Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M501484200 on May 31, 2005

J. Biol. Chem., Vol. 280, Issue 31, 28601-28609, August 5, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/31/28601    most recent
M501484200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vassilopoulos, S.
Right arrow Articles by Marty, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vassilopoulos, S.
Right arrow Articles by Marty, I.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Triadins Are Not Triad-specific Proteins

TWO NEW SKELETAL MUSCLE TRIADINS POSSIBLY INVOLVED IN THE ARCHITECTURE OF SARCOPLASMIC RETICULUM*

Stéphane Vassilopoulos{ddagger}§, Dominique Thevenon{ddagger}§, Sophia Smida Rezgui{ddagger}§, Julie Brocard{ddagger}§, Agnès Chapel||, Alain Lacampagne**{ddagger}{ddagger}, Joël Lunardi{ddagger}§, Michel DeWaard{ddagger}§, and Isabelle Marty{ddagger}§§§

From the {ddagger}INSERM U607, Laboratoire Canaux Calciques, Fonctions et Pathologies, Grenoble F-38054, France, §CEA Grenoble, DRDC, Grenoble F-38000, France, University Joseph Fourier, Grenoble F-38000, France, ||CEA Grenoble, DRDC, Laboratoire Chimie des Protéines, Grenoble F-38054, France, **INSERM U637, IFR3, Physiopathologie Cardiovasculaire, Montpellier F-34095, France, and {ddagger}{ddagger}CHU Arnaud de Villeneuve, Montpellier F-3400, France

Received for publication, February 8, 2005 , and in revised form, May 2, 2005.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
We have cloned two new triadin isoforms from rat skeletal muscle, Trisk 49 and Trisk 32, which were named according to their theoretical molecular masses (49 and 32 kDa, respectively). Specific antibodies directed against each protein were produced to characterize both new triadins. Both are expressed in adult rat skeletal muscle, and their expression in slow twitch muscle is lower than that in fast twitch muscle. Using double immunofluorescent labeling, the localization of these two triadins was studied in comparison to well-characterized proteins such as ryanodine receptor, calsequestrin, desmin, Ca2+-ATPase, and titin. None of these two triadins are localized within the rat skeletal muscle triad. Both are instead found in different parts of the longitudinal sarcoplasmic reticulum. We attempted to identify partners for each isoform: neither is associated with ryanodine receptor; Trisk 49 could be associated with titin or another sarcomeric protein; and Trisk 32 could be associated with IP3 receptor. These results open further fields of research concerning the functions of these two proteins; in particular, they could be involved in the set up and maintenance of a precise sarcoplasmic reticulum structure.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Skeletal muscle cells have highly organized structures. Sarcomeres, the contractile units of striated muscles, are assembled from thousands of proteins to produce the largest and most regular macromolecular complex known. In addition, this organized structure is designed to undergo strong mechanical stress during muscle contraction. Muscle contraction is activated by Ca2+ release from the sarcoplasmic reticulum in response to plasma membrane depolarization. This process is referred to as excitation-contraction coupling and takes place at the skeletal muscle triad junction, where T-tubules and the sarcoplasmic reticulum terminal cisternae are in close contact (1). To perform its function, the sarcoplasmic reticulum is built as a sleeve-like structure around the myofibrils, and it is compartmentalized in highly specialized structures (terminal cisternae and longitudinal reticulum) with specialized functions (calcium release and calcium uptake, respectively) (2).

Calcium release occurs via a macromolecular complex, the calcium release complex, specifically localized in the skeletal muscle triad (3). Major components of this calcium release complex are the two calcium channels, the ryanodine receptor (RyR)1 and the dihydropyridine receptor (4). Triadin is an integral membrane protein of the sarcoplasmic reticulum, first identified in rabbit skeletal muscle in 1990 (5, 6) as a 95-kDa glycoprotein specifically located in the triads. Because of its co-localization with RyR in the triads, involvement of triadin in excitation-contraction coupling has been presumed (7, 8). Protein interaction studies have shown that molecular partners of triadin are RyR (9-11); calsequestrin (CSQ), the protein that traps calcium inside the sarcoplasmic reticulum (12-14); junctin (15); and histidine-rich Ca2+-binding protein (16). Functional studies have shown that triadin by itself is able to regulate the activity of the RyR calcium channel in vitro (11, 17).

Triadin is expressed in both skeletal and cardiac muscle. Several isoforms of triadin have been identified in cardiac muscle. Three isoforms, called CT1, CT2, and CT3 (with molecular masses of 35, 40, and 92 kDa, respectively), have been cloned in rabbit heart (18). Of these, CT1 (35 kDa) is the major triadin isoform expressed in canine heart muscle, whereas CT2 (40 kDa) is not detectable as a protein, and CT3 (92 kDa) is expressed at very low levels in this species (19). More recently, three triadin isoforms have been cloned from mouse heart muscle with molecular masses of 35, 35.5, and 40 kDa (20). Whereas the 35- and 40-kDa isoforms presumably correspond to CT1 and CT2 isoforms of rabbit heart muscle, the 35.5-kDa protein presumably represents a new isoform.

We have previously shown that multiple isoforms of triadin are also expressed in rat skeletal muscle (21), and we identified a new skeletal muscle triadin isoform with an apparent molecular mass of 51 kDa. This new isoform was cloned from rat skeletal muscle (21) and human skeletal muscle (22). The skeletal muscle triadin isoforms were named according to their apparent molecular masses: Trisk (for triadin skeletal) 95 for the 95-kDa isoform, and Trisk 51 for the 51-kDa isoform. We have also shown that Trisk 95 and Trisk 51 are expressed in equivalent amounts in rabbit and rat skeletal muscles.

In the present study, two new shorter rat skeletal muscle triadins were cloned, Trisk 49 and Trisk 32. Specific antibodies were developed and used to characterize both proteins more precisely. The expression patterns of triadins were studied in fast and slow twitch muscles and during differentiation. The localization of these two triadins was studied with respect to other well-characterized proteins localized in known regions of the sarcomere. This study demonstrates that both 49- and 32-kDa triadins are not located within the triad, like Trisk 95 and Trisk 51, but are rather found in the longitudinal sarcoplasmic reticulum. Through double immunofluorescent labeling, this study precisely specifies their localization within the longitudinal sarcoplasmic reticulum and identifies possible partners for each protein. This raises new questions concerning their possible function: Trisk 49 and Trisk 32 could be involved in the maintenance of sarcomere structure during contraction, and Trisk 32 could also be involved in the regulation of nontriadic calcium release complex.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
cDNA Cloning—Total RNA was extracted from adult rat skeletal muscle using RNA-Plus (Q Biogene). mRNA was then purified twice using the Oligotex mRNA purification system (Qiagen). The first cDNA strand was synthesized by Superscript reverse transcriptase (Invitrogen) using Smart Race PCR cDNA Amplification Kit (Clontech) for 90 min at 65 °C in the presence of 0.6 M trehalose (Sigma-Aldrich) with the 3' CDS primer (AAGCAGTGGTAACAACGCAGAGTAC(T)30-3') and under all other conditions/products supplied in the kit. On the structural basis of triadin clone search (common 5'-end, and divergent 3'-end), a 3'-rapid amplification of cDNA ends PCR was performed with a common 5'-end primer, starting in the non-coding sequence of triadin at -19 (5'-ATTGATTTCTGCACCCACCATGACTGAG-3') and extended toward the 3' divergent extremity up to the CDS primer used for reverse transcription (universal primer supplied in the kit, 5'-CTAATACGACTCACTATAGGGCAAGCAGTGGTAACAACGCAGAGT-3'). PCR products were then subcloned using TA cloning PGEM-T easy (Promega). Vectors containing inserts of >1kb were then sequenced, resulting in the occurrence of two clones named 8F and 10D.

