JBC GenomeOne product landing page

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M502038200 on June 7, 2005

J. Biol. Chem., Vol. 280, Issue 31, 28177-28185, August 5, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
280/31/28177    most recent
M502038200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tykocinski, L.-O.
Right arrow Articles by Radbruch, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tykocinski, L.-O.
Right arrow Articles by Radbruch, A.

A Critical Control Element for Interleukin-4 Memory Expression in T Helper Lymphocytes*{boxs}

Lars-Oliver Tykocinski,a Petra Hajkova,b Hyun-Dong Chang,a Torsten Stamm,a Osman SÖzeri,a Max LÖhning,cd Jane Hu-Li,e Uwe Niesner,af Stephan Kreher,a Beate Friedrich,g Christophe Pannetier,e Gerald Grütz,h JÖrn Walter,i William E. Paul,e and Andreas Radbruchahj

From the aDeutsches Rheuma-Forschungszentrum, Berlin 10117, Germany, bWellcome Trust CR UK Institute, Cambridge CB2 1QR, United Kingdom, cInstitute of Experimental Immunology, University Hospital Zürich, Zürich 8091, Switzerland, eLaboratory of Immunology, National Institutes of Health, Bethesda, Maryland 20892, gMax Delbrück Center for Molecular Medicine, Berlin 13122, Germany, hUniversity Hospital Charité, Humboldt University, Berlin 10117, Germany, iUniversität des Saarlandes, Saarbrücken 66041, Germany

Received for publication, February 23, 2005 , and in revised form, May 18, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Naive T helper (Th) lymphocytes are induced to express the il4 (interleukin-4) gene by simultaneous signaling through the T cell receptor and the interleukin (IL)-4 receptor. Upon restimulation with antigen, such preactivated Th lymphocytes can reexpress the il4 gene independent of IL-4 receptor signaling. This memory for expression of the il4 gene depends on epigenetic modification of the il4 gene locus and an increased expression of GATA-3, the key transcription factor for Th2 differentiation. Here, we have identified a phylogenetically conserved sequence, the conserved intronic regulatory element, in the first intron of the il4 gene containing a tandem GATA-3 binding site. We show that GATA-3 binds to this sequence in a position- and orientation-dependent manner, in vitro and in vivo. DNA demethylation and histone acetylation of this region occurs early and selectively in differentiating, IL-4-secreting Th2 lymphocytes. Deletion of the conserved element by replacement of the first exon and part of the first intron of the il4 gene with gfp leads to a defect in the establishment of memory for expression of IL-4, in that reexpression of IL-4 still requires costimulation by exogenous IL-4. The conserved intronic regulatory element thus links the initial epigenetic modification of the il4 gene to GATA-3 and serves as a genetic control element for memory expression of IL-4.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Memory is one of the key features of adaptive immunity. Memory T and B lymphocytes react faster than naive lymphocytes to stimulation by their cognate antigen (1, 2). Memory T lymphocytes also memorize the expression of effector molecules like cytokines, which they had been instructed to express during their primary activation. Naive T helper (Th)1 lymphocytes are instructed to express particular cytokine genes by T cell antigen receptor (TcR) signals in combination with additional differentiation signals (3). The instructive signal interleukin (IL)-4 induces differentiation of activated naive Th cells into Th2 cells, expressing IL-4, IL-5, and IL-13, whereas the instructive signal IL-12 induces activated naive Th cells to express interferon-{gamma} (IFN-{gamma}) and tumor necrosis factor-{beta} (TNF-{beta}) (4). The expression of cytokine genes is transient. Upon restimulation by antigen, memory Th lymphocytes can reexpress specifically those cytokine genes they had been instructed to express in the primary stimulation, independent of the original instructive signals (5).

Apparently, the cytokine memory of Th lymphocytes is based on two critical molecular events, the expression of lineage-specific transcription factors and the epigenetic modification of cytokine gene loci (5–7). GATA-3 is a critical transcription factor for expression of the Th2 cytokine genes il4, il5, and il13 (8). Ectopic expression of GATA-3 in activated Th cells induces expression of these cytokine genes, even in Th1 cells (8–10). The expression of GATA-3 is drastically up-regulated in Th2 cells. This up-regulation can be induced by activated Stat6, resulting from IL-4 receptor signaling, and by GATA-3 itself in an autoregulatory loop (9, 11). Potential target binding sequences for GATA transcription factors have been identified in the promoter of the il5 (12) and the il13 gene (10, 13), in the il4/il13 intergenic conserved noncoding sequence, CNS-1 (14) and in the enhancer of the second intron of the il4 gene (15). For the 3' enhancer (DNase I-hypersensitive site VA) of the il4 gene and for a region upstream of the il13 gene (conserved GATA-3 response element), GATA-3 binding has been demonstrated in vivo by chromatin immunoprecipitation (ChIP) (16, 17). Another GATA-3 binding site is located in the locus control region of the Th2 cytokine gene cluster (18). Involvement of any of these GATA-3 binding sites in the establishment and maintenance of memory for IL-4 expression in Th2 cells has not been demonstrated so far. Conditional inactivation of gata3 in Th2 memory lymphocytes reduces the frequencies of cells reexpressing IL-4, IL-5, IL-13, and IL-10, demonstrating that sustained expression of GATA-3 is involved in the maintenance of Th2 cytokine memory (19–21). However, in established Th2 cells that were restimulated four times, upon deletion of gata3, many cells continue to reexpress IL-4 upon restimulation, indicating that a redundant mechanism may have taken over, such as epigenetic modification of the il4 gene or its essential control elements (21).

In the process of Th2 cell development, the il4 gene becomes demethylated, its chromatin becomes acetylated (22–27), and it remains euchromatic, whereas it is translocated to heterochromatin in polarized Th1 cells (28). The results of pharmacological interference with DNA demethylation and histone acetylation during polarization of activated naive Th cells suggest that these epigenetic changes are relevant for the induction and maintenance of cytokine memory (22). Inactivation of the DNA methyltransferase dnmt1 leads to expression of IL-4 in CD4 and CD8 T cells (29). Inhibition of DNA synthesis during the initial polarizing activation of naive Th cells inhibits the development of a cytokine memory for IL-4 (22, 30, 31). Since demethylation is considered to be dependent on DNA synthesis (32), this result supports a functional relevance of demethylation of the il4 gene for the establishment of an IL-4 cytokine memory. GATA-3 is apparently able to induce chromatin remodeling of the il4 gene locus on its own. Overexpression of GATA-3 in Th cells induces the appearance of the Th2-specific DNase I-hypersensitive sites II, III, and V of the il4 gene and the hyperacetylation of the il4 locus (9, 20, 27). Conditional inactivation of the gata-3 gene leads to decreased histone acetylation and increased DNA-methylation of the il4 locus (20). GATA-3 may directly interfere with histone acetylation and DNA methylation. It has been shown that GATA-3 inhibits binding of the methyl-CpG binding domain protein-2 to the second intron of the il4 gene and to CNS-1 and thus the recruitment of a silencing complex (33).

Here, we describe a phylogenetically conserved GATA-3 binding element of the first intron of the il4 gene. This element is initially and specifically demethylated in activated, Th2-polarized cells expressing IL-4, and it is required to maintain the memory for IL-4 expression in early Th2 memory cells.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Mice—DO11.10 TCR-transgenic mice on BALB/c background (kind gift of Dennis Y. Loh and Kenneth Murphy, Washington University School of Medicine, St. Louis, MO) were bred under specific pathogen-free conditions in our animal facility. Heterozygous il4wt/il4gfp mice (34), which have the gfp gene knocked into one il4 allele, have been prepared in the Laboratory of Immunology (NIAID, National Institutes of Health). All animal experiments were performed in accordance with institutional, state, and federal guidelines.

