neurons promotes neurite outgrowth. Shown are bar graphs documenting increased neurite length of eGFP-positive cells after co-transfection with eGFP, and respectively with Ninjurin; Rab13; Coronin 1b; Rap1b; Synaptogyrin; Synaptotagmin in PC-12 cells (panel A), in SH-SY5 neuroblastoma cells (panel B), and DRG neurons (panel C). Bar graphs show difference in neurite outgrowth between cells transfected with eGFP plus naked DNA, and eGFP plus each experimental gene 72 h after transfection (panels A–C). Number of transfected cells with neurites at least 2x the diameter of the cell body is reported for PC-12 (panel A), and SH-SY5 neuroblastoma cells (panel B). Length of the longest neurite per cell was measured for DRG neurons and neurite length in Ninjurin-, Coronin-, and Rab13-transfected cells was compared with control GFP-transfected cells and expressed as percentage of control (panel C). For all experiments, asterisks represent significant t test p values <0.01.

 
Expression of Rab13 and Coronin 1b in Cultured DRG Neurons—Further in vitro and in vivo experiments were conducted for Coronin 1b and Rab13, whose roles in the nervous system are still largely unknown. To verify if Coronin 1b and Rab13 protein expression were regulated during neurite outgrowth in cultured DRG neurons, we performed immunoblotting experiments in E14 DRG cells from days 1–7. Coronin 1b and Rab13 expression were strongly induced between 1 and 3 days (Fig. 3). Immunofluorescence experiments at days 1, 3, 5, 7, 9, and 14 in culture showed expression for Coronin 1b and Rab13 in the cytoplasm, and in particular at the cortical cytoskeleton as shown by co-localization with F-actin (data not shown); they were also found at the neurite terminals and growth cone, where staining pattern suggested co-localization with the proplasticity/regeneration marker GAP-43 (Fig. 4). Consistent with immunoblot experiments, an increased immunofluorescence signal was detected for both proteins between days 1 and 3. No difference in the intensity of the staining was observed beyond day 3 (data not shown).



View larger version (120K):
[in this window]
[in a new window]
  		FIG. 3.
DRG neurons time course shows increased neurite outgrowth and increased protein expression from days 1–3 and day 7 for Coronin 1b and Rab13. Panels A–C, phase contrast images of representative DRG neurons in culture at days 1, 3, and 7. Shown is increased neurite outgrowth in DRG neurons from day 1 to days 3 and 7. Panel D, shown is immunoblotting for Coronin 1b and Rab13 in E14 DRG neurons in culture in the time course 1, 3, and 7 days. Expression for Coronin 1b and Rab13 is strongly increased by day 3 in culture in DRG neurons. Thirty micrograms of proteins were run on a 12% polyacrylamide gel for each sample. {beta}-Actin is shown as loading control.

 



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 4.
Immunocytochemistry shows expression and localization of Rab13 and Coronin 1b in GAP-43-positive cultured DRG neurons. Shown is co-localization for Coronin 1b (panels A and D) with GAP-43 (panels B and E), merged (panels C and F), and for Rab 13 (panels G and J) with GAP-43 (panels H and K), merged (panels I and L) in 7-day-old DRG neurons in culture. Staining for both Coronin 1b, Rab 13, and GAP-43 shows cytoplasmic localization in the cell body and expression in neurites, including at the growth cone (labeled with G: panels A–C and G–I). Panels D–F, and J–L are magnification of the growth cone (G) from panels A–C, and G–I. Visible is the typical dotted staining at the growth cone for GAP-43, as well as for Coronin 1b and Rab13. Original magnification: x400 (panels A–C and G–I); x850 (panels D–F and G–L)

 
RNA Interference Experiments Show That Coronin 1b and Rab13 Repression Inhibit Neurite Extension in PC-12 Cells after NGF—To examine whether members of this gene cluster were involved in neurite outgrowth during differentiation, we performed gene silencing experiments using RNAi for Coronin 1b and Rab13 in PC-12 cells treated with NGF. Coronin 1b and Rab13 RNAi gene silencing, which resulted in strong reduction of protein expression (Fig. 5, panels A and C) significantly reduced the extent of neurite outgrowth in PC-12 cells after NGF treatment by 53 and 44%, respectively (Fig. 5, panels B and D).