Antibodies—Anti-calsequestrin monoclonal antibody (clone VIIID12) was obtained from Affinity BioReagents. Mouse anti-IP3R type III antibody was from Transduction Laboratories. Monoclonal anti-desmin antibody (clone DE-R-11) was from DakoCytomation. Monoclonal anti-titin antibody (T11), specific to the A-I junction, originated from Abcam. Guinea pig anti-Ca2+-ATPase was a gift from Dr. A. M. Lompré (23). Rabbit anti-bovine mitochondrial F1-ATPase antibody was previously characterized (24). Anti-ryanodine receptor antibodies obtained by rabbit immunization with ryanodine receptor purified from pig skeletal muscle have been described previously (4), as have antibodies against Trisk 95 and Trisk 51 (21) and antibodies against the N-terminal end of triadins (25). Using the same experimental techniques, anti-Trisk 49 and anti-Trisk 32 have been produced. Anti-Trisk 49 results from rabbit immunization with the C-terminal peptide of Trisk 49, with an extra tyrosine residue added to its N-terminal end to allow coupling with ovalbumin (YSTTGKHS). Anti-Trisk 32 results from the immunization of a rabbit or guinea pig with the C-terminal peptide of Trisk 32, with an extra tyrosine residue added to its N-terminal end to allow coupling with ovalbumin (YGGPKRILDKKQI). With the exception of antibodies used against Trisk 49 and Trisk 32, all other antibodies used in this study have previously been characterized and used.

Microsome Preparation—Two types of skeletal muscle were collected from adult rat hind legs: extensor digitorum longus (EDL) and soleus. Crude microsomes were prepared from each muscle with slight modifications to the procedures previously described (21). Indeed, after muscle homogenization in a 30-ml solution made up of 200 mM sucrose, 20 mM HEPES (pH 7.4), 0.4 mM CaCl2, 2 mM leupeptin, 100 mM phenylmethylsulfonyl fluoride, and 1 mM diisopropyl fluorophosphate, the low-speed (10 min at 1500 x g) pellet was discarded, and microsomes were obtained after 50 min of centrifugation at 41,000 x g. They were homogenized at 8-10 mg/ml in 0.1 M NaCl, 30 mM imidazole (pH 6.8), 8% sucrose, and protease inhibitors and stored in liquid nitrogen.

Satellite Cell Cultures—Rat skeletal muscle cell primary cultures resulted from satellite cells obtained by trypsinization of muscle fragments extracted from 20-day-old rat embryos. They were induced through differentiation and formed myotubes, as previously described (21).

L6 Cell Cultures and Transfection—Rat myogenic L6 cells (clone C5) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Invitrogen) and 1% penicillin-streptomycin. They were transfected with Lipofectamine and Plus Reagent (Invitrogen) as reported previously (21). The expression plasmid used for transfection was plasmid pcDNA3.1 (Invitrogen), with cDNA coding for Trisk 49 (full-length sequence of clone 10D) or Trisk 32 (full-length sequence of clone 8F).

Western Blot Analysis—The presence of Trisk 49 or Trisk 32 in samples was assayed by Western blot analysis, using a chemiluminescent reagent (Western lightning chemiluminescence reagent plus; PerkinElmer Life Sciences) after electrophoretic separation of the protein on a 5-15% acrylamide gel and electrotransfer on Immobilon P (Millipore) (21). The secondary antibodies were labeled with horseradish peroxidase and supplied by Jackson ImmunoResearch Laboratories.

Immunolabeling—Adult rat skeletal muscle (EDL) was embedded in Tissue-Tek OCT compound (Miles Inc.), frozen, and stored at -20 °C. Cryosections (10-µm thick) collected on microscope slides were fixed for 10 min with 4% paraformaldehyde in PBS at room temperature and then washed twice (10 min each) with PBS at 4 °C. After a 5-min permeabilization with 0.5% Triton X-100 in PBS at room temperature and a 30-min saturation with PBS supplemented with 0.1% Triton X-100, 0.5% bovine serum albumin, and 2% goat serum, the sections were incubated for 2 h at room temperature with the primary antibodies (dilution, 1:100 to 1:800) in PBS supplemented with 0.1% Triton X-100, 0.5% bovine serum albumin, and 2% goat serum and washed three times (10 min each) at 4 °C with PBS and 0.1% Triton X-100. The sections were then incubated with secondary antibodies for 30 min at room temperature. After three 10-min washes in PBS and 0.1% Triton X-100 at room temperature, the nuclei were stained with TO-PRO-3 (Molecular Probes), and the samples were mounted with an anti-fading solution (DakoCytomation fluorescent mounting medium; DakoCytomation). For double labeling, the two primary antibodies (from different species) and the two secondary antibodies were added at the same time. The secondary antibodies were labeled with either Alexa-488, Alexa-546 (both from Molecular Probes), or Cy3 (Jackson ImmunoResearch Laboratories). The muscle sections were analyzed by confocal laser scanning microscopy using a Leica TCS-SP2 operating system. Alexa-488, Alexa-546, or Cy3 fluorescence was sequentially excited and collected (400 Hz line by line) by using a 488-nm argon laser line for Alexa-488 and a 543-nm helium-neon laser line for Alexa-546 and Cy3 excitation. Fluorescence emission was collected from 498 to 541 nm for Alexa-488 and from 554 to 625 nm for Alexa-546 and Cy3. To assess the specificity of some antibodies, the antibody was pre-incubated with the corresponding antigenic peptide for 1 h at room temperature.

For myotubes (differentiated satellite cells), the immunolabeling was performed directly in the culture plate. After fixation of the cells with a 4% paraformaldehyde solution for 15 min, and two 5-min washes with PBS, the cells were permeabilized for 5 min with PBS and 0.25% Triton X-100, and the immunolabeling was achieved similarly to that described for muscle sections.

Immunoprecipitation—Rat skeletal muscle microsomes or Trisk 32-transfected cells were solubilized for 30 min at 4 °C at 3 mg/ml in a buffer composed of 0.9 M NaCl, 1.6% CHAPS, 0.1% phospholipids (egg total phosphatide extract; Avanti%20Polar%20Lipids">Avanti Polar Lipids), 20 mM Pipes (pH 7.1), 200 µM phenylmethylsulfonyl fluoride, and 1 mM diisopropyl fluorophosphate. After solubilization, the solubilized proteins were diluted with 1 volume of PBS and 1 volume of H2O. The immunoprecipitation was then performed with the chosen antibody and protein A-Sepharose as described previously (4). The immunoprecipitated proteins were then analyzed by Western blotting.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning of Trisk 49 and Trisk 32—We have previously shown that multiple triadin mRNA are produced in rat skeletal muscle (21), and we have cloned two major triadin isoforms, Trisk 95 and Trisk 51, which correspond to 4.5-kb transcripts. We then went on with cloning the remaining smaller transcripts.