Isolation of Naive CD4+CD62L+ DO11.10 Cells—Splenic cells from DO11.10 TCR-transgenic mice were stained with fluorescein isothiocyanate-conjugated anti-CD4 monoclonal antibody (GK1.5) and MultiSort anti-fluorescein isothiocyanate microbeads (Miltenyi Biotec) and sorted with the MidiMACS system (Miltenyi Biotec). After release of the MultiSort microbeads, the CD4+ cells were incubated with anti-CD62L MACS microbeads (Miltenyi Biotec), and CD4+CD62L+ were positively selected.

Isolation of Naive CD4+ il4wt/il4gfp Cells—Lymph node cells from il4wt/il4gfp heterozygous mice were stained with fluorescein isothiocyanate-conjugated antibodies to B220 (RA3–6B2), I-Ab (AF6–120.1) and CD8 (53–6.7) and negatively selected using anti-fluorescein isothiocyanate-coated magnetic beads. CD4-enriched cells were layered onto a discontinuous Percoll gradient, and small cells of high density were collected.

Cell Culture—DO11.10 cell cultures were set up with 2 x 106 cells/ml in complete RPMI 1640 supplemented with 10% fetal bovine serum, 100 units/ml penicillin, 0.1 mg/ml streptomycin, 0.3 mg/ml glutamine, and 10 µM 2-mercaptoethanol. The antigenic peptide OVA323–339 was added at 0.5 µM. CD4-, CD8-, CD90-depleted spleen cells from DO11.10 mice were used as antigen-presenting cells (APCs). For Th1 differentiation, the cells were stimulated in the presence of 10 ng/ml recombinant IL-12 (R & D Systems) and 5 µg/ml anti-IL-4 (11B11). For Th2 differentiation, cells were cultured in the presence of 30 ng/ml IL-4 (culture supernatant of murine myeloma cell line P3-X63 Ag.8.653 transfected with murine IL-4 cDNA), 5 µg/ml anti-IL-12 (C17.8.6), and 5 µg/ml anti-IFN-{gamma} (AN18.17.24).

APCs for the il4wt/il4gfp cells were generated from splenocytes treated with anti-Thy1.2 (H013.4) antibody plus Low-Tox M rabbit complement for 45 min at 37 °C. For Th2 priming, naive CD4+ il4wt/il4gfp T cells (105/ml) were cultured with 106/ml irradiated (3,000 rads) APC plus 3 µg/ml anti-CD3 (2C11), 3 µg/ml anti-CD28 (37.51), 1,000 units/ml IL-4, 10 µg/ml anti-IL-12 (C17.8), 10 µg/ml anti-IFN-{gamma} (XMG1.2), 100 ng/ml IL-6, and 10 units/ml recombinant human IL-2.

For the experiment described in Table I, CD4+ T cells from lymph nodes of il4wt/il4gfp B6;129 mice were primed for 3 days with T cell-depleted spleen cells as APCs under Th2 polarizing conditions (anti-CD3 (3 µg/ml), anti-CD28 (3 µg/ml), IL-4 (1,000 units/ml), human IL-2 (10 units/ml), anti-IFN-{gamma} (10 µg/ml), anti-IL-12 (10 µg/ml)). When tested, 16.2% of the cells were IL-4+, and 9.94% were GFP+. The cells were then recultured in the presence of APCs, anti-CD3, anti-CD28, human IL-2 (10 units/ml), anti-IFN-{gamma} (10 µg/ml), and anti-IL-12 (10 µg/ml). In three groups, various amounts of IL-4 were added (100, 1,000, and 10,000 units/ml), and in three groups, anti-IL-4 (20 µg/ml), anti-IL-4 receptor (20 µg/ml), or both were used. The reexpression of IL-4 and GFP was analyzed by flow cytometry.


View this table:
[in this window]
[in a new window]
  		TABLE I
Memory for IL-4 expression is impaired by the deletion of CIRE

CD4+ T cells from heterozygous il4wt/il4gfp B6;129 mice were polarized under Th2 conditions. On day 3, 16.2% of the cells expressed IL-4, and 9.94% expressed GFP. After the cells were washed and recultured for 4 days in the presence of different amounts of recombinant IL-4 (100, 1,000, and 10,000 units) or in the presence of {alpha}IL-4 and/or {alpha}IL-4R, the frequencies of IL-4- and GFP-expressing cells were determined by fluorescence-activated cell sorting analysis.

 
Sorting of Live IL-4 Secreting Cells with the Cytometric Cytokine Secretion Assay—Primed Ova-specific Th2 cells were restimulated after 1 week with phorbol 12-myristate 13-acetate (50 ng/ml) and ionomycin (1 µg/ml) for 3.5 h at 37 °C. The IL-4 secretion assay was performed as described before (34). The purity of the IL-4+ cells was 95%, and the purity of the IL-4– cells was >99%.

Isolation of IL-4+/GFP+ Cells—The il4wt/il4gfp T cells, primed for 67 h under Th2 conditions, were restimulated with immobilized anti-CD3/anti-CD28 for 3.5 h at 37 °C and 6% CO2 and sorted for IL-4 secretion (34). The sorted IL-4+ (>99%) cells were put back in complete RPMI medium on plates coated with immobilized anti-CD3 and anti-CD28 for an additional 17 h. The cells were then stained with APC-anti-CD4 and sorted for GFP expression using a FACStar. The purity of the IL-4+/GFP+ cells was >98%. These cells were then cultured again for 11 days in complete RPMI medium either in the presence of IL-4 (1,000 units/ml) or in the presence of anti-IL-4 antibody (10 µg/ml; 11B11). The cells were challenged with immobilized anti-CD3/anti-CD28 and recombinant human IL-2 (10 units/ml). IL-4 expression was detected by intracellular staining at 6 h, and GFP expression in living cells was assessed at 24 h.

Methylation-sensitive Endonuclease Restriction Analysis—The genomic DNA was prepared from sorted naive CD4+CD62Lhigh DO11.10 splenocytes and from 1-week Th1- or Th2-polarized DO11.10 T cells by phenol/chloroform extraction and digested with HindIII or EcoRI followed by ethanol precipitation and digestion with MspI or HpaII. The DNA was then subjected to agarose gel electrophoresis, transferred to a nylon membrane, and UV cross-linked.

The probes were generated by PCR amplification using the following primers: 5' probe, TCAAGGATCCACACGGTGCAA and ACCGTATCAAGCAAGGCCAGGTAG; 3' probe, TAAAGAACTGTAGTAGGGATAGGA and CTTAGCCAGATATGGCACTAGA.

The PCR product for the 3' probe was digested with EcoRI, and the 3' fragment was used as probe. The probes were 32P-labeled by using the Hexa Label DNA Labeling Kit (MBI Fermentas). The nylon membranes were prehybridized with mouse COT-1 DNA (Invitrogen) and hybridized in Church buffer (7% SDS, 0.5 M NaPO4, pH 7.2, 1 mM EDTA) overnight by 65 °C. The membranes were washed three times with Church washing buffer (5.8 mM NaH2PO4, 19.2 mM Na2HPO4, 1% SDS) at 65 °C.