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 5.
RNA interference shows reduction of Coronin 1b and Rab13 protein levels, and inhibition of neurite outgrowth in PC-12 after NGF. Shown is the effect of Coronin 1b and Rab13 RNAi upon Coronin and Rab13 protein expression and neurite elongation in PC-12 cells after NGF. Immunoblotting shows strong reduction of Coronin 1b (panel A) and Rab13 (panel C) expression after siRNA delivery in PC-12 cells. {beta}-Actin is shown for protein normalization. Bar graphs show the inhibitory effect of Coronin 1b (panel B), and Rab13 (panel D) siRNA delivery upon neurite length during NGF treatment (72 h). Bar graphs represent neurite length (measuring the length of the longest neurite per cell) expressed as percentage of neurite length in controltransfected cells (eGFP). Experimental cells were transfected with either Coronin or Rab13 siRNA and eGFP. Cells considered in the measurements were cells positive for GFP, and with no immunoreactivity for Coronin 1b or Rab13 staining, because of the gene silencing effect, compared with control cells positive for GFP and either Coronin 1b or Rab13 (asterisk, t test p values <0.01). Neurite lengths are reduced to 53% of control in Coronin 1b-silenced cells and to 44% in Rab13 RNAi experiments.

 
Coronin 1b, and Rab13 Protein Expression Is Induced after SCI Preferentially in Neurons and Axons Undergoing Plasticity— The combination of the gene expression changes in vivo and the findings from the experiments in vitro suggested that these genes and proteins may modulate neural plasticity in the spinal cord after injury. In accordance with gene array experiments, we examined changes in protein expression by immunoblotting for Coronin 1b and Rab13 in injured spinal cord at 7 and 14 days post-trauma and compared them to corresponding sham samples. Both proteins were similarly increased after injury at these time points (Fig. 6). We then studied expression of these proteins at the cellular level by immunofluorescence in sham and injured spinal cords 14 days after injury. The proteins were co-examined with cell specific markers for neurons (anti-NeuN, and anti-{beta}-III tubulin antibody), astrocytes (anti-GFAP), oligodendrocytes (anti-O2), and microglia (anti-CD11). Increased expression for Coronin 1b and Rab13 were found after injury (Fig. 7, A and B), primarily in the cell membrane and cytoplasm, and showed a preferential localization in neurons. Only weak expression was detected in astrocytes or in microglial cells (data not shown).



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 6.
Immunoblotting shows induction of Coronin 1b, and Rab13 protein expression at 7 and 14 days following SCI. Immunoblotting at 7 and 14 days after SCI in sham and injured cords in duplicate shows increased expression for Coronin 1b and Rab13 in injured cords. Fifty micrograms of protein were loaded on a 12% polyacrylamide gel for each sample. {beta}-Actin is shown for protein normalization.

 



View larger version (39K):
[in this window]
[in a new window]
  		FIG. 7.
Immunocytochemistry shows induction of Coronin 1b and Rab 13 protein expression in neurons at 14 days following SCI. Double immunofluorescence in cross sections of spinal cord (ventral horns, 0.4–0.5 cm below the injury site epicenter) shows staining for Coronin 1b (A), Rab 13 (B), and neuronal marker NeuN. Coronin 1b, and Rab 13 (panels B and E) co-localize with NeuN (panels A and D), merged (panels C and F) in sham (panels A and C) and injured cords (panels D and E) 14 days after SCI. Coronin 1b, and Rab 13 expression in neurons is much more intense in injured than in sham cords. Original magnification: x125.

 
To study the possible involvement of these proteins in neuronal and axonal plasticity, we examined the degree of Coronin 1b, and Rab13 co-expression and co-localization with the well established pro-plasticity/regeneration protein GAP-43. Using confocal microscopy, immunofluorescence experiments showed that the proteins were highly expressed in GAP-43-positive neurons and axons after injury, including expression in dorsal root ganglia, and each likely co-localized with GAP-43 (Fig. 8).



