HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 280, Issue 32, 28944-28951, August 12, 2005

This Article Abstract Full Text (PDF) All Versions of this Article: 280/32/28944    most recent M504937200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Hicks, S. W. Articles by Machamer, C. E. Search for Related Content PubMed PubMed Citation Articles by Hicks, S. W. Articles by Machamer, C. E. Social Bookmarking                      What's this?

Isoform-specific Interaction of Golgin-160 with the Golgi-associated Protein PIST^*

Stuart W. Hicks and Carolyn E. Machamer

From the Department of Cell Biology, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205

Received for publication, May 4, 2005 , and in revised form, June 2, 2005.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Golgin-160 belongs to the golgin family of Golgi-localized proteins, which have been implicated in Golgi structure and function. Golgin-160 possesses an N-terminal non-coiled-coil "head" domain followed by an extensive coiled-coil region. Using the N-terminal head domain of golgin-160 as bait in a yeast two-hybrid screen, the postsynaptic density-95/Discs large/zona occludens-1 (PDZ) domain protein interacting specifically with TC10 (PIST) was identified to interact with golgin-160. PIST (also known as GOPC, CAL, and FIG) has been implicated in the trafficking of a subset of plasma membrane proteins, supporting a role of golgin-160 in vesicular trafficking. Golgin-160 and PIST colocalize to Golgi membranes and interact in vivo. Glutathione S-transferase binding experiments identified an internal region of PIST that includes a coiled-coil domain, which interacts directly with golgin-160. Similar binding experiments identified a leucine-rich repeat within golgin-160 necessary for interaction with PIST. Therefore, our data suggest that golgin-160 may participate in PIST-dependent trafficking of cargo. Interestingly, we also discovered a widely expressed isoform of golgin-160, golgin-160B, which lacks the exon encoding the leucine repeat that mediates binding to PIST. As predicted, golgin-160B was unable to bind PIST. Full-length golgin-160 and golgin-160B may link distinct subsets of proteins to effect specific membrane trafficking pathways.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The mammalian Golgi complex is composed of polarized stacks of cisternal membranes connected by tubules to form a reticular network of membranes located in a juxtanuclear position (1). Transport through the Golgi apparatus allows for posttranslational modification of proteins and lipids as cargo sequentially encounters modifying enzymes before being sorted to its final destination. Although the importance of Golgi structure in the proper and efficient transport of secretory cargo is well documented, understanding how Golgi structure and function are coupled remains an active area of research.

The golgin family of Golgi-localized proteins has been implicated in both Golgi structure and function. Members of the golgin family were first identified as autoantigens in patients with autoimmune diseases, but the family has been expanded to include any Golgi-localized protein that contains an extensive coiled-coil region. The golgin family of proteins includes peripheral membrane proteins such as GM130 (2), golgin-45 (3), golgin-97 (4), golgin-160 (5, 6), and golgin-230/245 (7, 8) as well as the integral membrane proteins, golgin-67 (9), golgin-84 (10), and giantin (11).

GM130 and giantin are the best-studied golgins. GM130 associates with Golgi membranes by binding to GRASP65, an N-ethylmaleimide-sensitive cis-Golgi membrane protein important for cisternal stacking (12). Giantin in transport vesicles is thought to interact via p115 with GM130-GRASP65 in a Rab1-dependent manner (13). The tethering of giantin-containing vesicles with cisternal membranes containing GM130-GRASP65 is proposed to increase the specificity and/or efficiency of soluble N-ethylmaleimide factor attachment protein receptor (SNARE)-mediated recognition and fusion of transport vesicles (14).

A number of other golgins have also been implicated in the maintenance of Golgi structure and function. A medial-Golgi complex containing GRASP55 and golgin-45 was identified (3). Depletion of golgin-45 by RNA interference results in Golgi disassembly and inhibition of secretory protein transport. Depletion of golgin-84 leads to Golgi fragmentation and to reduced cell surface expression of the vesicular stomatitis virus G protein (15). Similarly, depletion of another golgin, golgin-97, results in Golgi fragmentation and inhibition of cholera toxin B fragment retrograde trafficking from the endosome-to-trans-Golgi network (16). Taken together, these results suggest that golgins and the proteins with which they interact link Golgi structure and membrane trafficking.

Golgin-160 is a peripheral membrane protein localized to the cytoplasmic face of the Golgi complex. Golgin-160 possesses an N-terminal non-coiled-coil (head) domain, which contains Golgi targeting information (17), and a C-terminal coiled-coil domain, comprising two-thirds of the protein. Previous work showed that caspase cleavage of the head of golgin-160 is required for the efficient disassembly of the Golgi during programmed cell death and the propagation of specific apoptotic signals (18, 19). Interestingly, caspase cleavage of the N-terminal head of golgin-160 may allow for nuclear translocation of golgin-160 fragments from the Golgi to the nucleus during apoptosis (17). If caspase-derived fragments of golgin-160 are translocated to the nucleus, they may function to regulate apoptotic progression.