Bisulfite-based Cytosine Methylation Analysis—The bisulfite-based methylation analysis was performed as described before (35). Briefly, the isolated genomic DNA was digested with KpnI and then denatured at 100 °C for 5 min. NaOH was added to the DNA at a final concentration of 0.3 M and incubated for 15 min at 50 °C. The DNA solution was mixed with 2 volumes of 2% (w/v) hot LMP-agarose (SeaPlaque-agarose; FMC) dissolved in H2O. To form DNA-agarose beads, droplets of the mixture containing not more than 100 ng of DNA were pipetted in ice-cold mineral oil overlaying the sodium bisulfite/hydroquinone solution. The bisulfite reaction was performed for 3.5 h at 50 °C. Afterward, the beads were washed in TE buffer and incubated for 2 x 15 min in 0.2 M NaOH. 50–100 ng of sample were amplified by nested PCR, each with 25 cycles consisting of 1 min at 95 °C, 1.5 min at 58 °C, and 1.5 min at 72 °C, using the following primers: for the il4 promoter region, 5'-TATTTTTGGGTTAATGAGATGGT, 5'-GTTTGTGAGTTTGAGTTTAAGGATT, and 5'-TTTTTAAATCTACAAAATTTCAACATAAA; for the il4 intron 1 region, 5'-GATTTTTGTTAGTATTGTATTGTTAGT, 5'-CCTCCAAAATATACCACAACAAAC, 5'-GTTATTGATGGGTTTTAATTTTTAGTTAG, and 5'-AAACCCCTCAAATCCACTTACCT; for the il4 intron 3 region, 5'-AGTTATTGATAGATAATGTTAGTTTTGTGT, 5'-ATAATACTCTTTAAACTTTCCAAAAAATC, 5'-TGAATGATTGGAGGAGTTGAGATT, and 5'-TTAAACTCATTCATAATACAACTTATC.



View larger version (37K):
[in this window]
[in a new window]
  		FIG. 1.
HpaII/MspI (CCpGG) methylation-sensitive endonuclease restriction analysis of the il4 genes of murine naive CD4+CD62Lhigh DO11.10 T cells and 1-week polarized Th1 or Th2 cells. A, methylation status of a 5,585-kb HindIII fragment, spanning exons 1–3 of the il4 gene, with the location of probe as indicated. B, methylation status of a 7,447-kb EcoRI fragment spanning exons 3 and 4 of the il4 gene, as visualized by the indicated probe. The 11 MspI/HpaII restriction sites of the analyzed region are designated A–K.

 
The gel-purified (Qiagen) PCR products were ligated into a TA cloning vector (Promega), and individual clones were sequenced.

Nuclear Extracts and DNA Binding Assays—Nuclear extracts were made as described (12). DNA binding reactions were performed for 15 min at room temperature in 20–25 µl of binding buffer (10 mM HEPES (pH 7.9), 100 mM KCl, 1 mM EDTA, 1 mM dithiothreitol, 10% glycerol, proteinase inhibitors) containing 8–10 nM radiolabeled oligonucleotides, 5–10 µg of nuclear extract, and 50 µg/ml poly(dI-dC). When indicated, 1 µM of unlabeled oligonucleotide was added as competitor. Antibodies directed against GATA-3 (HG3-31) and c-Maf (M-153) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Complexes were separated in a 4% polyacrylamide gel for 2–3 h at 4 °C and 200 V.

The following oligonucleotides and competitor sequences were used: for il4 conserved intronic regulatory element (CIRE) wild type, 5'-AGTACCTATCTGGCACCATCTCTCCAGAT; for il4 mut1, 5'-AGTACCctagTGGCACCATCTCTCCAGAT; for il4 mut2, 5'-AGTctgaATCTGGCACCATCTCTCCAGAT; for il4 mut3, 5'-tacgCCTATCTGGCACCATCTCTCCAGAT; for il4 mut4, 5'-AGTACCTATagctCACCATCTCTCCAGAT; for il4 mut5, 5'-AGTACCTATCTGtgcaCATCTCTCCAGAT; for il4 mut6, 5'-AGTACCTATCTGGCAtagcCTCTCCAGAT; for il4 mut7, 5'-AGTACCTATCTGGCACCAcagtTCCAGAT; for il4 mut8, 5'-AGTACCTATCTGGCACCATCTacgtAGAT; for il4 mut9, 5'-AGTACCTATCTGGCACCATCTCTCactgT; for il4 add6, 5'-AGTACCTATCTGGCACtggcacCATCTCTCCAGAT; for il4 inv, 5'-AGTACCTATCTGGagagatggtgCCAGAT; for il5 wild type, 5'-ATTAGGTGTCCTCTATCTGATTGTTAGCA; for il5 mut1, 5'-ATTAGGTGTCCTCctagTGATTGTTAGCA; for il5 mut2, 5'-ATTAGGTGTCCTCTATCTatgcGTTAGCA.

Chromatin Immunoprecipitation Assay—ChIP analysis was performed according to the manufacturer's protocol (Upstate%20Biotechnology">Upstate Biotechnology, Inc.). Th1 and Th2 cells were fixed with 1% formaldehyde for 10 min at room temperature. The chromatin was sheared to 200–1000 bp of length by sonication with five pulses of 10 s at 30% power (Bandelin). For the acetyl-H3 ChIP, the sheared chromatin was precleared by the incubation with Protein A-agarose beads and incubated with anti-acetyl-H3 antibodies (Upstate%20Biotechnology">Upstate Biotechnology) overnight at 4 °C, followed by incubation with Protein A-agarose beads for 1 h. In the case of the GATA-3 ChIP, the chromatin was precleared for 2 h with normal mouse IgG beads and then incubated with anti-GATA-3-agarose beads (HG3-31; Santa Cruz Biotechnology) for 2 h. For the acetyl-H4 ChIP, the µMACS system was used (Miltenyi Biotec). The chromatin was precleared with Protein A-MicroBeads (Miltenyi Biotec) and incubated with anti-acetyl-H4 (Upstate%20Biotechnology">Upstate Biotechnology) overnight, followed by incubation with Protein A-MicroBeads for 1 h. Washing steps were performed on µcolumns (Miltenyi Biotec). Washing and elution buffers were used according to the protocol of Upstate%20Biotechnology">Upstate Biotechnology. Cross-links were reversed by incubation at 65 °C for 4h in the presence of 0.2 M NaCl, and the DNA was purified by phenol/chloroform extraction. The amount of DNA was determined by conventional PCR or by real time PCR with LightCycler (Roche Applied Science) using SYBR Green. In the case of real time PCR, the amount of DNA was calculated with the equation, E^ – (crossing point IP – crossing point input), where E represents reaction efficiency, determined by serial dilution of DNA.