View larger version (99K):
[in this window]
[in a new window]
  		FIG. 8.
Immunocytochemistry shows co-localization of Coronin 1b, and Rab13 with GAP-43 in neurons and axons in dorsal root ganglia and dorsal horns in injured cords 14 days after SCI. Confocal microscopy immunofluorescence images show expression of Coronin 1b and Rab13 along with pro-plasticity marker GAP-43 in dorsal root ganglia, and dorsal horns of spinal cord 14 days following SCI (0.4–0.5 cm below the injury site epicenter). A, cross-sections of dorsal root ganglia fibers are positively stained for Coronin 1b (panel A), and for GAP-43 (panel B), and show membrane co-localization in all fibers (merged, panel C). Cross-sections of spinal cord (dorsal horns) show expression of Coronin 1b plus NeuN (panel D, red nuclear staining for NeuN and green cytoplasmic and membrane staining for Coronin 1b.), GAP-43 (panel E), and Coronin 1b plus GAP-43 (merged, panel F). Coronin 1b and GAP-43 co-expression and co-localization is shown in neurons (arrowhead, panel F) and axons (arrows, panel F) in cytoplasm and membrane. Immunostaining for neuronal membrane-specific marker {beta}-III tubulin was also performed, and showed an identical ring-like expression pattern (panel F, arrows) in the same cross-sections (not shown). B, cross-sections of dorsal root ganglia fibers are positively stained for Rab13 (panel A), and for GAP-43 (panel B), and merged (panel C). Rab13 shows membrane co-localization with GAP-43 in fibers (arrows, panel C), and cytoplasmic and membrane co-expression in a cell body (arrowhead, panel C). Cross-sections of spinal cord (dorsal horns) show expression of Rab13 plus NeuN (panel D, red nuclear staining for NeuN and green cytoplasmic and membrane staining for Rab13), GAP-43 (panel E), and Rab13 plus GAP-43 (merged, panel F). Rab13, and GAP-43 co-expression and co-localization are shown in neurons (arrowhead, panel F) and axons (arrows, panel F) in cytoplasm and membrane. Original magnification: x400.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Using a hypothesis-driven approach, combined with specific bioinformatics tools to analyze coordinated gene expression profiles, we have identified a cluster of genes induced between 7 and 28 days after experimental rat SCI, which appear to play a role in neuronal plasticity and neurite outgrowth. These genes include Ninjurin, Coronin 1b, Rab13, Synaptogyrin, Synaptotagmin 1, and Rap1b (Fig. 1), which can be classified into several functional classes: cytoskeleton remodeling, growth cone formation, axonal plasticity, cell adhesion activity, and synaptogenesis. We have validated and quantified the mRNA levels for a subset of these genes (Ninjurin, Rab13, Coronin 1b, Rap1b, and Synaptogyrin) by real time RT-PCR in vivo at 14 days after injury, confirming microarray results (Table II).

Certain of these genes, Ninjurin, Synaptotagmin, Synaptogyrin, and Rap1b, have already been partially characterized in vitro and/or in vivo, and have been implicated in axonal outgrowth, synaptic plasticity, and regeneration (20, 22–26, 33). Synaptotagmin and Synaptogyrin are active throughout the entire synapse formation process, being involved in vesicle docking, exocytosis, and endocytosis of synaptic vesicles- and contribute to neurite extension (22, 33). Rap1b is a small GTPase belonging to Ras superfamily of proteins, whose members may be involved in growth cone elongation, are induced by NGF, and can promote neurite outgrowth (34). Rap1 itself plays a role in the activation of the NGF-dependent ERK pathway, leading to axonal elongation in PC-12 cells (26). The cell adhesion molecule Ninjurin has also been reported to be induced by peripheral nerve injury, and promotes axonal and neurite outgrowth in sciatic nerve and DRG neurons following injury (20, 35).

Neither Coronin 1b nor Rab13 have been studied in the nervous system, nor have they been implicated in plasticity or neurite sprouting. Rab13 is a small GTPase, a ras superfamily member, which regulates intracellular vesicle trafficking to and from the plasma membrane, and mediates exocytosis within the trans-Golgi network (TGN) (28). Interestingly, Rab8, an analog to Rab13, also belonging to TGN network, has been found on cellular protrusions at the cortical cytoskeleton, and is co-localized with actin filaments (30). Coronin 1b is an actin-binding protein, belonging to the Coronin family, and may bind also to tubulin (27). It is important in cytoskeleton remodeling, lamellipodia extensions and mitosis; moreover, Coronin 1b is localized to the cortical cytoskeleton, where it is co-localized with F-actin (36, 37). It is known that cytoskeletal organization and remodeling are essential cellular modifications during sprouting and axonal elongation (for review, see Ref. 38). Importantly, cilpin C, a human Coronin-like homolog protein, which is highly expressed in brain, has been identified in stress fibers and neurite tips in SH-SY5 neuronal cells during neurite outgrowth (29).