The classic reverse transcription technique using oligo(dT)18 failed to provide full-length clones because of the presence of A-rich regions in the sequence of the cDNA, and only 3'-truncated clones were obtained. A more stringent technique was thus used to eliminate hybridization of the oligo(dT) primer within the internal stretches of A in the region spanning triadin nucleotides 900-1200. The reverse transcription step was performed with a 30-mer oligo(dT), at a temperature of 65 °C, and in the presence of trehalose to stabilize the reverse transcriptase at such a high temperature (26, 27). Under these conditions, most of the cDNAs produced by Superscript reverse transcriptase were full-length clones, resulting from an oligo(dT) hybridization only on the correct poly(A) stretches.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 1.
Sequence alignment of the C-terminal specific sequences of Trisk 32 and Trisk 49 with Trisk 95, Trisk 51, and mouse CT1 (cardiac isoform). Amino acids within the boxes represent the conserved sequences between the different isoforms. Numbers above the sequences correspond to amino acid positions in the Trisk 95 sequence.

 
Two clones, named 10D and 8F, were further analyzed. Clone 8F contains an open reading frame of 864 bp followed by a non-coding sequence of 127 bp with a polyadenylation signal. It encodes a 287-amino acid protein with a molecular mass of 32.1 kDa, and it was thus named Trisk 32 according to its molecular mass, as proposed for the two other skeletal muscle triadins, Trisk 95 and Trisk 51. Trisk 32 results from an alternative splicing after the eight first exons of human triadin (22) and possesses a unique C-terminal end made of 23 amino acids (Fig. 1). The size of this triadin isoform is similar to that of CT1, the major cardiac triadin (19). CT1 is nevertheless distinct from Trisk 32, even though both result from alternative splicing after exon 8, because Trisk 32 has a different specific C-terminal end (Fig. 1).



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 2.
Western blot analysis of Trisk 32 and Trisk 49. A, L6 cells transfected with Trisk 32 or Trisk 49 cDNA. Fifty micrograms of cell lysates were loaded in each lane. Lane 1, L6 cells transfected with Trisk 32. Lanes 2 and 4, non-transfected L6 cells. Lane 3, L6 cells transfected with Trisk 49. Western blot analysis was performed with anti-Trisk 32 (lanes 1 and 2) or anti-Trisk 49 (lanes 3 and 4). B, identification of Trisk 32 and Trisk 49 in rat skeletal muscle. Forty micrograms of rat skeletal muscle microsomes were loaded in each lane. Western blot analysis was performed with anti-Trisk 32, without (lane 1) and with (lane 2) pre-incubation of the antibody with the corresponding peptide (10 µg/ml). Western blot analysis in lanes 3 and 4 was performed with anti-Trisk 49, without (lane 3) and with (lane 4) pre-incubation with the corresponding peptide (10 µg/ml). C, Western blot analysis of rat skeletal muscle with an antibody directed against the N-terminal end of triadin, common to all triadin isoforms. Five micrograms of rat skeletal microsomes were loaded. The three major bands correspond to Trisk 95, Trisk 51, and Trisk 32.

 
Clone 10D, which contains an open reading frame of 1326 bp and a short non-coding sequence of 24 bp with a polyadenylation signal, encodes a protein of 442 amino acids and results from an alternative splicing after the 20 first exons of human triadin. It possesses a unique C-terminal end of four amino acids (Fig. 1). The corresponding protein formed of 442 amino acids has a theoretical molecular mass of 49.5 kDa and was thus named Trisk 49.



View larger version (61K):
[in this window]
[in a new window]
 
FIG. 3.
Expression of triadin isoforms in slow twitch and fast twitch muscle. The relative amount of each triadin isoform was assessed by Western blot analysis on slow twitch muscle (soleus, lanes 1, 3, 5, and 7) and fast twitch muscle (EDL, lanes 2, 4, 6, and 8). Twenty micrograms of microsomes from both muscle types were loaded in each lane, with the exception of lane 5, in which 40 µg of soleus microsomes were loaded. Analysis was performed with antibodies against Trisk 95 (lanes 1 and 2), Trisk 51 (lanes 3 and 4), Trisk 49 (lanes 5 and 6), and Trisk 32 (lanes 7 and 8).

 
Evidence for the Existence of Trisk 49 and Trisk 32—To check that the cloned cDNAs are physiologically translated in the corresponding proteins, specific antibodies were produced for each isoform. Taking advantage of their C-terminal specific sequences, synthetic peptides were produced and used to immunize either rabbits or guinea pigs. Reactivity of these antibodies was first checked on cells transfected with the corresponding cloned cDNA (Fig. 2A) and then checked on rat skeletal muscle (Fig. 2B).

Transfection of L6 cells with Trisk 32 cDNA gave rise to a triplet of approximately 37 kDa, specifically recognized by anti-Trisk 32 antibodies (Fig. 2A, lane 1). Transfection of L6 cells with Trisk 49 cDNA gave rise to a unique band of approximately 60 kDa, specifically recognized by anti-Trisk 49 antibodies (Fig. 2A, lane 3). The multiple bands observed for Trisk 32 are thought to arise from post-transcriptional modifications (such as glycosylation) because a single cDNA leads to the expression of two/three proteins, a situation that has previously been observed for Trisk 51 expressed in L6 cells (21) and for cardiac triadin CT1 expressed in Sf21 insect cells (19).



View larger version (119K):
[in this window]
[in a new window]
 
FIG. 4.
Co-localization of RyR and Trisk 95 and of CSQ and Trisk 51 in rat skeletal muscle sections. Longitudinal sections of adult rat EDL were immunolabeled with specific antibodies against RyR and Trisk 95 (T95) and CSQ and Trisk 51 (T51). They presented the typical triad protein labeling pattern: double rows of fluorescent dots corresponding to triads pairs on either side of the Z-line.

 
These antibodies were then tested by Western blot analysis on rat skeletal muscle to identify the corresponding protein within skeletal muscle. Anti-Trisk 32 specifically recognizes a triplet within rat skeletal muscle (Fig. 2B, lane 1), which was abolished by pre-incubation with the corresponding peptide (Fig. 2B, lane 2). Anti-Trisk 49 antibodies recognized a faint but specific band in rat skeletal muscle (Fig. 2B, lane 3), as shown by the abolition of the signal upon antibody-peptide pre-incubation (Fig. 2B, lane 4). Using anti-N-terminal end antibodies, which are common to all triadin isoforms and thus allow relative quantification, this study showed that Trisk 32 is present in about the same quantities as Trisk 95 and Trisk 51 (Fig. 2C). Because Trisk 49 migrates at the same molecular mass as Trisk 51, it is impossible to distinguish the respective contributions of Trisk 51 and Trisk 49 in the observed band. Nevertheless, it is likely that Trisk 49 is a less abundant isoform compared with the other three, as observed from anti-Trisk 49 reactivity on rat microsomes (Fig. 2B) and reverse transcription-PCR amplification (data not shown).