In this study we used the N-terminal head domain of golgin-160 as bait in a yeast two-hybrid screen to identify protein interactors. Here we identify and characterize the binding of golgin-160 with PDZ domain protein interacting specifically with TC10 (PIST). We also show that a novel isoform of golgin-160, golgin-160B, which is widely expressed in human tissues, is unable to bind PIST. Our results suggest that different golgin-160 isoforms may play non-overlapping roles in the regulation of certain membrane trafficking pathways.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Yeast Two-hybrid Assay—Yeast two-hybrid screening was performed using the Matchmaker Gal4 Two-Hybrid System 3 and a Matchmaker pretransformed HeLa cDNA library following the manufacturer's instructions (Clontech, Palo Alto, CA). The bait plasmid, human golgin-160 N terminus (amino acid residues 1–393), was amplified by PCR from a previously described full-length clone of human golgin-160 (18). The PCR fragment was cloned into the bait vector pGBKT7 (Clontech) using SalI and NdeI restriction sites and transformed into yeast strain AH109 (Clontech). The yeast strain Y187 (pretransformed with a cDNA library from HeLa cells cloned into the vector pGAD-GH) was mated with the AH109 strain that contained the bait construct according to the manufacturer's protocol. About 1 x 10⁷ HeLa clones were screened on both high stringency (lacking adenine, leucine, tryptophan, and histidine) and medium stringency (lacking leucine, tryptophan, and histidine) plates. Surviving clones that tested positive for -galactosidase expression were isolated and sequenced. A cDNA encoding residues 74–454 of human PIST (BC009553 [GenBank] ) was identified.

Expression Constructs—Myc-tagged golgin-160 and truncation mutants have been described (17). A full-length cDNA clone of GFP¹-tagged human PIST was kindly provided by William B. Guggino (Johns Hopkins University). Mutant proteins were named with both the tag type and the amino acids represented. The sequences of mutant proteins were confirmed by dideoxy sequencing. PIST truncation mutants were cloned into the BglII and EcoRI restriction sites of a modified pEGFP-C1 vector (T7-EGFP-C1) in which we inserted the T7 promoter sequence, TAATACGACTCACTATAGGG, upstream of the GFP start codon as previously described (17). Individual PIST truncation mutants were generated by PCR amplification to introduce a 5' BamHI site and a 3' EcoRI site followed by ligation into the T7-EGFP-C1 vector. To create the leucine repeat mutant in golgin-160 (g160-(1–393)3LA/Myc), the sequence LQSLRLSLPMQETQLCSTDSPL beginning at amino acid 121 was changed to AQSLRLSAPMQETQACSTDSPL using the PCR-based QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). The exon 3 isoform mutants of golgin-160 (g160B-(1–1459)/Myc and g160B-(1–353)/Myc) were generated by PCR mutagenesis using a primer overlapping the alternative splice junction. Glutathione S-transferase (GST) fusion proteins containing the non-coiled-coil head domain of golgin-160, GST/g160-(1–393), and the full-length PIST fusion protein, GST/PIST-(1–454), were cloned into pGEX-2T (Amersham Biosciences).

Cells and Antibodies—HeLa cells were maintained in Dulbecco's modified Eagle's medium (Invitrogen) containing 10% fetal calf serum and 0.1 mg/ml normocin-O (InvivoGen, San Diego, CA) at 37 °C in 5% CO₂. Thirty-five-mm dishes of HeLa cells (70–80% confluent) were transfected with 6 µl LT-1 (Mirus, Madison, WI) and 2 µg of T7-EGFP and/or pcDNA3.1/Myc-His(+), (Invitrogen) encoding the appropriate cDNA. Steady state expression was analyzed 16 h after transfection.

Rabbit anti-golgin-160 has been described (17). Polyclonal goat antibodies to PIST were from Abcam Inc. (Cambridge, MA). Mouse anti-p115 was from BD Transduction Laboratories. Rabbit anti--mannosidase II was a gift from Kelly Moremen (University of Georgia) and Marilyn Farquhar (University of California, San Diego). Rabbit anti-GFP was from Molecular Probes (Eugene, Oregon), and mouse anti-c-Myc was from Sigma. Texas Red-conjugated goat anti-rabbit and antimouse IgG and fluorescein-conjugated goat anti-rabbit and anti-mouse IgG were from Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA). Horseradish peroxidase-conjugated secondary antibodies were from Amersham Biosciences.

Indirect Immunofluorescence Microscopy—For localization studies, HeLa cells were stained as previously described (17). Briefly, cells were fixed in 3% paraformaldehyde for 10 min and permeabilized with 0.5% Triton X-100 in 10 mM glycine in phosphate-buffered saline for 3 min. Coverslips were incubated in primary antibody diluted in Gly/phosphate-buffered saline plus 1% bovine serum albumin (or 1% fish skin gelatin for goat anti-PIST) for 20 min. Coverslips were washed 3 times with Gly/phosphate-buffered saline, incubated with fluorescein- or Texas Red-labeled secondary antibodies, and washed as above. Coverslips were then mounted in glycerol containing 0.1 M N-propyl gallate. Images were collected on an Axioskop microscope (Zeiss, Thornwood, NY) equipped with epifluorescence and a Sensys CCD camera (Photometrics, Tucson, AZ) using IP Lab software (Signal Analytics, Vienna, VA).