The following primers were used: for conventional PCR for CIRE, 5'-CTCGAATGTACCAGGAGCCATATCC and 5'-AGCAGGACAGAGAAAGCATCGCTAC (positions 42–352; AC084392 [GenBank] .1); for real time PCR for CIRE, 5'-CACTTGAGAGAGATCATCGG and 5'-CCACCTCTCTAGCAACTCAG (positions 85–224); for conventional PCR for DNase I-hypersensitive site VA, 5'-GATATACTCAAGAGGGCACCAGGG and 5'-TGACTTCATTCTTCACGCCTAAGC (positions 11,168–11,441); for real time PCR for HS VA, 5'-AGGGCACTTAAACATTGC and 5'-ACGCCTAAGCACAATTCC (positions 11,189–11,427); for conventional PCR for ifn-{gamma} promoter, 5'-ATGGTTCAAGTCTGCACCCATAGC and 5'-CTCATACCCACATGTGGCTAAGGC (positions –1251 to –973; M28381 [GenBank] ); for real time PCR for ifn-{gamma} promoter, 5'-TTTCAGAGAATCCCACAAGAATG and 5'-TCGGGATTACGTATTTTCACAAG (positions –357 to –156; M28381 [GenBank] ); for real time PCR for the il4gfp allele, 5'-AGAGACCTCTGCCAGCATTGC and 5' GCAGATGAACTTCAGGGTCAGCT (positions –112 to +147).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Demethylation Is Restricted to the 5' End of the il4 Gene in Th2 Cells—Demethylation of the il4 gene of in vitro generated Th1 and Th2 cells was analyzed by methylation-sensitive MspI/HpaII restriction endonuclease analysis of HindIII- or EcoRI-digested genomic DNA.

With a probe corresponding to positions –845 to +309 relative to the first codon of the il4 gene (GenBankTM accession number AC084392 [GenBank] .1), HindIII-digested DNA was analyzed for methylation of the eight MspI/HpaII sites of the 5' part of the murine il4 gene, ranging from the promoter to the third exon (Fig. 1). Of the MspI sites A–H, most il4 alleles of Th1 cells show no demethylation at all (i.e. they are not cut by HpaII, with some being demethylated at sites G/H and/or at sites C/D). In particular, the il4 genes of Th1 cells are not detectably demethylated at site B, located in the first intron.

In Th2 cells, most il4 genes are demethylated at least at one MspI site. Many il4 genes are demethylated already at sites C and D and/or site B. These genes may also be demethylated at sites G/H, but this cannot be detected with the probe used. Many of the il4 genes that are not demethylated at sites B–D, are demethylated at sites G and H. Demethylation at sites E and F was not detectable in Th1 or in Th2 cells. It remains unclear whether site A is demethylated in any of the il4 genes analyzed, because site A is only 47 bp downstream of the 5' HindIII site. Taken together, and confirming the results of Lee et al. (25), demethylation at sites C and/or D is enhanced, and site B is selectively demethylated in 1-week polarized Th2, as compared with 1-week polarized Th1 cells.



View larger version (50K):
[in this window]
[in a new window]
  		FIG. 2.
DNA methylation of the promoter (–861 to –268), intron 1 (–7to +458), and intron 3 region (+5562 to +5979) of the il4 gene as analyzed by the bisulfite technology. DNA from naive CD4+ T cells, 1-week polarized Th1 and Th2 cell cultures, and sorted IL-4-secreting and nonsecreting cells isolated from Th2 cultures was treated with sodium bisulfite and amplified by PCR. Individual PCR products were cloned and sequenced, each line representing one il4 allele. The filled circles mark CpG motifs with methylated cytosine, whereas open circles mark CpG motifs with demethylated cytosine. MspI/HpaII sites A, B, and J are indicated (see Fig. 1). 10 of 17 sequences for the promoter from naive and Th1 cells and 12 of 19 sequences from Th2 cells are shown.

 
Methylation of the MspI sites I–K at the 3' end of the il4 gene was analyzed with a probe hybridizing to intron 3 of the il4 gene (+3300 to +4261; Fig. 1B). Neither in naive T cells, isolated ex vivo, nor in Th1 or Th2 cells, generated in vitro, are any of the MspI sites I–K detectably demethylated (i.e. demethylation of the il4 gene in 1-week Th2 cells is restricted to the 5' end).

Specific Demethylation of the First Intron of the il4 Gene in Th2 Cells—As shown here and by Lee et al. (25), the most obvious difference in methylation of the il4 genes of early polarized Th1 and Th2 cells is the specific demethylation of HpaII site B in the first intron of the il4 genes of Th2 cells. To obtain a more detailed picture of demethylation of the first intron of the il4 gene, we analyzed individual il4 genes isolated from naive Th cells, Th1 and Th2 cells, by bisulfite-based genomic sequencing. In addition, the il4 promoter and a CpG-rich region in the third intron of the il4 gene was analyzed (Fig. 2).

The sequence +5562 to +5979 located in the third intron of the il4 gene, including MspI/HpaII site J (+5600), shows essentially no demethylation of CpGs for any of the il4 genes analyzed, be they derived from naive Th cells or Th1 or Th2 cells. The promoter region (–861 to –268; Fig. 2), including MspI site A (–814), is partially demethylated in some il4 genes of naive T cells, starting at position –408. In Th1 cells, demethylation of the il4 promoter is similar as in naive T cells, whereas in Th2 cells demethylation of this region is strongly enhanced. The il4 promoter is also demethylated in Th2 cells that do not express IL-4 after restimulation.

The sequence analyzed downstream of the il4 promoter (–7 to +458; Fig. 2) encompasses the first intron, including the MspI/HpaII site B (+308), and parts of exons 1 and 2. In contrast to the il4 promoter, CpGs of this region are completely methylated in naive and Th1 lymphocytes. In Th2 cells, some il4 genes are demethylated at variable positions, mostly between CpG+113 and CpG+229. This demethylation is linked to a memory for expression of IL-4, since 11 of 12 il4 sequences of Th2 lymphocytes, which had been isolated according to memory expression of IL-4, show demethylation of CpG+101, CpG+113, and CpG+185. Five of 12 sequences from Th2 cells, that do not express IL-4 after restimulation, are demethylated at these three CpG elements. 10 of 12 sequences from the IL-4-secreting Th2 cells also show demethylation of CpG+225 and CpG+229. The MspI/HpaII site B (CpG+308) is demethylated in three of the 12 sequences. It should be noted that the 12 sequences of il4 genes selected at random from IL-4-expressing cells show no allelic bias with respect to demethylation.

A Conserved Element in the First Intron of the il4 Gene (CIRE)—Analysis of DNA methylation had suggested that the il4 genes of Th2 lymphocytes memorizing IL-4 expression are specifically demethylated between CpG+101 and CpG+229. Comparing the orthologous sequences available from humans, mice, rats, cows, and rabbits reveals a stretch of 17 bp of complete homology between positions +140 and +157 of the murine il4 gene (Fig. 3). This 17-bp-long, phylogenetically conserved intron sequence in the center of a region of Th2-specific initial demethylation of the il4 gene includes a GATA and a GATG quadruplet on the noncoding strand, separated by six conserved base pairs.



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 3.
Sequence of the CIRE of the il4 gene of various mammalian species. A core sequence of 17 bp is completely conserved in all mammalian species analyzed. Two putative GATA-binding sites, separated by 6 nucleotides, are indicated (GenBankTM accession numbers as follows: mouse, AC084392 [GenBank] .1; human, M23442 [GenBank] ; rat, X53087 [GenBank] ; cow, AH003241 [GenBank] ; rabbit, AF169175 [GenBank] ).

 
The ability of the phylogenetically conserved intron 1 sequence of il4 (CIRE) to bind proteins of nuclear extracts from Th1 and Th2 cells, in particular GATA-3, was tested by electrophoretic mobility shift and supershift assays and compared with the promoter of the il5 gene, which contains a well defined GATA-3 binding site (12, 36, 37) (Fig. 4).