Based upon these functional features of the identified gene cluster, transfection experiments were performed in PC-12, SH neuroblastoma neuronal like cell lines, as well as in DRG neurons, in order to examine whether expression of these genes promote neurite elongation or sprouting. While expression of each of these genes enhanced neurite outgrowth, Ninjurin, Rab13, and Coronin 1b were most effective. Moreover, Coronin 1b, and Rab13 RNAi experiments in PC-12 cells showed that inhibition of Coronin 1b, and Rab13 protein expression reduced neurite outgrowth after NGF treatment. While Rab13 gene knockout has never been reported before, previous work in Dictyostelium discoideum, showed that mutant cells lacking Coronin grow and migrate more slowly than wild-type cells, probably by affecting cytokinesis (31). Also, in vertebrate cells Coronin expression at lamellipodia was disrupted by overexpression of truncated mutants, inhibiting cell spreading and locomotion (32).

In cultured DRG neurons, Coronin 1b, and Rab13 were also co-expressed with GAP-43 at neurite terminals and growth cones, and their expression increased during the first days in culture along with the increase in neurite outgrowth. Parallel studies in vivo demonstrated that Coronin 1b, and Rab13 protein expression were increased at both 7 and 14 days after rat SCI. They were primarily expressed in neurons, although low level of expression was also present in astrocytes. Moreover, they were co-expressed and likely co-localized with the pro-regeneration marker GAP-43 in neurons and axonal membranes throughout the spinal cord, as well as in DRGs. The possible functional relationship between cytoskeleton and membrane-bound proteins Coronin 1b, Rab13 with GAP-43 is also supported by the fact that GAP-43 itself accumulates in the pseudopods of spreading cells and interacts with cortical actin-containing filaments and the cell membrane at the growth cones (11).

Taken together, these data support a role for Coronin 1b and Rab13 in neuronal and axonal plasticity. For most effective regeneration to occur after injury, multiple molecular pathways may need to operate together in a coordinated fashion. These include the ability of the damaged axons to extend the growth cone, to make cell contacts with the extracellular matrix (guidance), to form connections with nearby cells, and to achieve functional synapses. The genes and proteins in the gene cluster here described play a known or putative role in several of the above mechanisms; together their coordinated action may induce more effective plasticity and regeneration than that resulting from expression of a single protein.


   FOOTNOTES
 
* This work was supported by National Institutes of Health Contract NIH-NINDS-01 (NS-1-2339) (to A. I. F. and E. P. H.), and a National Institutes of Health Programs in Genomic Applications Grant U01 HL66614 HOPGENE (to E. P. H.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

These authors equally contributed to this work. Back

|| To whom correspondence may be addressed: Dept. of Neuroscience, Georgetown University School of Medicine, 3900 Reservoir Rd., NW, Washington, D. C. 20057. E-mail: sd69{at}georgetown.edu. ** To whom correspondence may be addressed: Dept. of Neuroscience, Georgetown University School of Medicine, 3900 Reservoir Rd., NW, Washington, D. C. 20057. E-mail: fadena{at}georgetown.edu.

1 The abbreviations used are: SCI, spinal cord injury; PBS, phosphate-buffered saline; DRG, dorsal root ganglia; RT, reverse transcription; NGF, nerve growth factor; RNAi, RNA interference; eGFP, enhanced green fluorescent protein. Back