Co-immunoprecipitation and Immunoblotting—The method used for immunoprecipitation has been described previously (17). Briefly, cells were lysed in 25 mM Hepes (pH 7.1), 125 mM potassium acetate, 1.0% Nonidet P-40, 1 mM dithiothreitol with a protease inhibitor mixture (Sigma). Cell lysates were cleared of debris by centrifugation at 5,000 x g for 10 min, and lysates were immunoprecipitated with 2 µl of anti-GFP or anti-Myc antiserum. Immune complexes were collected with either 25 µl of fixed Staphylococcus aureus (Calbiochem-Novabiochem) or 20 µl of protein G-Sepharose (Amersham Biosciences) and washed. The immunoprecipitates were analyzed by SDS-PAGE and visualized by immunoblot analysis as described below.

For immunoblotting analysis, proteins were separated by SDS-PAGE and transferred to Immobilon-P transfer membranes (Millipore, Billerica, MA). Membranes were blocked in 3% bovine serum albumin, 0.1% Tween 20, 150 mM NaCl, and 10 mM Tris (pH 7.4) for 1 h and then incubated with the indicated primary antibody blocking buffer overnight at 4 °C. The blots were washed and incubated for 1 h at room temperature with the appropriate horseradish peroxidase-conjugated secondary antibody (Amersham Biosciences) in blocking buffer. The membranes were washed and analyzed using enzyme-linked chemiluminescence with the ECL kit (Amersham Biosciences). Chemiluminescent signal was measured by the VersaDoc Imaging System (Bio-Rad) and quantitated using Quantity One software (Bio-Rad).

GST Pull-down Assays—For GST pull-down assays, the head domain of golgin-160 and full-length PIST were expressed as GST fusion proteins in Escherichia coli BL21-codon plus (Stratagene) using standard methods. Bacterially expressed GST or GST fusion proteins were purified and rebound to glutathione-Sepharose 4B beads according to the manufacturer's instructions (Amersham Biosciences). [³⁵S]Methionine-labeled golgin-160, PIST, and truncation mutants were generated by coupled in vitro transcription/translation using the TNT® T7 coupled reticulocyte lysate system (Promega, Madison, WI) as instructed by the manufacturer. The ³⁵S-labeled proteins were incubated with GST or GST fusion protein-coupled beads in binding buffer (25 mM Hepes (pH 7.1), 125 mM potassium acetate, 1 mM dithiothreitol) overnight at 4 °C. Beads were washed 3 times with binding buffer containing 0.1% Nonidet P-40. Proteins were eluted, electrophoresed, and visualized on a Molecular Imager FX PhosphorImager (Bio-Rad) and quantitated using Quantity One software (Bio-Rad).

RT-PCR and Quantitative Real-time PCR—Total RNA from human tissues was obtained from Clontech. Total RNA from HeLa cells was isolated using TRIzol® total RNA isolation reagent (Invitrogen) following the manufacturer's instructions. Total HeLa RNA was quantified by absorbance at 260 nm in a spectrophotometer, and purity was assessed by the 260/280 absorbance ratio. cDNA was synthesized using 1 µg of RNA reverse-transcribed with 200 units of murine leukemia virus reverse transcriptase (Invitrogen) in a 20-µl reaction containing 25 ng of oligo(dT)_12–18 primer, 500 µM concentrations of each dNTP, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl₂, and 10 mM dithiothreitol.

To identify golgin-160 transcripts in HeLa cells, a region within the N-terminal head domain was amplified by PCR. The primers used to visualize golgin-160 isoform expression in HeLa cells were as follows: golgin-160 (GenBank^TM accession number NM_005895 [GenBank] ) forward, 5'-TGGTGCCACCTGACCAGCAGGACAAA-3' (sense, 101–126 nucleotides), and reverse, 5'-CTTACCAAGGGCCAGTACCCTG-3' (antisense, 612–591 nucleotides). PCR reactions were carried out with Taq polymerase buffer (Invitrogen) with 2.5 mM MgCl₂, 0.4 mM concentrations of each dNTP, and 10 pmol of each primer. Amplification (denaturation 94 °C, 30 s; annealing 55 °C, 30 s; extension 72 °C, 60 s) was performed in a DNA thermal cycler (PerkinElmer Life Sciences, model 2400). PCR products were run on a 1.5% agarose gel, excised, and purified. PCR products were sequenced as described.