View larger version (163K):
[in this window]
[in a new window]
 
FIG. 5.
Trisk 49 and Trisk 32 are not in rat skeletal muscle triad. Longitudinal sections of adult rat EDL were immunolabeled with specific antibodies against CSQ and Trisk 49 (T49) (a-c), RyR and Trisk 32 (T32) (d-f), or Trisk 49 and Trisk 32 (g-i). Trisk 49 labeling (b) is presented as a double row of rods, closer to the Z-line than the triads are (represented by CSQ labeling, a). Trisk 32 labeling (e) appears as a row of dots in the middle of the triad double rows.

 
Are These Isoforms Specific to Muscle Type?—Because at least four triadin isoforms are expressed in rat skeletal muscle (Trisk 95, Trisk 51, Trisk 49, and Trisk 32), this study further investigated whether some of these isoforms are muscle type-specific. Indeed, myosin and many other skeletal muscle proteins (for review, see Ref. 28) are expressed under a different isoform ("fast" or "slow") when they are localized in fast twitch or slow twitch muscles. Microsomes from two types of rat muscle were prepared to test the reactivity of the different triadin antibodies: EDL, a fast twitch muscle, and soleus, a slow twitch muscle. As shown on Fig. 3, reactivity to all four isoforms is lower in rat slow twitch muscle compared with fast twitch muscle, with Trisk 49 being almost undetectable. Nevertheless, except for Trisk 49, none of these isoforms seem to be slow twitch- or fast twitch-specific proteins. Trisk 49 is present in low amounts in fast twitch muscle, and either its expression in slow twitch muscle decreases to reach the detection limit of Western blot or it is not expressed in slow twitch muscle.



View larger version (149K):
[in this window]
[in a new window]
 
FIG. 6.
Trisk 49 is localized within the longitudinal sarcoplasmic reticulum, at the interface of the A and I bands. Longitudinal sections of adult rat EDL were immunolabeled with specific antibodies against Ca2+-ATPase and Trisk 49 (T49) (a-c), desmin and Trisk 49 (d-f), and titin and Trisk 49 (g-i). Ca2+-ATPase is a longitudinal sarcoplasmic reticulum marker, desmin labels the Z-line, and antibodies used against titin are specific to the A-I interface.

 
Localization of Trisk 49 and Trisk 32 in Adult Skeletal Muscle—To identify the localization of the two new isoforms in rat skeletal muscle, immunohistolabeling of rat EDL longitudinal section was performed with different antibodies: RyR, CSQ, Trisk 95, Trisk 51, Trisk 49, and Trisk 32. As previously observed (21), Trisk 95 and Trisk 51 perfectly co-localize with RyR and CSQ. Fig. 4 presents images of Trisk 95/RyR and Trisk 51/CSQ double labeling, indicating that these two isoforms are localized within the adult rat skeletal muscle triad. The same experiment was performed with anti-Trisk 49 and anti-Trisk 32. These two triadin isoforms presented a striated pattern perpendicular to the fiber axis when observed at low magnification similarly to RyR, CSQ, Trisk 95, and Trisk 51 (data not shown). Nevertheless, at higher magnification, results are completely different for the two isoforms: neither is co-localized with RyR or CSQ (Fig. 5) or with Trisk 95, Trisk 51, or dihydropyridine receptor (data not shown), with these five proteins all being co-localized. The staining for Trisk 49 appears as a double row of rods situated in the middle of the double row of dots observed for CSQ (Fig. 5, a-c). This staining is very intense and contrasts with the faint labeling observed in Western blot, probably because a low amount of Trisk 49 is present, but it is very concentrated in a precise part of the muscle. The staining for Trisk 32 shows a diffused band of dots in the middle of RyR staining (Fig. 5, d-f). In addition, localization of both isoforms is not similar, with Trisk 32 being inside the labeling of Trisk 49 (Fig. 5, g-i). To map their localization more precisely, double immunolabelings were performed with anti-Trisk 49 and anti-Ca2+-ATPase antibodies, anti-desmin or anti-titin (Fig. 6). Ca2+-ATPase is a protein specifically localized in the sarcoplasmic reticulum responsible for the uptake of calcium by the sarcoplasmic reticulum (29) and most abundant in the longitudinal part of the sarcoplasmic reticulum. Desmin is considered a marker of the Z-disc (30). Titin is a giant protein (each molecule, extending from the Z-disc to the M-line, is >1 µm long) that controls the layout of the sarcomere and, by acting like a spring, provides elasticity to the sarcomere (reviewed in Ref. 31). The antibody used to label titin is specific to the A-I junction part of the molecule (32). Trisk 49 is localized within the longitudinal sarcoplasmic reticulum, but it is not present in all the longitudinal reticulum as observed from overlay with Ca2+-ATPase labeling (Fig. 6, a-c). Comparison with localization of desmin showed that it is centered on the Z-disc, the double row of rods surrounding the Z-line (Fig. 6, d-f). Trisk 49 seems more precisely co-localized with titin at the A-I junction (Fig. 6, g-i).

To localize Trisk 32 more precisely, double labeling was performed with anti-Trisk 32 and anti-Ca2+-ATPase, anti-desmin, anti-IP3R type III, or anti-mitochondrial FoF1-ATPase. It has been demonstrated that IP3R is found within the longitudinal sarcoplasmic reticulum at the Z-line (33) and that FoF1-ATPase, a specific mitochondrial protein responsible for ATP synthesis, is localized in the inner membrane of mitochondria (34). Trisk 32 is localized within the longitudinal sarcoplasmic reticulum (Fig. 7, a-c), where it co-localizes with Ca2+-ATPase, and is specifically centered on the Z-disc (colocalization with desmin, Fig. 7, d-f). Trisk 32 is also present in the same part of the reticulum as IP3R (Fig. 7, g-i) and the mitochondria (Fig. 7, j-l).