   ACKNOWLEDGMENTS
 
We thank Bogdan Stoica for assistance using confocal microscope.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Aigner, L., and Caroni, P. (1993) J. Cell Biol. 23, 417–429
  2. Ernfors, P., Rosario, C. M., Merlio, J. P., Grant, G., Aldskogius, H., and Persson, H. (1993) Brain Res Mol Brain Res. 17, 217–226[Medline] [Order article via Infotrieve]
  3. Gloster, A., Wu, W., Speelman, A., Weiss, S., Causing, C., Pozniak, C., Reynolds, B., Chang, E., Toma, J. G., and Miller, F. D. (1994) J. Neurosci. 14, 7319–7330[Abstract]
  4. Koliatsos, V. E., Cayouette, M. H., Berkemeier, L. R., Clatterbuck, R. E., Price, D. L., and Rosenthal, A. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 3304–3308[Abstract/Free Full Text]
  5. Aigner, L., Arber, S., Kapfhammer, J. P., Laux, T., Schneider, C., Botteri, F., Brenner, H. R., and Caroni, P. (1995) Cell 83, 269–278[CrossRef][Medline] [Order article via Infotrieve]
  6. Murphy, P. G., Grondin, J., Altares, M., and Richardson, P. M. (1995) J. Neurosci. 7, 5130–5138
  7. Herdegen, T., Skene, P., and Bahr, M. (1997) Trends Neurosci. 20, 227–231[CrossRef][Medline] [Order article via Infotrieve]
  8. Jung, M., Petrausch, B., and Stuermer, C. A. (1997) Mol. Cell Neurosci. 9, 116–131[CrossRef][Medline] [Order article via Infotrieve]
  9. Diaz, E., Ge, Y., Yang, Y. H., Loh, K. C., Serafini, T. A., Okazaki, Y., Hayashizaki, Y., Speed, T. P., Ngai, J., and Scheiffele, P. (2002) Neuron 36, 417–434[CrossRef][Medline] [Order article via Infotrieve]
  10. Li, S., and Strittmatter, S. M. (2003) J. Neurosci. 23, 4219–4227[Abstract/Free Full Text]
  11. Laux, T., Fukami, K., Thelen, M., Golub, T., Frey, D., and Caroni, P. (2000) J. Cell Biol. Jun 26; 149, 1455–1472
  12. Caroni, P. (2001) EMBO J. 20, 4332–4336[CrossRef][Medline] [Order article via Infotrieve]
  13. Cai, D., Deng, K., Mellado, W., Lee, J., Ratan, R. R., and Filbin, M. T. (2002) Neuron 35, 711–719[CrossRef][Medline] [Order article via Infotrieve]
  14. Qiu, J., Cai, D., Dai, H., McAtee, M., Hoffman, P. N., Bregman, B. S., and Filbin, M. T. (2002) Neuron 34, 895–903[CrossRef][Medline] [Order article via Infotrieve]
  15. Snider, W. D., Zhou, F. Q., Zhong, J., and Markus, A. (2002) Neuron 35, 13–16[CrossRef][Medline] [Order article via Infotrieve]
  16. Carmel, J. B., Galante, A., Soteropoulos, P., Tolias, P., Recce, M., Young, W., and Hart, R. P. (2001) Physiol Genomics. 7, 201–213[Abstract/Free Full Text]
  17. Song, G., Cechvala, C., Resnick, D. K., Dempsey, R. J., and Rao, V. L. (2001) J. Neurochem. 79, 804–815[CrossRef][Medline] [Order article via Infotrieve]
  18. Di Giovanni, S., Knoblach, S. M., Brandoli, C., Aden, S. A., Hoffman, E. P., and Faden, A. I. (2003) Ann. Neurol. 53, 454–468[CrossRef][Medline] [Order article via Infotrieve]
  19. Bareyre, F. M., and Schwab, M. E. (2003) Trends Neurosci. 26, 555–563[CrossRef][Medline] [Order article via Infotrieve]
  20. Araki, T., and Milbrandt, J. (1996) Neuron 7, 353–361
  21. Di Giovanni, S., Molon, A., Broccolini, A., Melcon, G., Mirabella, M., Hoffman, E. P., and Servidei, S. (2004) Ann. Neurol. 5, 195–206
  22. Sudhof, T. C. (2004) Annu. Rev. Neurosci. 27, 509–547[CrossRef][Medline] [Order article via Infotrieve]
  23. Fukuda, M., and Mikoshiba, K. (2000) Neurosci. Lett. 295, 33–36[CrossRef][Medline] [Order article via Infotrieve]
  24. Janz, R., Sudhof, T. C., Hammer, R. E., Unni, V., Siegelbaum, S. A., and Bolshakov, V. Y. (1999) Neuron 24, 687–700[CrossRef][Medline] [Order article via Infotrieve]
  25. Lu, L., Anneren, C., Reedquist, K. A., Bos, J. L., and Welsh, M. (2000) Exp. Cell Res. 259, 370–377[CrossRef][Medline] [Order article via Infotrieve]
  26. Anneren, C., Reedquist, K. A., Bos, J. L., and Welsh, M. (2000) J. Biol. Chem. 275, 29153–29161[Abstract/Free Full Text]
  27. de Hostos, E. L. (1999) Trends Cell Biol. 9, 345–350[CrossRef][Medline] [Order article via Infotrieve]
  28. Tang, B. L. (2001) J. Neurochem. 79, 923–930[CrossRef][Medline] [Order article via Infotrieve]
  29. Nakamura, T., Takeuchi, K., Muraoka, S., Takezoe, H., Takahashi, N., and Mori, N. (1999) J. Biol. Chem. 274, 13322–13327[Abstract/Free Full Text]
  30. Hattula, K., Furuhjelm, J., Arffman, A., and Peranen, J. (2002) Mol. Biol. Cell 13, 3268–3280[Abstract/Free Full Text]
  31. de Hostos, E. L., Rehfuess, C., Bradtke, B., Waddell, D. R., Albrecht, R., Murphy, J., and Gerisch, G. (1993) J. Cell Biol. 120, 163–173[Abstract/Free Full Text]
  32. Mishima, M., and Nishida, E. (1999) J. Cell Sci. 112, 2833–2842[Abstract]
  33. Detrait, E. R., Yoo, S., Eddleman, C. S., Fukuda, M., Bittner, G. D., and Fishman, H. M. (2000) J. Neurosci. Res. 62, 566–573[CrossRef][Medline] [Order article via Infotrieve]
  34. Mochizuki, N., Yamashita, S., Kurokawa, K., Ohba, Y., Nagai, T., Miyawaki, A., and Matsuda, M. (2001) Nature 411, 1065–1068[CrossRef][Medline] [Order article via Infotrieve]
  35. Long, K. E., and Lemmon, V. (2000) J. Neurobiol. 44, 230–245[CrossRef][Medline] [Order article via Infotrieve]
  36. Humphries, C. L., Balcer, H. I., D'Agostino, J. L., Winsor, B., Drubin, D. G., Barnes, G., Andrews, B. J., and Goode, B. L. (2002) J. Cell Biol. 159, 993–1004[Abstract/Free Full Text]
  37. Oku, T., Itoh, S., Okano, M., Suzuki, A., Suzuki, K., Nakajin, S., Tsuji, T., Nauseef, W. M., and Toyoshima, S. (2003) Biol. Pharm. Bull. 26, 409–416[CrossRef][Medline] [Order article via Infotrieve]
  38. Dent, E. W., and Gertler, F. B. (2003) Neuron 40, 209–227[CrossRef][Medline] [Order article via Infotrieve]
  39. Seo, J., Bakay, M., Chen, Y. W., Hilmer, S., Shneiderman, B., and Hoffman, E. P. (2004) Bioinformatics 20, 2534–2544[Abstract/Free Full Text]
  40. Fedoroff, S., and Richardson, A. (2001) Protocols for Neural Cell Culture, 3rd Ed., pp. 95–100, Humana Press, Totowa, NJ