Quantitative real-time PCR was used to quantitate mRNA encoding golgin-160 isoforms. The isoform-specific primers used were as follows: golgin-160A (GenBank^TM NM_005895 [GenBank] ) forward, 5'-GCAGTCTCTCAGACTCAGTCTTCC-3' (sense, 363–386 nucleotides), and golgin-160B forward, 5'-TGATGCCTCTCCAGGCTCTACA-3' (sense, 271–294 nucleotides), and the reverse primer, 5'-CTTACCAAGGGCCAGTACCCTG-3' (g160A: 612–591 nucleotides) was used for both isoform A and B of golgin-160. mRNA expression levels of each golgin-160 isoform was quantified by real-time PCR using iQ SYBR Green Supermix (Bio-Rad) and a MyCycler Thermal Cycler (Bio-Rad) according to the manufacturer's instructions. Myi software (Bio-Rad) was used to auto-calculate threshold cycles. mRNA levels were normalized to the threshold cycles of 1 ng of the corresponding isoform plasmid cDNA. Expression levels were expressed as the mRNA level relative to golgin-160 isoform A in HeLa cells, which was given a relative mRNA quantity of 1.0. PCR amplification was performed two independent times.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
PIST Interacts with Golgin-160 in Vivo—We previously identified an 85-amino acid stretch in the N-terminal head domain of golgin-160 containing Golgi targeting information (17). Although the head domain of golgin-160 shows no significant homology to other proteins, it contains several interesting motifs, including a cryptic nuclear localization signal (residues, 232–239) and three caspase cleavage sites (Asp-59, Asp-139, and Asp-311) (Fig. 1A). To identify candidate proteins that interact with golgin-160, a yeast two-hybrid screen was performed using the N-terminal non-coiled coil head domain of golgin-160 as bait. We screened 1 x 10⁷ clones of a pretransformed HeLa cell cDNA library and isolated a clone encoding the PDZ domain protein interacting specifically with TC10 (PIST) (Fig. 1B). The interaction between golgin-160 and PIST was further confirmed by -galactosidase activity after co-transformation of the individual cDNAs into yeast (data not shown). PIST was first identified due to its interaction with TC10, a Rho GTPase (20). PIST, also known as GOPC (Golgi-associated PDZ and coiled-coil motif containing) (21), CAL (cystic fibrosis transmembrane conductance receptor-associated ligand) (22), and FIG (fused in glioblastoma) (23), contains two N-terminal coiled-coil domains and a PDZ domain within its C-terminal half (Fig. 1C). PIST is suggested to have a role in the trafficking of a subset of plasma membrane proteins through interactions with its PDZ domain (22–25).

View larger version (64K): [in this window] [in a new window]   FIG. 1. Identification of PIST as a golgin-160 interactor by yeast two-hybrid assay. A, the N-terminal head domain (residues 1–393) of golgin-160 was fused to GAL4 binding domain and used to screen a HeLa library for interactors. The head domain has been enlarged to highlight interesting motifs contained within this region. The gray bars represent the location of Golgi targeting and putative nuclear retention information, and the gray box represents the nuclear localization signal (NLS). Caspase-cleavage sites are marked with arrowheads. aa, amino acids. B, alignment of the partial protein sequence of positive interacting clone 25 with the full-length human (AAH09553 [GenBank] and mouse (NP_444417 [GenBank] ) PIST protein sequences. C, a diagram of full-length PIST containing the two N-terminal coiled-coil domains (CC1 and CC2) and the C-terminal PDZ domain (PDZ).

View larger version (54K): [in this window] [in a new window]   FIG. 2. Golgin-160 and PIST co-localize to the Golgi complex and can be co-immunoprecipitated. A, HeLa cells were fixed, permeabilized, and double-labeled with rabbit anti-golgin-160 and goat anti-PIST antibody. Secondary antibodies were fluorescein-conjugated donkey anti-rabbit IgG and Texas Red-conjugated donkey anti-goat IgG. Bar, 10 µm. B, HeLa cells were co-transfected with GFP-tagged PIST and Myc-tagged golgin-160. Cell lysates were immunoprecipitated (IP) with anti-GFP. 10% of the total lysate, immunoprecipitates, and 10% of the unbound fraction were analyzed by SDS-PAGE and immunoblotted with anti-GFP, anti-Myc, and anti-p115.

View larger version (32K): [in this window] [in a new window]   FIG. 3. A region including the second coiled-coil domain of PIST interacts with golgin-160. A, schematic representation of full-length and truncated PIST proteins (the N-terminal GFP tag is not depicted). B, in vitro interaction of PIST with a GST fusion protein containing the N-terminal head of golgin-160. GFP-tagged full-length and truncated mutants of PIST were [35S]methionine-labeled by in vitro transcription/translation and incubated with bacterially expressed GST-g160-(1–393) bound to glutathione-Sepharose. Bound PIST proteins were visualized by phosphorimaging.

A Leucine Repeat within the Head Domain of Golgin-160 Is Necessary for Interaction with PIST—To narrow down the sequence within the head of golgin-160 responsible for binding to PIST, we performed similar in vitro binding experiments using GST-tagged full-length PIST (GST/PIST-(1–454) instead of GST/golgin-160. [³⁵S]Methionine-labeled Myc-tagged golgin-160 proteins (Fig. 4A) were produced by coupled in vitro transcription and translation and then incubated with GST alone or GST/PIST-(1–454). As expected, the full-length and N-terminal head domain of golgin-160 were able to bind to PIST, whereas the C-terminal coiled-coil domain was unable to bind (Fig. 4A). To further map the interaction domain within the head of golgin-160, progressively smaller truncations of the head, as illustrated in Fig. 4B, were tested for their ability to bind PIST. g160-(60–311)/Myc was able to interact with PIST as efficiently as the full head domain (Fig. 4B). Interestingly, neither g160-(1–139)/Myc nor g160-(140–311)/Myc bound to PIST, suggesting that the sequences flanking residue 139 may mediate golgin-160 binding to PIST.

View larger version (17K): [in this window] [in a new window]   FIG. 4. A 79-amino acid region in the N-terminal head domain of golgin-160 directly interacts with PIST. A, schematic representation of full-length and truncated golgin-160 proteins (the C-terminal Myc tag is not depicted) and their in vitro interaction with a GST fusion protein of full-length PIST, GST/PIST-(1–454). NLS, nuclear localization signal. aa, amino acids. B, schematic representation of truncations of the head of golgin-160 (the C-terminal Myc tag is not depicted) and their in vitro interaction with PIST. Full-length and truncated mutants of golgin-160 were [35S]methionine-labeled by in vitro transcription/translation and incubated with bacterially expressed GST-PIST-(1–454) bound to glutathione-Sepharose. Bound golgin-160 proteins were visualized by phosphorimaging.