Nuclear extracts of Th1 cells do not contain proteins binding to the CIRE of il4 (lanes 1–3) but do contain proteins that bind to the promoter of the il5 gene (lane 7). However, these proteins do not include GATA-3 (lane 8). Nuclear extracts of Th2 cells contain additional proteins binding to the promoter of il5 (lane 9), and they also contain proteins binding to the CIRE of il4 (lane 4). Both complexes, the CIRE/Th2-protein (lane 4) and the il5 promoter/Th2-protein complex (lane 9) have the same mobility and can be supershifted with a specific antibody to GATA-3 (lanes 5 and 10) but not with an antibody to c-Maf, another Th2-specific transcription factor, used here as control (lanes 6 and 11). This shows that GATA-3 from nuclear extracts of Th2 cells can bind to the CIRE of the il4 gene, as well as to the promoter of il5.

Structural Conservation of the CIRE Is Required for GATA-3 Binding—Structural conservation of the CIRE of il4 in evolution is required for GATA-3 binding, as is evident from competition analysis with mutated oligonucleotides (Fig. 5A). Binding of the nuclear proteins of Th2 cells to the labeled CIRE oligonucleotide is inhibited by a 100-fold molar excess of unlabeled wild type CIRE oligonucleotide (Fig. 5A, lane 2) or oligonucleotides mutated at sequences outside of the two GATA-binding sites (Fig. 5A, lanes 5, 7, 10, and 11). Oligonucleotides with mutations of any of the two GATA-binding sites are not able to inhibit binding of GATA-3 to the wild type CIRE oligonucleotide (Fig. 5A, lanes 3, 4, 6, 8, and 9)(i.e. the CIRE of il4 requires both GATA-binding sites for efficient binding of GATA-3). This is also the case for binding of GATA-3 to its target sequences in the il5 promoter, although orientation and distance of the il5 promoter GATA-binding sites differ from those of CIRE (Fig. 5A, lanes 14 and 15).

The sequence of the six base pairs separating the two GATA-binding sites of the CIRE does not seem to be important for binding of Th2 cell-derived nuclear proteins to CIRE (Fig. 5A, lane 7). The six base pairs apparently just maintain a distinct distance between the two GATA motifs. A mutant CIRE with 12 instead of 6 nucleotides separating the GATA-binding motifs can no longer inhibit binding of GATA-3 to the CIRE efficiently (Fig. 5B, lane 3), and a mutant with an inverted 3' GATA-binding motif also cannot inhibit binding of CIRE to nuclear proteins of Th2 cells (Fig. 5B, lane 4). Thus, GATA-3 binds to CIRE in a position- and orientation-dependent manner.



View larger version (83K):
[in this window]
[in a new window]
  		FIG. 4.
Analysis of protein binding to the CIRE by electrophoretic mobility shift assay. Nuclear proteins of 1-week polarized Th2 (lane 4) but not of 1-week polarized Th1 cells (lanes 1–3) bind to the labeled CIRE oligonucleotide. Antibodies specific for GATA-3 (HG3-31) and c-Maf (M-153) were used to define the binding proteins. The Th2-specific complex is supershifted by antibodies to GATA-3 (lane 5). A complex with similar mobility behavior binds to the GATA-binding site of the il5 promoter (lanes 7–11).

 
GATA-3 Binds to the CIRE in Th2 Lymphocytes in Vivo— Binding of GATA-3 to the CIRE in vivo was analyzed by ChIP. Th cells were stimulated for 1 week under Th1 or Th2 conditions, and IL-4-expressing Th2 cells were isolated by the cytokine secretion assay and magnetic cell sorting. The complexed chromatin fragments of these cells were precipitated with anti-GATA-3 antibody. The precipitated DNA was analyzed in real time PCR with primers specific for the CIRE- or DNase-hypersensitive site VA of the il4 gene. GATA-3 binds to HS VA of restimulated Th2 but not Th1 cells, confirming earlier results (16). The binding is more frequent in IL-4-secreting than in nonsecreting Th2 cells (2.5-fold) (Fig. 6A). In Th2, but not in Th1 cells, anti-GATA-3 antibodies precipitate chromatin containing the CIRE region. The binding of GATA-3 to CIRE correlates with the ability of the Th2 cells to secrete IL-4. About 6 times more CIRE is precipitated in IL-4-secreting versus IL-4-nonsecreting Th2 cells. This difference is not due to differential availability of GATA-3, since GATA-3 protein levels are the same in IL-4-secreting and nonsecreting Th2 cells (Supplemental Fig. A).

In Th2 cells, not only GATA-3 is bound to the CIRE, the chromatin is acetylated as well, as is evident from precipitation with an antibody to acetylated histone H3 (Fig. 6B). Chromatin acetylation is also evident for il4 HS VA in Th2 but not Th1 cells and for the promoter of ifn-{gamma} in Th1 but not Th2 cells (Fig. 6B), confirming earlier reports (26, 27).

Memory for Expression of IL-4 Is Impaired by Deletion of the CIRE of il4 —To determine the functional relevance of the CIRE of il4 for reexpression of IL-4, Th cells were analyzed, in which one of the il4 alleles had been subject to targeted integration of the gene for green fluorescent protein (gfp) (34). In this allele, il4gfp, the gfp gene replaces the first exon (131 base pairs) and 178 base pairs of the first intron of the il4 gene, including the CIRE of il4 (Fig. 7A). Within the 309 bp deleted in the il4gfp allele, apart from CIRE, no other evolutionary conserved sequences with putative transcription factor binding sites are located according to DiAlign TF (Genomatix) scanning. Heterozygous il4wt/il4gfp resting Th cells were activated under Th2-polarizing conditions for 3 days and then restimulated with immobilized anti-CD3 and anti-CD28 for 3.5 h. Cells expressing both il4 alleles (i.e. secreting IL-4 and expressing intracellular GFP) were isolated by combined magnetic and fluorescence-activated cell sorting, after labeling of viable IL-4-secreting cells in the cytometric cytokine secretion assay (9, 34). The sorted cells were maintained in culture for another 12 days in medium containing either IL-4 or anti-IL-4 antibodies. After a further restimulation with immobilized anti-CD3 and anti-CD28, the frequencies of cells expressing GFP and/or IL-4 were determined (Fig. 7B). Expression of the il4wt allele was independent of whether the cells had been cultured in the presence or absence of IL-4 (26.6 and 24.8%, respectively). The il4gfp allele, however, was expressed by 30.9% of the cells when they had been cultured in the presence of IL-4 but only by 9.1% of the cells when they had been cultured in the absence of IL-4.



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 5.
Binding of GATA-3 to the CIRE is dependent on the presence of both GATA-binding motifs in the same orientation and at a distance of 6 nucleotides. A, the sequence of the CIRE was mutated as indicated, and unlabeled mutant oligonucleotides were used to inhibit the binding of nuclear proteins of polarized Th2 cells to labeled CIRE at a 100-fold excess. Mutants 1, 2, 4, 6, and 7 did not inhibit. A similar analysis was performed for the GATA-binding sites of the il5 promoter. B, analysis of mutants with 12 instead of 6 nucleotides separating the two GATA-binding sites (add6) and with the two GATA-binding sites in opposite direction at a 6-nucleotide distance (inv). Both mutants could not completely inhibit the binding to the CIRE probe. 32P-Labeled probe is marked by an asterisk.