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
H. Nakatsuji, N. Nishimura, R. Yamamura, H.-o. Kanayama, and T. Sasaki
Involvement of Actinin-4 in the Recruitment of JRAB/MICAL-L2 to Cell-Cell Junctions and the Formation of Functional Tight Junctions
Mol. Cell. Biol., May 15, 2008; 28(10): 3324 - 3335.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
R. Yamamura, N. Nishimura, H. Nakatsuji, S. Arase, and T. Sasaki
The Interaction of JRAB/MICAL-L2 with Rab8 and Rab13 Coordinates the Assembly of Tight Junctions and Adherens Junctions
Mol. Biol. Cell, March 1, 2008; 19(3): 971 - 983.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
L. Cai, A. M. Makhov, and J. E. Bear
F-actin binding is essential for coronin 1B function in vivo
J. Cell Sci., May 15, 2007; 120(10): 1779 - 1790.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Biol.Home page
C. D. Knights, J. Catania, S. D. Giovanni, S. Muratoglu, R. Perez, A. Swartzbeck, A. A. Quong, X. Zhang, T. Beerman, R. G. Pestell, et al.
Distinct p53 acetylation cassettes differentially influence gene-expression patterns and cell fate
J. Cell Biol., May 22, 2006; 173(4): 533 - 544.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
T. Terai, N. Nishimura, I. Kanda, N. Yasui, and T. Sasaki
JRAB/MICAL-L2 Is a Junctional Rab13-binding Protein Mediating the Endocytic Recycling of Occludin
Mol. Biol. Cell, May 1, 2006; 17(5): 2465 - 2475.
[Abstract] [Full Text] [PDF]