Identification of Trisk 32 and Trisk 49 Partners—We attempted to identify the specific partners of Trisk 32 and Trisk 49 using immunoprecipitation with specific antibodies, and their association with RyR was first investigated. As expected, RyR was associated with neither Trisk 49 nor Trisk 32 (or only in very minor amounts), in contrast with Trisk 95 and Trisk 51, which are both associated with RyR (Fig. 8A). Based on the possible co-localization observed in immunolabeling, association of Trisk 32 with IP3R was also examined. Because IP3R is a protein that shares homologous domains with RyR and because Trisk 32 shares common parts with Trisk 95, which is associated with RyR, one could assume that Trisk 32 and IP3R are not only partially co-localized but also associated. Nevertheless, it was not possible to demonstrate association of IP3R with Trisk 32 by immunoprecipitation on rat skeletal muscle, probably because of the low expression of IP3R in skeletal muscle (35, 36). Thus, to test this hypothesis, skeletal muscle culture cells (L6 cells) were used because they are known to express high amounts of IP3R type III (36, 37). These cells were transfected with Trisk 32 cDNA or with Trisk 49, Trisk 51, or Trisk 95 cDNAs. Then immunoprecipitation was performed with antibodies directed against the corresponding triadin isoform (anti-Trisk 32, anti-Trisk 49, anti-Trisk 51, or anti-Trisk 95). The presence of IP3R type III among the immunoprecipitated proteins was assayed by Western blot analysis. Results are presented in Fig. 8B. IP3R type III is expressed in the L6 cells, as observed in lane 1. Immunoprecipitation was performed on Trisk 32-transfected (lanes 3 and 5) or non-transfected (lanes 2 and 4) cells, with two different antibodies directed against Trisk 32 (guinea pig anti-Trisk 32, lanes 2 and 3, or rabbit anti-Trisk 32, lanes 4 and 5). Both anti-Trisk 32 antibodies induced co-immunoprecipitation of IP3R type III only in cells expressing Trisk 32. In the cells transfected with another triadin isoform, the immunoprecipitation of this triadin did not lead to the co-immunoprecipitation of IP3R type III (Fig. 8B, lanes 6-8). This indicates that Trisk 32 and IP3R type III are associated within the cells and that the other triadin isoforms (Trisk 49, Trisk 51, and Trisk 95) are unable to interact with IP3R type III. The association with IP3R type III is therefore specific for Trisk 32. It is thus plausible that in skeletal muscle, Trisk 32 and IP3R are not only co-localized but also associated.



View larger version (125K):
[in this window]
[in a new window]
 
FIG. 7.
Trisk 32 is located within the longitudinal sarcoplasmic reticulum, co-localized with IP3R and mitochondria. Longitudinal sections of adult rat EDL were immunolabeled with specific antibodies against Ca2+-ATPase and Trisk 32 (T32) (a-c), desmin and Trisk 32 (d-f), IP3R and Trisk 32 (g-i), and FoF1-ATPase and Trisk 32 (j-l). Ca2+-ATPase is a longitudinal sarcoplasmic reticulum marker, desmin labels the Z-line, IP3R is located in the longitudinal sarcoplasmic reticulum, and FoF1-ATPase is a mitochondria marker.

 



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 8.
A, Trisk 95 and Trisk 51, but not Trisk 32 or Trisk 49, are associated with RyR. Immunoprecipitations were performed on rat skeletal muscle with antibodies against Trisk 95 (IP T95, lane 2), Trisk 51 (IP T51, lane 3), Trisk 32 (IP T32, lane 4), and Trisk 49 (IP T49, lane 5) and with non-immune serum (pre-immune, IP PI, lane 6). The presence of RyR in the immunoprecipitated proteins was analyzed by Western blot. Lane 1, 5 µg of rat skeletal muscle microsomes. The two bands with high molecular masses are characteristic of RyR; the lower one, which is present in a smaller amount, is a proteolytic degradation of RyR. B, Trisk 32, but not Trisk 49, Trisk 51, or Trisk 95, is associated with IP3R in L6 cells. L6 cells were either not transfected (lanes 2 and 4) or transfected with the cDNA of Trisk 32 (lanes 3 and 5), Trisk 49 (lane 6), Trisk 51 (lane 7), or Trisk 95 (lane 8). Immunoprecipitations were then performed with the corresponding anti-Trisk antibody (anti-Trisk 32 developed in guinea pig, lanes 2 and 3; anti-Trisk 32 developed in rabbit, lanes 4 and 5; anti-Trisk 49, lane 6; anti-Trisk 51, lane 7; anti-Trisk 95, lane 8). The immunoprecipitated proteins were analyzed by Western blot using anti-IP3R antibodies. Lane 1, 60 µg of nontransfected L6 cells, for control of IP3R type III expression levels.

 
Because titin and Trisk 49 appear co-localized on muscle sections, co-immunoprecipitation on rat microsomes of titin and Trisk 49 was also attempted, using either anti-titin or anti-Trisk 49 antibodies, but without success. This is probably due to either the low expression of Trisk 49 in skeletal muscle (Fig. 3) or the microsome preparation, which could lead to dissociation of the complex, because both proteins are expressed in different compartments.



View larger version (92K):
[in this window]
[in a new window]
 
FIG. 9.
Trisk 49 and Trisk 32 expression during differentiation of myoblasts. Primary cultures of satellite cells were induced in differentiation. When myotubes formed, the cells were fixed and labeled with antibodies against titin and Trisk 49 (a-c) or IP3R and Trisk 32 (d-f). The nuclei were stained with TO-PRO-3 (blue labeling in c and f). Titin and Trisk 49 antibodies labeled only myotubes (aligned nuclei) and not myoblasts (isolated nuclei), and both presented a striated pattern. IP3R and Trisk 32 antibodies label the myotubes (multinucleated cells) and the myoblasts (isolated nuclei), with a diffuse punctated pattern.

 
Trisk 49 and Trisk 32 Expression during in Vitro Myotube Differentiation—We have previously shown that Trisk 95 and Trisk 51 are progressively expressed in primary cultures of rat skeletal muscle as differentiation and myotube formation takes place. Expression of Trisk 49 and Trisk 32 was examined during in vitro differentiation of rat myoblast primary cultures. The cells were identified by nuclei staining (represented in blue on Fig. 9, c and f). The myotubes were identified through nuclei alignment, whereas other cells remained as myoblasts or fibroblasts. Similarly to Trisk 95 and Trisk 51, Trisk 49 is expressed within myotubes but not within myoblasts (Fig. 9b). As soon as myotubes are formed, Trisk 49 is present under a striated pattern (Fig. 9b), identical to the pattern observed for titin (Fig. 9a). This striated pattern is specific to the protein and abolished by preincubation of antibodies with the peptide (data not shown). The early striated pattern of Trisk 49 is another indication of a possible interaction with titin and probably reflects a specific role and interaction at this early developmental stage.

On the contrary, Trisk 32 shows punctate labeling in myotubes (Fig. 9e), similar to observations for Trisk 95 and Trisk 51, and it is expressed at a low level in myoblasts. This punctated staining in myotubes is already co-localized with IP3R type III (Fig. 9, d-f, insets).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, two new triadin isoforms, Trisk 49 and Trisk 32, were cloned from rat skeletal muscle, and the presence of the corresponding protein was demonstrated using specific antibodies. Whereas Trisk 32 is present in comparable amounts with the two previously described isoforms, Trisk 95 and Trisk 51, Trisk 49 is apparently less abundant. No isoform switch was observed between slow or fast twitch muscles. All triadin isoforms seemed less abundant in slow twitch muscle, probably because the relative amount of sarcoplasmic reticulum is lower in slow twitch muscle than in fast twitch muscle (38).