Identification and Quantitation of a Splice Isoform of Human Golgin-160 Lacking Exon 3—Interestingly, the reference sequence for the murine golgin-160 protein (Mea-2; NP_032172 [GenBank] ) encodes a 1447-amino acid protein that lacks the exon encoding the leucine repeat (designated exon 3 in humans). Mea-2 apparently represents an alternative splice variant of golgin-160 in which exon 3 is absent. However, a mouse cDNA clone (BAA86889 [GenBank] containing exon 3 is present in the National Center of Biotechnology Information nucleotide data base. This suggests that mice express at least two isoforms of golgin-160 that differ by the presence or absence of exon 3. A data base search of human expressed sequence tags (ESTs) indicates that humans also express an isoform of golgin-160 lacking exon 3, similar to Mea-2 (Fig. 6A). At least five human ESTs of significant E value containing this alternative splice isoform exist. To confirm that human cells express an isoform of golgin-160 missing exon 3, RT-PCR was carried out on HeLa cells and human tissues. cDNA was reverse-transcribed from total RNA using an oligo(dT) primer followed by PCR amplification. Primers used in the PCR reaction were complementary to sequences in exon 2 (sense) and exon 4 (antisense). HeLa cells and all the tissues analyzed showed two PCR products (Fig. 6B). The difference in PCR product size corresponds to the size of exon 3. The bands were extracted and sequenced, confirming that the observed RT-PCR products represent amplification of golgin-160A (full-length, upper band) and golgin-160B (missing exon 3, lower band). Although golgin-160 runs as a doublet on SDS-PAGE gels, this is a result of phosphorylation (28). We were unable to distinguish between the golgin-160 isoforms after phosphatase treatment by SDS-PAGE using our existing antibodies (data not shown).

View larger version (42K): [in this window] [in a new window]   FIG. 5. A leucine repeat within the head domain of golgin-160 is necessary for interaction with PIST. A, schematic representation of the wild-type (WT) and leucine to alanine (3LA) mutations in the head domain of golgin-160. NLS, nuclear localization signal. aa, amino acids. B, in vitro interaction of golgin-160 with a GST fusion protein containing full-length PIST. g160-(1–393)/Myc and g160-(1–393)3LA/Myc were [35S]methionine-labeled by in vitro transcription/translation and incubated with bacterially expressed GST-PIST-(1–454) bound to glutathione-Sepharose. Bound golgin-160 proteins were visualized by phosphorimaging.

The Golgin-160B Isoform Localizes to the Golgi but Is Unable to Bind PIST—Previous work has demonstrated that the minimal Golgi targeting information in golgin-160A does not overlap with exon 3 (17). Therefore, both isoforms share the region shown to contain Golgi targeting information. To confirm that the Golgi targeting information is functional and golgin-160B is localized to the Golgi, we expressed an Myc-tagged version of golgin-160 lacking exon 3, g160B-(1–1458)/Myc, in HeLa cells (Fig. 7A). Co-localization of g160B-(1–1458)/Myc and mannosidase II, a Golgi resident enzyme, by indirect immunofluorescence microscopy verified that golgin-160B is specifically targeted to the Golgi complex.

View larger version (30K): [in this window] [in a new window]   FIG. 6. Identification and quantification of a splice isoform of golgin-160 lacking exon 3. A, schematic representation of the head of golgin-160B, a splice isoform lacking exon 3. The amino acid (aa) sequence in the region where the alternative splicing event occurs is shown (deleted exon 3 is shown above). B, mRNA expression of golgin-160 isoforms. Total RNA from HeLa cells and indicated human tissues was reverse-transcribed. Primers were used to PCR-amplify a region that would include exon 3. PCR products were analyzed by electrophoresis in an agarose gel. Amplicons representing isoform A and isoform B were present in HeLa cells and all tissues examined. C, mRNA expression levels of golgin-160 isoforms. Quantitative real-time PCR was performed with primers specific for either golgin-160A or golgin-160B as described under "Experimental Procedures." Results were normalized to the amplification of 1 ng of plasmid cDNA encoding the corresponding isoform. All values are presented as the mRNA level relative to that of golgin-160 isoform A in HeLa cells, which was given a relative mRNA level of 1.0. Error bars represent the S.D. from two independent experiments.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Golgin-160 is a peripheral membrane protein that belongs to the golgin family of Golgi-localized proteins. A number of recent studies have implicated golgins in the maintenance of Golgi structure and the integrity of membrane-trafficking pathways. We previously showed that the N-terminal non-coiled-coil domain head domain of golgin-160 possesses Golgi targeting information (17). The head domain of golgin-160 is also cleaved by caspases during apoptosis, and this cleavage is required for apoptotic progression induced by specific stimuli and efficient disassembly of the Golgi complex (18, 19). Taken together, these results suggest that the N-terminal head domain of golgin-160 mediates protein-protein interactions important for golgin-160 function.