 
In a second experimental approach, Th2-polarized cells were restimulated in the presence of various amounts of IL-4, anti-IL-4 or anti-IL-4 receptor antibodies, or both. Whereas the frequencies of cells expressing the il4wt allele were not significantly different in cultures with or without IL-4, the frequencies of cells expressing the il4gfp allele were significantly reduced by 60% when comparing cultures restimulated in the presence or absence of IL-4 (Table I). Thus, deletion of the phylogenetically conserved GATA-binding site CIRE of il4 impairs memory for IL-4 expression in early Th2 lymphocytes, in that reexpression of il4 upon TcR signaling still requires costimulatory signaling from the IL-4 receptor, as in the initial, polarizing stimulation.

Acetylation of histones of the 5' end of the il4gfp allele is significantly less prominent than for the il4wt allele (Fig. 7C), in heterozygous Th2 cells activated under polarizing conditions for 1 week. Thus, acetylation of the 5' end of the il4 gene, indicating epigenetic "opening" of the gene, correlates to the presence of the CIRE of il4.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
As is shown here, the first intron of the il4 gene contains a 17-bp-long phycogenetically conserved sequence we named CIRE with two GATA-3 binding sites. The neighboring sequences are rapidly and specifically demethylated and histone-acetylated in naive Th lymphocytes induced to express the il4 gene. Deletion of CIRE reduces the frequencies of 1-week-old Th2 cells reexpressing IL-4 upon TcR stimulation in the absence of exogenous IL-4 by about 60%, as compared with cells restimulated in the presence of IL-4, indicating a defect in the development and early maintenance of memory for IL-4 expression. Loss of CIRE also leads to reduced histone acetylation at the 5' end of the il4 gene. CIRE links the initial epigenetic modification of the il4 gene to GATA-3, the key transcription factor of Th2 lymphocytes, and serves as a genetic control element for early establishment of a memory for expression of IL-4 in Th2 cells. Interestingly, the defective memory expression of the mutant il4gfp allele can be rescued by IL-4 signaling, indicating that Stat6 can efficiently induce IL-4 expression directly and not only through up-regulation of GATA-3.

Early and Specific Demethylation of the First Intron of il4 Is Linked to Memory for IL-4 Expression in Th Lymphocytes—Two lines of evidence had previously indicated that epigenetic modifications of genes coding for effector cytokines like IL-4 are essential for the establishment of a memory of Th cells to express these genes upon restimulation via the TcR in the absence of the original costimulatory signals. First, establishment of a cytokine memory for effector cytokines like IL-4, IL-10, and IFN-{gamma} during the initial instructing activation of naive Th cells can be blocked selectively by blocking DNA synthesis but not by blocking later stages of cell cycling (22, 30, 31). Second, control elements of cytokine genes are selectively demethylated and histone-acetylated in cells memorizing their expression (17, 24–27, 38). Blocking the demethylation of DNA and acetylation of proteins deregulates cytokine gene expression (22). It also has been shown that genetic inactivation of the DNA methyltransferase Dnmt1 leads to spontaneous expression of IL-4 in CD4 and CD8 T cells (29).



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 6.
CIRE in intron 1 of the il4 gene binds to GATA-3 in vivo and is acetylated at histones H3 in Th2 cells. Naive CD4+ T cells from DO11.10 mice were activated under polarizing Th1 or Th2 conditions for 7 days. Th2 populations were separated into IL-4-secreting and nonsecreting populations by cytokine secretion assay and MACS. A, DNA-protein complexes of Th1, Th2, IL-4-secreting Th2, and IL-4-nonsecreting Th2 cells were immunoprecipitated with {alpha}-GATA-3 antibodies. DNA before immunoprecipitation (input) and the immunoprecipitates were amplified with primers for the il4 CIRE region and for the DNase I-hypersensitive site VA, respectively. The amount of specifically precipitated DNA was quantified by real time PCR. B, Th cells were stimulated with phorbol 12-myristate 13-acetate and ionomycin for 10 min. DNA-protein complexes were immunoprecipitated with {alpha}-acetyl-H3 antibodies and Protein A-agarose beads or with beads alone. Precipitated DNA was amplified by PCR with primers specific for the il4 CIRE, HS site VA, and the ifn-{gamma} promoter. Input DNA and no antibody control precipitate were amplified with primers for the il4 CIRE. PCR was performed on undiluted and 1:10 diluted input or precipitate, respectively.

 
Specific demethylation of the first intron of the il4 gene in developing Th2 cells had been analyzed previously by Lee et al. (25), estimating that about 5–10% of the il4 alleles of 1-week Th2-polarized cells were demethylated at the SmaI/XmaI site +308 (25). Here, we confirm and extend this observation, by showing that the CpGs at positions +101, +113, and +185 are demethylated in all but one of the 12 analyzed il4 alleles of 1-week polarized Th2 cells when these cells had been isolated according to IL-4 expression. In 19 of 20 il4 alleles from naive Th or 1-week polarized Th1 cells, these CpGs were methylated. Th2-specific demethylation of the first intron of the il4 gene contrasts with the maintenance of methylation in the third intron of il4 in the same Th2 cells. The promoter of il4 in 1-week polarized Th2 cells is largely demethylated. In Th1 and naive Th cells, the promoter is not completely methylated, in line with the observation that IL-4 expression is inducible in naive and 1-week Th1 cells (9, 39, 40). The early, specific, and almost complete demethylation of CpGs +101 to +185 of the first intron of il4 in Th2 cells with a memory for IL-4 marks this region as a key candidate for a genetic control element linking epigenetic modification of the il4 gene to the rapid establishment of a memory for IL-4 expression in early Th2 cells.

It should be noted that the present analysis makes it unlikely that demethylation is involved in the regulation of an apparent monoallelic expression of il4 (34, 41, 42), since all alleles of IL-4-expressing cells show a uniform pattern of demethylation, although the cells were not selected for expression of one particular allele.

Demethylation of the First Intron of il4 Flanks a Phylogenetically Conserved GATA-3 Binding Site (CIRE)—The prime candidate for a regulatory region in the first il4 intron is the phylogenetically conserved sequence CIRE (i.e. positions +140 to +157 of the murine sequence, containing two binding sites for GATA transcription factors). The sequence itself does not contain any CpG, and flanking CpGs are not conserved positionally, making a direct interference of methylation with the binding of transcription factor complexes unlikely. We show here that GATA-3 binds in vivo to the CIRE of il4 in Th2 cells. Binding of GATA-3 to the CIRE correlates with reexpression of IL-4 as well as with DNA demethylation and histone H3 acetylation of the first intron of il4. Since it has been shown that GATA-3 can induce IL-4 expression in Th1 cells (9, 40) and is required to maintain Th2 polarization (19–21), demethylation/acetylation of the first intron of il4 seems to be a consequence of rather than a prerequisite for GATA-3 binding. The resulting epigenetic modification and GATA-3 binding itself appear to be required for Stat6-independent, TcR-induced transcription of the il4 gene (i.e. a memory for expression of IL-4).

The link between epigenetic modification of the il4 gene and GATA-3 is well established. Upon ectopic overexpression in Th cells, GATA-3 induces Th2-specific DNase I-hypersensitive sites within the il4 gene locus, even in Stat6-deficient Th cells, and it induces the acetylation of il4 chromatin (9, 27). GATA-3 promotes histone acetylation and demethylation of the il4 gene by inhibiting the binding of methyl-CpG binding domain protein-2 to methylated sequences of the second intron of the il4 gene and to CNS-1. In methyl-CpG binding domain protein-2-deficient cells, GATA-3 is dispensable for induction of IL-4 expression (33). DNA methyltransferase Dnmt1 is critical to maintain methylation of the il4 gene in the presence of methyl-CpG binding domain protein-2 and the absence of GATA-3 (29). Conditional inactivation of gata3 in Th2 cells leads to histone deacetylation and DNA methylation of the il4 locus, suggesting that GATA-3 is necessary not only to induce but also to maintain epigenetic modifications of the il4 locus (20). The GATA-3 binding element CIRE in the first intron of the il4 gene is specifically and initially demethylated in developing Th2 cells and is critically involved in maintenance of IL-4 memory, at least in early memory Th2 cells, as is shown here. In "old," repeatedly restimulated memory Th2 cells, demethylation of the il4 gene spreads further up- and downstream of the gene (23, 25). This spreading is independent of CIRE, since it is also observed for the il4gfp allele (23), and its functional relevance remains to be determined.