Analysis of the cellular distribution of these two triadin isoforms in rat skeletal muscle showed that, in contrast to Trisk 95 and Trisk 51, Trisk 49 and Trisk 32 are not located within the skeletal muscle triad. Because all triadins share common sequences, the localization of the triadins inside the muscle cell is somehow connected to the specific C-terminal end of each isoform. Although it could be concluded that the name "triadin," in its original meaning ("located in the triad"), is not fully appropriate for these two triadin isoforms, it nevertheless should be kept because all triadin proteins result from alternative splicings of the same gene. These results were confirmed by immunoprecipitation, and once again it was observed that Trisk 95 and Trisk 51 are associated with RyR and thus members of the calcium release complex, whereas no association was shown for Trisk 49 and Trisk 32. Their involvement in the calcium release complex or excitation-contraction coupling is still unclear. To find clues regarding their function, their precise localization was investigated in skeletal muscle. Using double immunofluorescent labeling on skeletal muscle sections, it was shown that Trisk 32 is localized within the longitudinal part of the sarcoplasmic reticulum, close to the Z-line. This part of the sarcoplasmic reticulum has already been shown to contain IP3R, the other intracellular calcium channel (33, 39), and we indeed observed that Trisk 32 and IP3R are located within the same region of the sarcoplasmic reticulum. The similar localization of these two proteins enabled speculation concerning the existence of a calcium release complex centered around IP3R and involving Trisk 32, identical to the one centered around RyR and involving Trisk 95 and Trisk 51. This hypothesis was reinforced by sequence homologies identified between RyR and IP3R in the channel domains of both proteins (40, 41). This domain of RyR has recently been demonstrated to be an interaction site between RyR and triadin (42). Thus, it is tempting to conclude a Trisk 32-IP3R interaction. To test this hypothesis, immunoprecipitation was performed on a rat skeletal muscle cell line, known to express a higher amount of IP3R than differentiated cells or adult muscle, transfected with Trisk 32 cDNA. Within the transfected cells, results showed that immunoprecipitation of Trisk 32 induced co-immunoprecipitation of IP3R type III. Thus, association of Trisk 32 and IP3R type III can be observed if both partners are expressed in reasonable amounts. This interaction is specific for Trisk 32 and cannot be reproduced with the any of the other triadin isoforms (Trisk 49, Trisk 51, or Trisk 95). We conclude that this association could probably also exist in skeletal muscle, and part of Trisk 32 could be associated with IP3R type III. By double labeling a muscle section with anti-Trisk 32 antibodies and antibodies directed against a specific mitochondrial protein (FoF1-ATP synthase), it was observed that the part of the sarcoplasmic reticulum that contains Trisk 32 also co-localized with the mitochondria. The function of Trisk 32 could then be connected to calcium release via IP3R and/or calcium storage in the mitochondria, which is today a well-established fact (43-46).



View larger version (88K):
[in this window]
[in a new window]
 
FIG. 10.
Schematic organization of the triad area and localization of Trisk 49 and Trisk 32. Possible organizations of the sarcoplasmic reticulum and triad and localization of Trisk 49 and Trisk 32 compared with other known proteins are represented on this figure. Both Trisk 49 and Trisk 32 are located at slightly different places within the non-junctional sarcoplasmic reticulum surrounding the Z-line, whereas triad proteins are found around the T-tubules.

 
Double immunofluorescence labeling was also used to study the precise localization of Trisk 49. As early as the first developmental stages, Trisk 49 differs in its localization from other triadin isoforms. Exterior to the triad, it is organized in a double row of rods localized between the double row of triads and the Z-line. This localization corresponds to the A-I part of titin, a giant protein involved in the organization and elasticity of the sarcomere. Because of low expression of Trisk 49 in skeletal muscle, identification of the molecular partners of Trisk 49 has not yet been achieved, but this will be the focus of future research.

As previously observed for Trisk 95 and Trisk 51, the two new triadins Trisk 49 and Trisk 32 are strongly expressed in myotubes. Whereas Trisk 95, Trisk 51, and Trisk 49 are absent from myoblasts, Trisk 32 seems to have an earlier expression and is weakly expressed before differentiation. Trisk 32 presents a punctated pattern in myotubes, co-localized with IP3R type III, whereas Trisk 49 presents a striated pattern, identical to the one observed for titin. Once again, this could be an indication that Trisk 32 is associated with IP3R and that Trisk 49 is associated with titin ever since the early differentiation stages. Trisk 49 has already reached an organized localization compared with the Z-line, whereas the triads have not. Trisk 49 could be directly connected or not connected to the A-I part of titin, or it could be connected to another sarcomeric protein localized in this region. It could then be involved in sarcomeric structure positioning and organization of the triads.

Fig. 10 summarizes data concerning the localization of Trisk 32 and Trisk 49 in rat skeletal muscle. The next step will involve a more precise identification of their function, which, in contrast to Trisk 95 and Trisk 51, will probably not be connected to excitation-contraction coupling. Because of its similar localization and possible interaction with IP3R, Trisk 32 could be involved in the regulation of a calcium release complex centered on IP3R, in a similar fashion as the regulation of the calcium release complex centered on RyR by Trisk 95. Trisk 32 is already expressed in myoblasts, as well as IP3R, in contrast to Trisk 95 or Trisk 51, which, as RyR, is expressed only in myotubes. One possible role for these two triadin isoforms could involve an anchoring function. During contraction, elasticity of muscle fibers is such that, in order to remain organized, some parts have to be anchored while others are mobile. Position of the triads is fixed compared with the Z-line (47). It is likely that all sarcoplasmic reticulum around the Z-line is fixed, including the triads and mitochondria. In contrast, the sarcoplasmic reticulum centered around myosin undergoes muscle contraction and elongation. In this context, the function of Trisk 32 in a "fixed" sarcoplasmic reticulum could be related to the anchoring of the reticulum and IP3R to adjacent mitochondria. Similarly, Trisk 49 could be involved in connecting titin or another sarcomeric protein to the reticulum close to the triad. Thus, both triadins Trisk 49 and Trisk 32 could contribute to keeping this part of the reticulum stable during contraction. The existence of a cytoskeleton spatially separated from the contractile apparatus is increasingly recognized today (48). A great number of proteins are involved in connecting the plasma membrane with the sarcomere Z-line at the costamere (49). Others are involved in connecting the sarcoplasmic reticulum to the myofibrils (see Ref. 50 for review), like ankyrin (51), or in connecting the plasma membrane to the sarcoplasmic reticulum membrane, like junctophilin (52). Disruption to any of these systems has dramatic consequences on muscle and triad structure or function (52, 53), similarly to conditions observed in some myopathies. Thus, the putative function of Trisk 32 and Trisk 49 in maintaining sarcoplasmic reticulum positioning could be of major importance and needs to be researched thoroughly. In addition, the presence of these two triadins in human skeletal muscle has to be assayed.

Another muscle protein, tropomyosin, has recently been discovered under different isoforms in various localizations of the skeletal muscle, associated with either thin actin filaments or the Z-line (54). Thus, triadins are likely to be part of a large family of skeletal muscle proteins that can have multiple localizations and functions within the same cell. Different types of reticulum exist within skeletal muscle, and it would be worth identifying which type of reticulum (endoplasmic or sarcoplasmic) these triadins are located in to understand their sorting and function (55).