To gain further insight into the role of golgin-160 in Golgi structure and function, we sought to identify proteins that interact with golgin-160. We performed a yeast two-hybrid screen using the N-terminal non-coiled-coil domain of golgin-160 as bait. We found that the PDZ domain-containing protein, PIST, interacts with the head of golgin-160. In addition to a PDZ domain in the C-terminal half of the protein, PIST also contains two N-terminal coiled-coil domains. PIST colocalized with golgin-160 at the Golgi complex in HeLa cells (Fig. 2A), and co-immunoprecipitation confirmed that golgin-160 and PIST can interact in vivo (Fig. 2B).

We performed in vitro binding assays and identified a 127-amino acid region within PIST that directly interacts with golgin-160 (Fig. 3B). The C termini of several plasma membrane proteins, including the 1-adrenergic receptor (29), cystic fibrosis transmembrane conductance receptor (30), the chloride channel, ClC-3B (31), glutamate receptor 2 (32), and Frizzled-5 and -8 (21), interact with the PDZ domain of PIST. By contrast, the second coiled-coil domain and the linker sequence preceding the PDZ domain of PIST is necessary and sufficient to bind to golgin-160. This same region of PIST has been reported to mediate interactions with TC10, a Rho GTPase, (20) and syntaxin-6, a Q-SNARE (23). Recently, exogenous expression of TC10 has been proposed to regulate cystic fibrosis transmembrane conductance receptor trafficking and expression through its interaction with PIST (34). Therefore, binding of golgin-160, TC10, and syntaxin-6 to PIST may coordinate membrane trafficking of some plasma membrane proteins in cell types where these proteins are expressed. Because TC10 is not widely expressed (35), it will be important to analyze its effect on PIST function in cells that normally express TC10.

Using in vitro binding experiments, we identified a leucine repeat motif within the head of golgin-160 necessary for the direct interaction of golgin-160 with PIST (Fig. 5). Although this repeat is characteristic of leucine zipper motifs, the leucine repeat in golgin-160 does not possess the predicted coiled-coil structure required for leucine zipper-regulated dimerization. Furthermore, we previously showed that the head of golgin-160 does not homodimerize (17). Therefore, it is unlikely that the leucine repeat found within the head of golgin-160 is a classical leucine zipper. Although unable to mediate homodimerization, these leucines are required for golgin-160-PIST interaction. Within the segment of PIST that binds golgin-160, there is also a leucine zipper motif located in the second coiled-coil domain. Even though we were unable to detect an interaction between the second coiled-coil domain of PIST and golgin-160, we propose that a heterodimeric interaction between the leucine repeat of golgin-160 and the leucine zipper of PIST is likely necessary but not sufficient for golgin-160-PIST interaction.

View larger version (80K): [in this window] [in a new window]   FIG. 7. Golgin-160B localizes to the Golgi but is unable to bind PIST. A, HeLa cells were transfected with Myc-tagged golgin-160A or Myc-tagged golgin-160B. Cells were fixed, permeabilized, and stained with mouse anti-Myc and rabbit anti-mannosidase II (ManII) antibodies. Secondary antibodies were Texas Red-conjugated goat anti-mouse IgG and fluorescein-conjugated donkey anti-rabbit IgG. Bar, 10 µm. B, the ability of the golgin-160B isoform to bind PIST was tested. In vitro interaction of golgin-160A and golgin-160B isoforms with a GST fusion protein containing full-length PIST is shown. g160A-(1–393)/Myc and g160B-(1–353)/Myc were [35S]methionine-labeled by in vitro transcription/translation and incubated with bacterially expressed GST/PIST-(1–454) bound to glutathione-Sepharose. Bound proteins were visualized by phosphorimaging.

Interestingly, the annotated mouse homolog of golgin-160, Mea-2, lacks exon 3. Quantitative real-time RT-PCR confirmed that an alternative transcript of human golgin-160 lacking exon 3 is widely expressed in human tissues (Fig. 6) and localizes to the Golgi complex (Fig. 7A). Surprisingly, golgin-160B mRNA levels ranged from 50 to 100% of the level of golgin-160A mRNA. With our current antibodies we are unable to resolve golgin-160 isoforms by SDS-PAGE. An antibody specific for exon 3 will allow us to specifically analyze golgin-160A.

The alternative splicing that occurs in golgin-160B may prevent caspase-3 cleavage at Asp-99 (corresponding to Asp-139 in golgin-160A). Aside from the requirement for Asp at position 1 (P1), the amino acid present three residues upstream of the Asp (P4) is the most critical determinant of specificity (36). Due to the alternative splicing in golgin-160B, the cysteine at P4 of golgin-160A is replaced by a glycine at P4 in golgin-160B. Use of a combinatorial peptide library demonstrated that a glycine at P4 severely inhibits caspase-3 cleavage (36). In addition, Mea-2, the mouse homolog of human golgin-160B, encodes an Ala in place of the required Asp (residue 99). Therefore, it is likely that caspase-3 is unable to cleave human golgin-160B at Asp-99 or the mouse homolog, Mea-2. Studies are currently under way to characterize the caspase cleavage of golgin-160B and its consequences.

Because golgin-160B lacks three of the leucines necessary for interaction with PIST, we predicted that golgin-160B would be unable to interact with PIST. In vitro binding experiments confirmed that golgin-160B was unable to bind PIST (Fig. 7B). Therefore, it is possible that golgin-160B functions independently of PIST or that heterodimers of golgin-160A and golgin-160B may organize different binding partners into complexes.