View larger version (13K):
[in this window]
[in a new window]
  		FIG. 7.
Deletion of CIRE by knock-in of the gfp gene into the il4 gene affects memory for IL-4 expression in cis. A, targeted introduction of a gfp gene into the il4 gene deletes the CIRE. B, in vitro polarized Th2 cells heterozygous for the knock-in were sorted according to GFP and IL-4 expression and restimulated in the presence of IL-4 (black bars) or anti-IL-4 antibodies (striped bars), and after 11 days, their expression of IL-4 and GFP upon restimulation was determined cytometrically. C, histone acetylation at the 5' end of the il4 gene is reduced in the absence of CIRE. Th cells of heterozygous il4wt/il4gfp DO11.10 mice were stimulated for 1 week under Th2-polarizing conditions and restimulated for 5 h with phorbol 12-myristate 13-acetate and ionomycin. Histone acetylation was analyzed by chromatin immunoprecipitation (ChIP) with antibodies specific for acetyl-H4 and Protein A MicroBeads. Precipitated DNA was amplified with primers for the CIRE region of the il4wt allele, an equivalent region at the 5' end of the il4gfp allele, and the ifn-{gamma} promoter.

 
It remains unclear so far which proteins are attracted to the il4 gene and its promoter by GATA-3. GATA-1, -2, -4, -5, and -6 interact with the co-activator p300/CREB-binding protein (CBP) (43–48). The association of p300 with GATA-3 has been shown indirectly (17, 49). p300/CBP has histone acetyltransferase activity and in addition can recruit other histone acetyltransferases like p300/CBP-associated factor (50), steroid receptor coactivator-1 (51), and p300/CBP cointegrator protein (52).

GATA-3 has only a limited capacity to activate the il4 promoter and does not bind to it directly (26, 53). GATA-3 may rather catalyze the activation of il4 transcription by interacting with NFAT proteins bound to the il4 promoter (54–56). So far, direct interaction of GATA-4, -5, and -6 with NFAT3 has been described (57).

CIRE Renders IL-4 Reexpression Independent of IL-4 Signals—Targeted mutation of the first intron of the il4 gene, including CIRE, reduces memory expression of IL-4 by 60%, in terms of frequencies of IL-4-reexpressing cells, compared with reexpression obtained in the continued presence of exogenous IL-4, when 3-day or 1-week polarized Th2 cells were analyzed. These functional data demonstrate the dominant role of CIRE for the rapid establishment of an IL-4-independent memory for IL-4 expression in naive Th lymphocytes. The genetic control elements responsible for the remaining 40% of IL-4 memory are so far elusive. Other regulatory elements, like the GATA-3 binding sites of the second intron of the il4 gene (15, 58), CNS-1 (14), and DNase I-hypersensitive site VA (16, 26) may redundantly, synergistically, or alternatively control imprinting of the il4 gene for memory expression.

It remains to be elucidated how the binding of GATA-3 to CIRE renders reexpression of IL-4 independent of IL-4 signaling. This effect is acting in cis, since in the present analysis, expression of the il4wt and il4gfp alleles was compared within the same cells. The histone acetylation is significantly reduced in the il4gfp allele, pointing to a role of CIRE in introducing epigenetic modifications after the primary stimulation and thereby imprinting the il4 gene for memory expression. The dependence on continued IL-4/Stat6 signaling for reexpression of the il4gfp gene also demonstrates the relevance of the direct participation of Stat6 in the control of expression of the il4 gene, in addition to the Stat6-induced up-regulation of GATA-3 expression. Binding of Stat6 to the promoter of il4, to the DNase I-hypersensitive site VA, and to the locus control region of the Th2 cytokine gene cluster has been demonstrated, but the functional relevance of these binding sites remains elusive (26, 59). Stat6 also binds and inactivates a negative control element downstream of the il4 gene (60). In the absence of binding of GATA-3 to CIRE (i.e. for memory Th2 cells with an il4gfp allele), Stat6 apparently can compensate for the lack of CIRE in catalyzing TcR signal-induced transcription of the il4gfp gene. Stat6 can bind to p300/CBP, like GATA factors, and this interaction is required for Stat6-mediated transcriptional activation (61). It remains to be shown whether the relevant binding sites of Stat6 for memory expression of the il4 gene are located in the il4 gene promoter or enhancer or in the recently described RAD50-C region of the locus control region of the il4 locus (59).


   FOOTNOTES
 
* This work was supported by Deutsche Forschungsgemeinschaft Grants SFB 421 and SFB 618. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{boxs} The on-line version of this article (available at http://www.jbc.org) contains an additional figure. Back

d A fellow of the Ernst Schering Research Foundation. Back

f Supported by the Boehringer Ingelheim Fonds Ph.D. fellowship. Back

j To whom correspondence should be addressed: Deutsches Rheumaforschungszentrum Berlin, Schumannstrasse 21/22, 10117 Berlin, Germany. Tel.: 49-30-28460-600; Fax: 49-30-28460603; E-mail: radbruch{at}drfz.de.

1 The abbreviations used are: Th, T helper; CIRE, conserved intronic regulatory element; TcR, T cell receptor; IL, interleukin; IFN-{gamma}, interferon-{gamma}; ChIP, chromatin immunoprecipitation; APC, antigen-presenting cell; CREB, cAMP-response element-binding protein; CBP, CREB-binding protein. Back