    FOOTNOTES
 
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AJ812275 [GenBank] and AJ812276 [GenBank] .

* This work was supported by grants from the Association Française contre les Myopathies and the GIS-Institut des Maladies Rares and financial support from INSERM, CEA, and the French Ministry of Research. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§§ To whom correspondence should be addressed: CCFP-INSERM U607, DRDC-CEA Grenoble, 17 rue des Martyrs, 38054 Grenoble Cedex 9, France. Tel.: 33-4-38-78-57-06; Fax: 33-4-38-78-50-41; E-mail: imarty{at}cea.fr.

1 The abbreviations used are: RyR, ryanodine receptor; CSQ, calsequestrin; EDL, extensor digitorum longus; IP3R, inositol 1,4,5-trisphosphate receptor; CT, cardiac triadin; PBS, phosphate-buffered saline; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; Pipes, 1,4-piperazinediethanesulfonic acid. Back


    ACKNOWLEDGMENTS
 
We thank Dr. A. M. Lompré for antibodies against Ca2+-ATPase.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Flucher, B. E. (1992) Dev. Biol. 154, 245-260[CrossRef][Medline] [Order article via Infotrieve]
  2. Franzini-Armstrong, C. (1994) in Myology (Engel, A. E., and Franzini-Armstrong, C., eds) pp. 176-199, McGraw-Hill Inc., New York
  3. Flucher, B. E., and Franzini-Armstrong, C. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 8101-8106[Abstract/Free Full Text]
  4. Marty, I., Robert, M., Villaz, M., Lai, Y., De Jongh, K. S., Catterall, W. A., and Ronjat, M. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2270-2274[Abstract/Free Full Text]
  5. Brandt, N. R., Caswell, A. H., Wen, S. R., and Talvenheimo, J. A. (1990) J. Membr. Biol. 113, 237-251[CrossRef][Medline] [Order article via Infotrieve]
  6. Kim, K. C., Caswell, A. H., Talvenheimo, J. A., and Brandt, N. R. (1990) Biochemistry 29, 9281-9289[CrossRef][Medline] [Order article via Infotrieve]
  7. Caswell, A. H., Brandt, N. R., Brunschwig, J. P., and Purkerson, S. (1991) Biochemistry 30, 7507-7513[CrossRef][Medline] [Order article via Infotrieve]
  8. Knudson, C. M., Stang, K. K., Moomaw, C. R., Slaughter, C. A., and Campbell, K. P. (1993) J. Biol. Chem. 268, 12646-12654[Abstract/Free Full Text]
  9. Liu, G., and Pessah, I. N. (1994) J. Biol. Chem. 269, 33028-33034[Abstract/Free Full Text]
  10. Caswell, A. H., Motoike, H. K., Fan, H., and Brandt, N. R. (1999) Biochemistry 38, 90-97[CrossRef][Medline] [Order article via Infotrieve]
  11. Groh, S., Marty, I., Ottolia, M., Prestipino, G., Chapel, A., Villaz, M., and Ronjat, M. (1999) J. Biol. Chem. 274, 12278-12283[Abstract/Free Full Text]
  12. Guo, W., and Campbell, K. P. (1995) J. Biol. Chem. 270, 9027-9030[Abstract/Free Full Text]
  13. Kobayashi, Y. M., Alseikhan, B. A., and Jones, L. R. (2000) J. Biol. Chem. 275, 17639-17646[Abstract/Free Full Text]
  14. Shin, D. W., Ma, J., and Kim, D. H. (2000) FEBS Lett. 486, 178-182[CrossRef][Medline] [Order article via Infotrieve]
  15. Zhang, L., Kelley, J., Schmeisser, G., Kobayashi, Y. M., and Jones, L. R. (1997) J. Biol. Chem. 272, 23389-23397[Abstract/Free Full Text]
  16. Lee, H. G., Kang, H., Kim, D. H., and Park, W. J. (2001) J. Biol. Chem. 276, 39533-39538[Abstract/Free Full Text]
  17. Ohkura, M., Furukawa, K., Fujimori, H., Kuruma, A., Kawano, S., Hiraoka, M., Kuniyasu, A., Nakayama, H., and Ohizumi, Y. (1998) Biochemistry 37, 12987-12993[CrossRef][Medline] [Order article via Infotrieve]
  18. Guo, W., Jorgensen, A. O., Jones, L. R., and Campbell, K. P. (1996) J. Biol. Chem. 271, 458-465[Abstract/Free Full Text]
  19. Kobayashi, Y. M., and Jones, L. R. (1999) J. Biol. Chem. 274, 28660-28668[Abstract/Free Full Text]
  20. Hong, C. S., Ji, J. H., Kim, J. P., Jung, D. H., and Kim, D. H. (2001) Gene (Amst.) 278, 193-199[CrossRef][Medline] [Order article via Infotrieve]
  21. Marty, I., Thevenon, D., Scotto, C., Groh, S., Sainnier, S., Robert, M., Grunwald, D., and Villaz, M. (2000) J. Biol. Chem. 275, 8206-8212[Abstract/Free Full Text]
  22. Thevenon, D., Smida-Rezgui, S., Chevessier, F., Groh, S., Henry-Berger, J., Romero, N. B., Villaz, V., De Waard, M., and Marty, I. (2003) Biochem. Biophys. Res. Commun. 303, 669-675[CrossRef][Medline] [Order article via Infotrieve]
  23. Enouf, J., Lompre, A. M., Bredoux, R., Bourdeau, N., de La Bastie, D., and Levy-Toledano, S. (1988) J. Biol. Chem. 263, 13922-13929[Abstract/Free Full Text]
  24. Lunardi, J., Dupuis, A., Frobert, Y., Grassi, J., and Vignais, P. V. (1989) FEBS Lett. 245, 223-228[CrossRef][Medline] [Order article via Infotrieve]
  25. Marty, I., Robert, M., Ronjat, M., Bally, I., Arlaud, G., and Villaz, M. (1995) Biochem. J. 307, 769-774
  26. Carninci, P., Nishiyama, Y., Westover, A., Itoh, M., Nagaoka, S., Sasaki, N., Okazaki, Y., Muramatsu, M., and Hayashizaki, Y. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 520-524[Abstract/Free Full Text]
  27. Mizuno, Y., Carninci, P., Okazaki, Y., Tateno, M., Kawai, J., Amanuma, H., Muramatsu, M., and Hayashizaki, Y. (1999) Nucleic Acids Res. 27, 1345-1349[Abstract/Free Full Text]
  28. Bottinelli, R., and Reggiani, C. (2000) Prog. Biophys. Mol. Biol. 73, 195-262[CrossRef][Medline] [Order article via Infotrieve]
  29. Jorgensen, A. O., Shen, A. C., MacLennan, D. H., and Tokuyasu, K. T. (1982) J. Cell Biol. 92, 409-416[Abstract/Free Full Text]
  30. Tokuyasu, K. T., Dutton, A. H., and Singer, S. J. (1983) J. Cell Biol. 96, 1727-1735[Abstract/Free Full Text]
  31. Skeie, G. O. (2000) Cell. Mol. Life Sci. 57, 1570-1576[CrossRef][Medline] [Order article via Infotrieve]
  32. Furst, D. O., Osborn, M., Nave, R., and Weber, K. (1988) J. Cell Biol. 106, 1563-1572[Abstract/Free Full Text]
  33. Salanova, M., Priori, G., Barone, V., Intravaia, E., Flucher, B., Ciruela, F., McIlhinney, R. A., Parys, J. B., Mikoshiba, K., and Sorrentino, V. (2002) Cell Calcium 32, 193-200[CrossRef][Medline] [Order article via Infotrieve]
  34. Kopaczyk, K., Asai, J., Allmann, D. W., Oda, T., and Green, D. E. (1968) Arch. Biochem. Biophys. 123, 602-621[CrossRef][Medline] [Order article via Infotrieve]
  35. Furuichi, T., Shiota, C., and Mikoshiba, K. (1990) FEBS Lett. 267, 85-88[CrossRef][Medline] [Order article via Infotrieve]
  36. Vermassen, E., Parys, J. B., and Mauger, J. P. (2004) Biol. Cell 96, 3-17[CrossRef][Medline] [Order article via Infotrieve]
  37. De Smedt, H., Missiaen, L., Parys, J. B., Henning, R. H., Sienaert, I., Vanlingen, S., Gijsens, A., Himpens, B., and Casteels, R. (1997) Biochem. J. 322, 575-583
  38. Eisenberg, B. R., and Kuda, A. M. (1976) J. Ultrastruct. Res. 54, 76-88[CrossRef][Medline] [Order article via Infotrieve]
  39. Powell, J. A., Carrasco, M. A., Adams, D. S., Drouet, B., Rios, J., Muller, M., Estrada, M., and Jaimovich, E. (2001) J. Cell Sci. 114, 3673-3683[Abstract/Free Full Text]
  40. Furuichi, T., Yoshikawa, S., Miyawaki, A., Wada, K., Maeda, N., and Mikoshiba, K. (1989) Nature 342, 32-38[CrossRef][Medline] [Order article via Infotrieve]
  41. Mignery, G. A., Sudhof, T. C., Takei, K., and De Camilli, P. (1989) Nature 342, 192-195[CrossRef][Medline] [Order article via Infotrieve]
  42. Lee, J. M., Rho, S. H., Shin, D. W., Cho, C., Park, W. J., Eom, S. H., Ma, J., and Kim, D. H. (2004) J. Biol. Chem. 279, 6994-7000[Abstract/Free Full Text]
  43. Brini, M. (2003) Cell Calcium 34, 399-405[CrossRef][Medline] [Order article via Infotrieve]
  44. Malli, R., Frieden, M., Osibow, K., Zoratti, C., Mayer, M., Demaurex, N., and Graier, W. F. (2003) J. Biol. Chem. 278, 44769-44779[Abstract/Free Full Text]
  45. Filippin, L., Magalhaes, P. J., Di Benedetto, G., Colella, M., and Pozzan, T. (2003) J. Biol. Chem. 278, 39224-39234[Abstract/Free Full Text]
  46. Rudolf, R., Mongillo, M., Magalhaes, P. J., and Pozzan, T. (2004) J. Cell Biol. 166, 527-536[Abstract/Free Full Text]
  47. Brown, I. E., Kim, D. H., and Loeb, G. E. (1998) J. Muscle Res. Cell Motil. 19, 473-477[CrossRef][Medline] [Order article via Infotrieve]
  48. Clark, K. A., McElhinny, A. S., Beckerle, M. C., and Gregorio, C. C. (2002) Annu. Rev. Cell Dev. Biol. 18, 637-706[CrossRef][Medline] [Order article via Infotrieve]
  49. Ervasti, J. M. (2003) J. Biol. Chem. 278, 13591-13594[Free Full Text]
  50. Sorrentino, V. (2004) Biochim. Biophys. Acta 1742, 113-118[Medline] [Order article via Infotrieve]
  51. Bagnato, P., Barone, V., Giacomello, E., Rossi, D., and Sorrentino, V. (2003) J. Cell Biol. 160, 245-253[Abstract/Free Full Text]
  52. Ito, K., Komazaki, S., Sasamoto, K., Yoshida, M., Nishi, M., Kitamura, K., and Takeshima, H. (2001) J. Cell Biol. 154, 1059-1067[Abstract/Free Full Text]
  53. Tuvia, S., Buhusi, M., Davis, L., Reedy, M., and Bennett, V. (1999) J. Cell Biol. 147, 995-1008[Abstract/Free Full Text]
  54. Kee, A. J., Schevzov, G., Nair-Shalliker, V., Robinson, C. S., Vrhovski, B., Ghoddusi, M., Qiu, M. R., Lin, J. J., Weinberger, R., Gunning, P. W., and Hardeman, E. C. (2004) J. Cell Biol. 166, 685-696[Abstract/Free Full Text]
  55. Kaisto, T., and Metsikko, K. (2003) Exp. Cell Res. 289, 47-57[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Physiol.Home page
P. D. Allen
Triadin, not essential, but useful
J. Physiol., July 1, 2009; 587(13): 3123 - 3124.
[Full Text] [PDF]