Our findings raise the possibility that golgin-160 may play a role in the transport of proteins bound to the PDZ domain of PIST. It also suggests that caspase cleavage of golgin-160 may disrupt this transport step and aid in Golgi disassembly and/or apoptotic progression. Furthermore, the ratio of golgin-160 isoforms in a given cell may allow for the regulation of PIST-dependent trafficking of cargo. Studies to address the role of golgin-160 in the trafficking of plasma membrane proteins that bind PIST are currently under way.

	FOOTNOTES

 
^* This work was supported by National Institutes of Health Grant GM42522 (to C. E. M.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Dept. of Cell Biology, Johns Hopkins University School of Medicine, 725 Wolfe St., Baltimore, MD 21205. Tel.: 410-955-1809; Fax: 410-955-4129; E-mail: machamer{at}jhmi.edu.

¹ The abbreviations used are: GFP, green fluorescent protein; GST, glutathione S-transferase; RT, reverse transcription.

	ACKNOWLEDGMENTS

 
We thank Bill Guggino for the full-length cDNA clone encoding PIST and the Puigsever laboratory for help with real-time PCR. We also thank the members of the Machamer lab for discussions and comments on the manuscript.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Farquhar, M. G., and Palade, G. E. (1998) Trends Cell Biol. 8, 2–10[CrossRef][Medline] [Order article via Infotrieve]
2. Nakamura, N., Rabouille, C., Watson, R., Nilsson, T., Hui, N., Slusarewicz, P., Kreis, T. E., and Warren, G. (1995) J. Cell Biol. 131, 1715–1726[Abstract/Free Full Text]
3. Short, B., Preisinger, C., Korner, R., Kopajtich, R., Byron, O., and Barr, F. A. (2001) J. Cell Biol. 155, 877–883[Abstract/Free Full Text]
4. Griffith, K. J., Chan, E. K., Lung, C. C., Hamel, J. C., Guo, X., Miyachi, K., and Fritzler, M. J. (1997) Arthritis Rheum. 40, 1693–1702[Medline] [Order article via Infotrieve]
5. Misumi, Y., Sohda, M., Yano, A., Fujiwara, T., and Ikehara, Y. (1997) J. Biol. Chem. 272, 23851–23858[Abstract/Free Full Text]
6. Fritzler, M. J., Hamel, J. C., Ochs, R. L., and Chan, E. K. (1993) J. Exp. Med. 178, 49–62[Abstract/Free Full Text]
7. Erlich, R., Gleeson, P. A., Campbell, P., Dietzsch, E., and Toh, B. H. (1996) J. Biol. Chem. 271, 8328–8337[Abstract/Free Full Text]
8. Fritzler, M. J., Lung, C. C., Hamel, J. C., Griffith, K. J., and Chan, E. K. (1995) J. Biol. Chem. 270, 31262–31268[Abstract/Free Full Text]
9. Jakymiw, A., Raharjo, E., Rattner, J. B., Eystathioy, T., Chan, E. K., and Fujita, D. J. (2000) J. Biol. Chem. 275, 4137–4144[Abstract/Free Full Text]
10. Bascom, R. A., Srinivasan, S., and Nussbaum, R. L. (1999) J. Biol. Chem. 274, 2953–2962[Abstract/Free Full Text]
11. Linstedt, A. D., and Hauri, H. P. (1993) Mol. Biol. Cell 4, 679–693[Abstract]
12. Barr, F. A., Puype, M., Vandekerckhove, J., and Warren, G. (1997) Cell 91, 253–262[CrossRef][Medline] [Order article via Infotrieve]
13. Moyer, B. D., Allan, B. B., and Balch, W. E. (2001) Traffic 2, 268–276[CrossRef][Medline] [Order article via Infotrieve]
14. Shorter, J., Beard, M. B., Seemann, J., Dirac-Svejstrup, A. B., and Warren, G. (2002) J. Cell Biol. 157, 45–62[Abstract/Free Full Text]
15. Diao, A., Rahman, D., Pappin, D. J., Lucocq, J., and Lowe, M. (2003) J. Cell Biol. 160, 201–212[Abstract/Free Full Text]
16. Lu, L., Tai, G., and Hong, W. (2004) Mol. Biol. Cell 15, 4426–4443[Abstract/Free Full Text]
17. Hicks, S. W., and Machamer, C. E. (2002) J. Biol. Chem. 277, 35833–35839[Abstract/Free Full Text]
18. Mancini, M., Machamer, C. E., Roy, S., Nicholson, D. W., Thornberry, N. A., Casciola-Rosen, L. A., and Rosen, A. (2000) J. Cell Biol. 149, 603–612[Abstract/Free Full Text]
19. Maag, R. S., Mancini, M., Rosen, A., and Machamer, C. E. (2005) Mol. Biol. Cell 16, 3019–3027[Abstract/Free Full Text]
20. Neudauer, C. L., Joberty, G., and Macara, I. G. (2001) Biochem. Biophys. Res. Commun. 280, 541–547[CrossRef][Medline] [Order article via Infotrieve]
21. Yao, R., Maeda, T., Takada, S., and Noda, T. (2001) Biochem. Biophys. Res. Commun. 286, 771–778[CrossRef][Medline] [Order article via Infotrieve]
22. Cheng, J., Moyer, B. D., Milewski, M., Loffing, J., Ikeda, M., Mickle, J. E., Cutting, G. R., Li, M., Stanton, B. A., and Guggino, W. B. (2002) J. Biol. Chem. 277, 3520–3529[Abstract/Free Full Text]
23. Charest, A., Lane, K., McMahon, K., and Housman, D. E. (2001) J. Biol. Chem. 276, 29456–29465[Abstract/Free Full Text]
24. Ives, J. H., Fung, S., Tiwari, P., Payne, H. L., and Thompson, C. L. (2004) J. Biol. Chem. 279, 31002–31009[Abstract/Free Full Text]
25. Hruska-Hageman, A. M., Benson, C. J., Leonard, A. S., Price, M. P., and Welsh, M. J. (2004) J. Biol. Chem. 279, 46962–46968[Abstract/Free Full Text]
26. Moitra, J., Szilak, L., Krylov, D., and Vinson, C. (1997) Biochemistry 36, 12567–12573[CrossRef][Medline] [Order article via Infotrieve]
27. Simmerman, H. K., Kobayashi, Y. M., Autry, J. M., and Jones, L. R. (1996) J. Biol. Chem. 271, 5941–5946[Abstract/Free Full Text]
28. Cha, H., Smith, B. L., Gallo, K., Machamer, C. E., and Shapiro, P. (2004) J. Cell Sci. 117, 751–760[Abstract/Free Full Text]
29. He, J., Bellini, M., Xu, J., Castleberry, A. M., and Hall, R. A. (2004) J. Biol. Chem. 279, 50190–50196[Abstract/Free Full Text]
30. Cheng, J., Wang, H., and Guggino, W. B. (2004) J. Biol. Chem. 279, 1892–1898[Abstract/Free Full Text]
31. Gentzsch, M., Cui, L., Mengos, A., Chang, X. B., Chen, J. H., and Riordan, J. R. (2003) J. Biol. Chem. 278, 6440–6449[Abstract/Free Full Text]
32. Selimi, F., Lohof, A. M., Heitz, S., Lalouette, A., Jarvis, C. I., Bailly, Y., and Mariani, J. (2003) Neuron 37, 813–819[CrossRef][Medline] [Order article via Infotrieve]
33. Deleted in proof
34. Cheng, J., Wang, H., and Guggino, W. B. (2005) J. Biol. Chem. 280, 3731–3739[Abstract/Free Full Text]
35. Neudauer, C. L., Joberty, G., Tatsis, N., and Macara, I. G. (1998) Curr. Biol. 8, 1151–1160[CrossRef][Medline] [Order article via Infotrieve]
36. Thornberry, N. A., Rano, T. A., Peterson, E. P., Rasper, D. M., Timkey, T., Garcia-Calvo, M., Houtzager, V. M., Nordstrom, P. A., Roy, S., Vaillancourt, J. P., Chapman, K. T., and Nicholson, D. W. (1997) J. Biol. Chem. 272, 17907–17911[Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				S. Yadav, S. Puri, and A. D. Linstedt A Primary Role for Golgi Positioning in Directed Secretion, Cell Polarity, and Wound Healing Mol. Biol. Cell, March 15, 2009; 20(6): 1728 - 1736. [Abstract] [Full Text] [PDF]

				J. I. Sbodio and C. E. Machamer Identification of a Redox-sensitive Cysteine in GCP60 That Regulates Its Interaction with Golgin-160 J. Biol. Chem., October 12, 2007; 282(41): 29874 - 29881. [Abstract] [Full Text] [PDF]

				F. Suzuki-Toyota, C. Ito, Y. Toyama, M. Maekawa, R. Yao, T. Noda, H. Iida, and K. Toshimori Factors Maintaining Normal Sperm Tail Structure During Epididymal Maturation Studied in Gopc / Mice Biol Reprod, July 1, 2007; 77(1): 71 - 82. [Abstract] [Full Text] [PDF]

				D. Williams, S. W. Hicks, C. E. Machamer, and J. E. Pessin Golgin-160 Is Required for the Golgi Membrane Sorting of the Insulin-responsive Glucose Transporter GLUT4 in Adipocytes Mol. Biol. Cell, December 1, 2006; 17(12): 5346 - 5355. [Abstract] [Full Text] [PDF]

				J. I. Sbodio, S. W. Hicks, D. Simon, and C. E. Machamer GCP60 Preferentially Interacts with a Caspase-generated Golgin-160 Fragment J. Biol. Chem., September 22, 2006; 281(38): 27924 - 27931. [Abstract] [Full Text] [PDF]

				E. Dumin, I. Bendikov, V. N. Foltyn, Y. Misumi, Y. Ikehara, E. Kartvelishvily, and H. Wolosker Modulation of D-Serine Levels via Ubiquitin-dependent Proteasomal Degradation of Serine Racemase J. Biol. Chem., July 21, 2006; 281(29): 20291 - 20302. [Abstract] [Full Text] [PDF]

				D. Escalier Knockout mouse models of sperm flagellum anomalies Hum. Reprod. Update, July 1, 2006; 12(4): 449 - 461. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 280/32/28944    most recent M504937200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Hicks, S. W. Articles by Machamer, C. E. Search for Related Content PubMed PubMed Citation Articles by Hicks, S. W. Articles by Machamer, C. E. Social Bookmarking                      What's this?