   ACKNOWLEDGMENTS
 
We thank T. HÖfer for helpful discussions.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Vitetta, E. S., Berton, M. T., Burger, C., Kepron, M., Lee, W. T., and Yin, X. M. (1991) Annu. Rev. Immunol. 9, 193–217[CrossRef][Medline] [Order article via Infotrieve]
  2. Dutton, R. W., Bradley, L. M., and Swain, S. L. (1998) Annu. Rev. Immunol. 16, 201–223[CrossRef][Medline] [Order article via Infotrieve]
  3. Seder, R. A., and Paul, W. E. (1994) Annu. Rev. Immunol. 12, 635–673[CrossRef][Medline] [Order article via Infotrieve]
  4. Coffman, R. L., and Mosmann, T. R. (1991) Res. Immunol. 142, 7–9[CrossRef][Medline] [Order article via Infotrieve]
  5. LÖhning, M., Richter, A., and Radbruch, A. (2002) Adv. Immunol. 80, 115–181[Medline] [Order article via Infotrieve]
  6. Murphy, K. M., and Reiner, S. L. (2002) Nat. Rev. Immunol. 2, 933–944[CrossRef][Medline] [Order article via Infotrieve]
  7. Messi, M., Giacchetto, I., Nagata, K., Lanzavecchia, A., Natoli, G., and Sallusto, F. (2003) Nat. Immunol. 4, 78–86[CrossRef][Medline] [Order article via Infotrieve]
  8. Zheng, W., and Flavell, R. A. (1997) Cell 89, 587–596[CrossRef][Medline] [Order article via Infotrieve]
  9. Ouyang, W., LÖhning, M., Gao, Z., Assenmacher, M., Ranganath, S., Radbruch, A., and Murphy, K. M. (2000) Immunity 12, 27–37[CrossRef][Medline] [Order article via Infotrieve]
  10. Lavenu-Bombled, C., Trainor, C. D., Makeh, I., Romeo, P. H., and Max-Audit, I. (2002) J. Biol. Chem. 277, 18313–18321[Abstract/Free Full Text]
  11. HÖfer, T., Nathansen, H., LÖhning, M., Radbruch, A., and Heinrich, R. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 9364–9368[Abstract/Free Full Text]
  12. Siegel, M. D., Zhang, D. H., Ray, P., and Ray, A. (1995) J. Biol. Chem. 270, 24548–24555[Abstract/Free Full Text]
  13. Kishikawa, H., Sun, J., Choi, A., Miaw, S. C., and Ho, I. C. (2001) J. Immunol. 167, 4414–4420[Abstract/Free Full Text]
  14. Takemoto, N., Kamogawa, Y., Jun Lee, H., Kurata, H., Arai, K. I., O'Garra, A., Arai, N., and Miyatake, S. (2000) J. Immunol. 165, 6687–6691[Abstract/Free Full Text]
  15. Henkel, G., and Brown, M. A. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 7737–7741[Abstract/Free Full Text]
  16. Agarwal, S., Avni, O., and Rao, A. (2000) Immunity 12, 643–652[CrossRef][Medline] [Order article via Infotrieve]
  17. Yamashita, M., Ukai-Tadenuma, M., Kimura, M., Omori, M., Inami, M., Taniguchi, M., and Nakayama, T. (2002) J. Biol. Chem. 277, 42399–42408[Abstract/Free Full Text]
  18. Spilianakis, C. G., and Flavell, R. A. (2004) Nat. Immunol. 5, 1017–1027[CrossRef][Medline] [Order article via Infotrieve]
  19. Pai, S. Y., Truitt, M. L., and Ho, I. C. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 1993–1998[Abstract/Free Full Text]
  20. Yamashita, M., Ukai-Tadenuma, M., Miyamoto, T., Sugaya, K., Hosokawa, H., Hasegawa, A., Kimura, M., Taniguchi, M., DeGregori, J., and Nakayama, T. (2004) J. Biol. Chem. 279, 26983–26990[Abstract/Free Full Text]
  21. Zhu, J., Min, B., Hu-Li, J., Watson, C. J., Grinberg, A., Wang, Q., Killeen, N., Urban, J. F., Jr., Guo, L., and Paul, W. E. (2004) Nat. Immunol. 5, 1157–1165[CrossRef][Medline] [Order article via Infotrieve]
  22. Bird, J. J., Brown, D. R., Mullen, A. C., Moskowitz, N. H., Mahowald, M. A., Sider, J. R., Gajewski, T. F., Wang, C. R., and Reiner, S. L. (1998) Immunity 9, 229–237[CrossRef][Medline] [Order article via Infotrieve]
  23. Guo, L., Hu-Li, J., Zhu, J., Watson, C. J., Difilippantonio, M. J., Pannetier, C., and Paul, W. E. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 10623–10628[Abstract/Free Full Text]
  24. Agarwal, S., and Rao, A. (1998) Curr. Opin. Immunol. 10, 345–352[CrossRef][Medline] [Order article via Infotrieve]
  25. Lee, D. U., Agarwal, S., and Rao, A. (2002) Immunity 16, 649–660[CrossRef][Medline] [Order article via Infotrieve]
  26. Avni, O., Lee, D., Macian, F., Szabo, S. J., Glimcher, L. H., and Rao, A. (2002) Nat. Immunol. 3, 643–651[Medline] [Order article via Infotrieve]
  27. Fields, P. E., Kim, S. T., and Flavell, R. A. (2002) J. Immunol. 169, 647–650[Abstract/Free Full Text]
  28. Grogan, J. L., Mohrs, M., Harmon, B., Lacy, D. A., Sedat, J. W., and Locksley, R. M. (2001) Immunity 14, 205–215[Medline] [Order article via Infotrieve]
  29. Makar, K. W., Perez-Melgosa, M., Shnyreva, M., Weaver, W. M., Fitzpatrick, D. R., and Wilson, C. B. (2003) Nat. Immunol. 4, 1183–1190[CrossRef][Medline] [Order article via Infotrieve]
  30. Richter, A., LÖhning, M., and Radbruch, A. (1999) J. Exp. Med. 190, 1439–1450[Abstract/Free Full Text]
  31. Lohning, M., Richter, A., Stamm, T., Hu-Li, J., Assenmacher, M., Paul, W. E., and Radbruch, A. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 12307–12312[Abstract/Free Full Text]
  32. Kress, C., Thomassin, H., and Grange, T. (2001) FEBS Lett. 494, 135–140[CrossRef][Medline] [Order article via Infotrieve]
  33. Hutchins, A. S., Mullen, A. C., Lee, H. W., Sykes, K. J., High, F. A., Hendrich, B. D., Bird, A. P., and Reiner, S. L. (2002) Mol. Cell 10, 81–91[CrossRef][Medline] [Order article via Infotrieve]
  34. Hu-Li, J., Pannetier, C., Guo, L., LÖhning, M., Gu, H., Watson, C., Assenmacher, M., Radbruch, A., and Paul, W. E. (2001) Immunity 14, 1–11[CrossRef][Medline] [Order article via Infotrieve]
  35. Hajkova, P., el-Maarri, O., Engemann, S., Oswald, J., Olek, A., and Walter, J. (2002) Methods Mol. Biol. 200, 143–154[Medline] [Order article via Infotrieve]
  36. Zhang, D. H., Cohn, L., Ray, P., Bottomly, K., and Ray, A. (1997) J. Biol. Chem. 272, 21597–21603[Abstract/Free Full Text]
  37. Lee, H. J., O'Garra, A., Arai, K., and Arai, N. (1998) J. Immunol. 160, 2343–2352[Abstract/Free Full Text]
  38. Yamashita, M., Shinnakasu, R., Nigo, Y., Kimura, M., Hasegawa, A., Taniguchi, M., and Nakayama, T. (2004) J. Biol. Chem. 279, 39454–39464[Abstract/Free Full Text]
  39. Assenmacher, M., Lohning, M., Scheffold, A., Richter, A., Miltenyi, S., Schmitz, J., and Radbruch, A. (1998) J. Immunol. 161, 2825–2832[Abstract/Free Full Text]
  40. Lee, H. J., Takemoto, N., Kurata, H., Kamogawa, Y., Miyatake, S., O'Garra, A., and Arai, N. (2000) J. Exp. Med. 192, 105–115[Abstract/Free Full Text]
  41. Bix, M., and Locksley, R. M. (1998) Science 281, 1352–1354[Abstract/Free Full Text]
  42. Riviere, I., Sunshine, M. J., and Littman, D. R. (1998) Immunity 9, 217–228[CrossRef][Medline] [Order article via Infotrieve]
  43. Blobel, G. A., Nakajima, T., Eckner, R., Montminy, M., and Orkin, S. H. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 2061–2066[Abstract/Free Full Text]
  44. Boyes, J., Byfield, P., Nakatani, Y., and Ogryzko, V. (1998) Nature 396, 594–598[CrossRe