Home page
J. Physiol.Home page
I. Marty, J. Fauré, A. Fourest-Lieuvin, S.ép. Vassilopoulos, S. Oddoux, and J. Brocard
Triadin: what possible function 20 years later?
J. Physiol., July 1, 2009; 587(13): 3117 - 3121.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Shen, C. Franzini-Armstrong, J. R. Lopez, L. R. Jones, Y. M. Kobayashi, Y. Wang, W. G. L. Kerrick, A. H. Caswell, J. D. Potter, T. Miller, et al.
Triadins Modulate Intracellular Ca2+ Homeostasis but Are Not Essential for Excitation-Contraction Coupling in Skeletal Muscle
J. Biol. Chem., December 28, 2007; 282(52): 37864 - 37874.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
A. J. Rose, T. J. Alsted, J. B. Kobbero, and E. A. Richter
Regulation and function of Ca2+-calmodulin-dependent protein kinase II of fast-twitch rat skeletal muscle
J. Physiol., May 1, 2007; 580(3): 993 - 1005.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
A. Nori, G. Valle, E. Bortoloso, F. Turcato, and P. Volpe
Calsequestrin targeting to sarcoplasmic reticulum of skeletal muscle fibers
Am J Physiol Cell Physiol, August 1, 2006; 291(2): C245 - C253.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. S. Rezgui, S. Vassilopoulos, J. Brocard, J. C. Platel, A. Bouron, C. Arnoult, S. Oddoux, L. Garcia, M. De Waard, and I. Marty
Triadin (Trisk 95) Overexpression Blocks Excitation-Contraction Coupling in Rat Skeletal Myotubes
J. Biol. Chem., November 25, 2005; 280(47): 39302 - 39308.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/31/28601    most recent
M501484200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vassilopoulos, S.
Right arrow Articles by Marty, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vassilopoulos, S.
Right arrow Articles by Marty, I.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement