JBC Anatrace, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M502236200 on June 20, 2005

J. Biol. Chem., Vol. 280, Issue 33, 29525-29532, August 19, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/33/29525    most recent
M502236200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ma, K.
Right arrow Articles by Park, E. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ma, K.
Right arrow Articles by Park, E. A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Cloning of the Rat Pyruvate Dehydrogenase Kinase 4 Gene Promoter

ACTIVATION OF PYRUVATE DEHYDROGENASE KINASE 4 BY THE PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR {gamma} COACTIVATOR*

Ke Ma{ddagger}§, Yi Zhang{ddagger}§*, Marshall B. Elam¶, George A. Cook{ddagger}, and Edwards A. Park{ddagger}||

From the {ddagger}Department of Pharmacology, College of Medicine, University of Tennessee Health Science Center, Memphis, Tennessee, 38163 and Department of Medicine, Veterans Affairs Medical Center, Memphis, Tennessee 38104

Received for publication, February 28, 2005 , and in revised form, June 1, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The pyruvate dehydrogenase complex catalyzes the conversion of pyruvate to acetyl-CoA in mitochondria and is a key regulatory enzyme in the metabolism of glucose to acetyl-CoA. Phosphorylation of pyruvate dehydrogenase by the pyruvate dehydrogenase kinases (PDK) inhibits pyruvate dehydrogenase complex activity. There are four PDK isoforms, and expression of PDK4 and PDK2 genes is elevated in starvation and diabetes, allowing glucose to be conserved while fatty acid oxidation is increased. In these studies we have investigated the transcriptional mechanisms by which the expression of the PDK4 gene is increased. The peroxisome proliferator-activated receptor {gamma} coactivator (PGC-1{alpha}) stimulates the expression of genes involved in hepatic gluconeogenesis and mitochondrial fatty acid oxidation. We have found that PGC-1{alpha} will induce the expression of both the PDK2 and PDK4 genes in primary rat hepatocytes and ventricular myocytes. We cloned the promoter for the rat PDK4 gene. Hepatic nuclear factor 4 (HNF4), which activates many genes in the liver, will induce PDK4 expression. Although HNF4 and PGC-1{alpha} interact to stimulate several genes encoding gluconeogenic enzymes, the induction of PDK4 does not involve interactions of PGC-1{alpha} with HNF4. Using the chromatin immunoprecipitation assay, we have demonstrated that HNF4 and PGC-1{alpha} are associated with the PDK4 gene in vivo. Our data suggest that by inducing PDK genes PGC-1{alpha} will direct pyruvate away from metabolism into acetyl-CoA and toward the formation of oxaloacetate and into the gluconeogenic pathway.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The pyruvate dehydrogenase complex (PDC)1 catalyzes the formation of acetyl-CoA from pyruvate. PDC is an important regulatory enzyme in the metabolism of glucose to acetyl-CoA (1). The activity of PDC is controlled in part through its phosphorylation and dephosphorylation by pyruvate dehydrogenase kinases (PDKs) and pyruvate dehydrogenase phosphatases, respectively (2, 3). There are three serine phosphorylation sites on the {alpha} subunit of pyruvate dehydrogenase (E1) that are targeted by PDKs. Phosphorylation will completely inhibit PDC activity (1, 2). The PDKs are subject to short term regulation including inhibition by the PDC substrates pyruvate and NAD+ as well as stimulation by the PDC products NADH and acetyl-CoA. The acetyl-CoA, which stimulates PDK4 activity, may be derived from fatty acid or glucose oxidation (2). In the liver PDC activity is high after a high carbohydrate diet, and the acetyl-CoA generated from PDC is utilized for the synthesis of long chain fatty acids (4).

There are four PDK isoforms, and two of these, PDK2 and PDK4, are highly expressed in the liver, heart, and kidney (4–8). These PDK isoforms are regulated in the long term by changes in gene expression. Expression of both PDK2 and PDK4 genes are induced in starvation and by streptozotocin-induced diabetes (2, 4). Several factors including long chain fatty acids, glucocorticoids, and peroxisome proliferator-activator receptor agonists will increase transcription of the PDK4 gene (5, 7). The expression of both PDK2 and PDK4 is inhibited by insulin, although the PDK2 gene is more sensitive than the PDK4 gene to insulin inhibition in Morris hepatoma 7800 C1 cells (7).

Peroxisome proliferator-activated receptor {gamma} coactivator (PGC-1{alpha}) was first cloned from brown adipose tissue as a transcriptional coactivator for peroxisomal proliferator-activated receptor {gamma} (9). PGC-1{alpha} is highly expressed in tissues with high metabolic rates including heart, muscle, and brown adipose tissue (10). Overexpression of PGC-1{alpha} in heart and muscle promotes mitochondrial biogenesis and elevated fatty acid oxidation (11). The heart genes encoding the fatty acid oxidation enzymes, such as medium chain acyl-CoA dehydrogenase and the "muscle" isoform of carnitine palmitoyltransferase-I (CPT-I{beta}), are stimulated by PGC-1{alpha} (12). In cardiac myocytes PGC-1{alpha} is increased at birth when there is a switch from glucose to fatty acid utilization, and PGC-1{alpha} is elevated in the heart of fasted animals (12).

In the liver transcription of PGC-1{alpha} is induced by dexamethasone, cAMP, and thyroid hormone (13, 14). PGC-1{alpha} can induce the "liver isoform" of the CPT-I (CPT-I{alpha}) gene (13). Although PGC-1{alpha} is expressed at low levels in the liver of fed animals, after an overnight fast PGC-1{alpha} abundance is elevated (13, 15). PGC-1{alpha} is increased in situations where hepatic mitochondrial fatty acid oxidation and CPT-I{alpha} activity are stimulated such as fasting, streptozotocin-induced diabetes, and hyperthyroidism (13, 14, 16). Overexpression of PGC-1{alpha} will induce the expression of the phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase genes, resulting in accelerated hepatic gluconeogenesis (17, 18). PGC-1{alpha} mediates many of its actions on the gluconeogenic pathway through interactions with nuclear receptors such as hepatic nuclear factor-4 (HNF4), the glucocorticoid receptor, the forkhead transcription factor (FKHR/FOXO1), and others (10, 13, 15, 17). The interactions with HNF4 and the glucocorticoid receptor are mediated in part through the AF2 domain in the nuclear receptor and the Leu-X-X-Leu-Leu (LXXLL) motif in PGC-1{alpha}.We hypothesized that PGC-1{alpha} might further regulate pyruvate metabolism by inducing the PDK genes. Here, we show that PGC-1{alpha} can induce PDK2 and PDK4 gene expression in primary rat hepatocytes and myocytes. We cloned the rat PDK4 promoter and examined the regulation of the PDK4 gene by PGC-1{alpha}.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cloning of the Rat PDK4 Promoter—Genomic DNA was prepared from rat tails using a Qiagen genomic DNA isolation kit (QIAamp DNA kit 51304). A forward primer containing the sequence 5'-atggattaccacttcccagcactg (–2989/–2965) and a reverse primer, 5'-cgggagcgcggtcgagcgagagcaag (+87/+62), were used in polymerase chain reactions to amplify 2989 nucleotides of the promoter and 87 nucleotides of the first exon from the rat PDK4 gene.

Identification of the Transcriptional Start Site by Rapid Amplification of cDNA Ends (RACE)—Transcription start site determinations were performed on DNase I-treated total RNA isolated from rat hepatocytes (19). RNA was isolated with RNA-Stat 60 reagent (Tel-Test) as we have described previously (19). The cDNA was prepared using the 5' RACE system for rapid amplification of cDNA ends (Invitrogen #18374-058). The following rat PDK4 gene-specific primers were designed with Primer3_www.cgiv 0.2 software. The gene-specific primer 1 (GSP1) (5'-cagggaggatgtcaat-3') was used for reverse transcription to create a first strand PDK4 cDNA. The GSP2, 5'-atgttggcaagtctgacgggca-3', and GSP3, 5'-gtctgacgggcaattcttg-3', were used in the nested PCR reactions to identify the 5' end of the mRNA. The PCR products were cloned into the pCR4-TOPO vector from the TOPO TA cloning vector system (Invitrogen K4575). The PCR products were sequenced at the University of Tennessee Molecular Resource Center.

Transient Transfection of Luciferase Vectors—PDK4-luciferase (PDK4-luc) constructs were transiently transfected into HepG2 cells by the calcium phosphate method (20). Transfections included 2 µg of PDK4-luciferase along with TK-Renilla and mammalian expression vectors for either HNF4 or PGC-1{alpha}. Cells were transfected in Dulbecco's modified Eagle's medium containing 5% calf serum, 5% fetal calf serum and incubated overnight at 37 °C. After two washes with phosphate-buffered saline, the medium was replaced by Dulbecco's modified Eagle's medium containing no serum. After 24 h, cells were lysed in passive lysis buffer (Promega). Both luciferase and Renilla activity were measured. Protein content in each lysate was determined by Bio-Rad protein assay. Luciferase activity was corrected for both protein content and Renilla activity to account for cell density and transfection efficiency, respectively.

The serial deletions of the rat PDK4 promoter were created by PCR amplification (20). The forward primer contained a SacI site, and the reverse primer contained a Hind III site. These restriction sites were used for cloning of the rPDK4 promoter fragments into the luciferase reporter pGL3-basic (Promega). Site-directed mutagenesis of the HNF4 binding sites was conducted using the QuikChange site-directed mutagenesis kit (Stratagene) (20). The sequences of the top primers were –1126/–1090, catcctccttacatgcgacagctactagcaccttggg, –218/–183, gcctccctctcactagttgctacttacaggccgtgg, and –140/–106, cggccaaagggaggctcctaacattcttgctctg. The altered nucleotides are underlined. All deletions and site-directed mutants were confirmed by DNA sequencing at the University of Tennessee Molecular Resource Center.

Adenoviral Infection of Primary Rat Hepatocytes and Neonatal Cardiac Ventricular Myocytes—Hepatocytes were obtained from livers of male Sprague-Dawley rats (Harlan) as we have reported previously (21). The cardiac myocytes were prepared from 2- and 3-day-old rats (22). The adenoviruses expressing green fluorescent protein (GFP) and PGC-1{alpha} were purified by cesium chloride purification (13, 23). Rat primary hepatocytes were plated in RPMI 1640 media containing 20 mM glucose in the absence of serum before infection. Ventricular myocytes were plated in Dulbecco's modified Eagle's medium containing 20 mM glucose. The hepatocytes and myocytes were infected at a multiplicity of infection of 50 (23). Sixteen hours after the infection the cells were changed to fresh medium. After infection for 48 h, RNA was isolated from the hepatocytes and myocytes.

Western Analysis—Rats were made diabetic by a single intraperitoneal injection of streptozotocin at 150 mg/kg of body weight (24). After 48 h it was confirmed that diabetes was induced by testing the urine for glucose and ketones using the Ames Multistix (Miles Inc.). Livers from control and diabetic rats as well as infected primary hepatocytes were harvested in PD buffer (40 mM Tris-Cl, pH 8.0, 500 mM NaCl, 0.5% Nonidet P-40, 6 mM EDTA, pH 8.0, 6 mM EGTA, pH 8.0, 1 mM dithiothreitol, and diluted protease inhibitor mixture Sigma P8340). The liver samples were sonicated 5 times at a setting of 5 in a 100-watt Microson sonicator (Misonix XL2000). Cell membranes were removed by centrifugation for 25 min at 4 °C. An equal amount of protein was loaded onto a 12% SDS-PAGE gel and transferred to a 0.45-µm pure nitrocellulose membrane (Bio-Rad). Blots were immunoblotted with primary antibodies (anti-PGC-1{alpha}, Santa Cruz sc-13067) in phosphate-buffered saline containing 5% nonfat dry milk powder and incubated with horseradish peroxidase-conjugated anti-rabbit secondary antibody (Bio-Rad, 170-6515). Immunoreactive proteins were identified using Super Signal West Femto Chemiluminescence Substrate (Pierce).

Real-time PCR—RNA was extracted from primary rat hepatocytes or cardiac myocytes using RNA-Stat-60 (Tel-Test) as described previously (14). The RNA was initially treated with DNase I (Ambion) at 37 °C for 1 h. The DNase I was stopped by the addition of DNase inactivation reagent to the sample. Equal amounts of DNA-free RNA were used for the first-strand cDNA synthesis. Up to 1 µg of RNA was mixed with 1 µl of 10 mM dNTP mix and 1 µl of random hexamers (50 ng/µl). Each sample was incubated at 70 °C for 10 min and then placed on ice for at least 1 min. Next, 2 µl of 10x reverse transcription buffer, 4.5 µl of 25 mM MgCl2, 2 µl of 0.1 M dithiothreitol, and 1 µl of RNaseOUT recombinant ribonuclease inhibitor was added to each tube. After incubation at 25 °C for 2 min, each tube was loaded with 1 µl of SuperScript II reverse transcriptase. The tubes were incubated at 25 °C for 10 min, 42 °C for 1 h, and 70 °C for 15 min. RNase H was added to each to each tube and incubated at 37 °C for 20 min. The parameters for real time PCR were as follows: 95 °C for 11 min followed by 40 cycles of 95 °C for 30 s and 60 °C for 1 min and, for the melt curve, 100 cycles of 10 s from 60 to 100 °C in 0.4 °C increments. The final concentration of primers in each well in the PCR plates was 0.1 µM. The oligonucleotide standards were diluted to 10–9, 10–8, 10–7, 10–6, and 10–5 µM and used as a template for the standard curve. The sequences of the PDK2 and PDK4 primers are provided in Table I. A 1:500 dilution of each cDNA as template was used to measure 18 S rRNA, and 1 µl of 1:10 or 1:20 dilution of each cDNA was used as a template to assess target genes. The 18 S rRNA normalized all PDK mRNA determinations.


View this table:
[in this window]
[in a new window]
  		TABLE I
The forward primers (FP) and reverse primers (RP) were used for real-time PCR to quantitate mRNA abundance

The rat genes are indicated on the left, and the DNA sequences are shown 5' to 3'. The conditions for the real-time PCR are outlined under "Materials and Methods." mHMG-CoA, mitochondrial hydroxymethyl-glutaryl-CoA.

 
Gel Shift Mobility Assays—The PDK4 promoter probes for gel shift assays were created by labeling double-stranded oligonucleotides using Klenow enzyme and [{alpha}-32P]dCTP (20, 23). The sequence of the top strand oligomers were –211/–192, 5'-gctctcaccctttgccccttac-3', –130/–110, 5'-ggaggagcccaaagttcttgc-3', and –1115/–1093, 5'-gatgcgagggctaagggcaccttg-3'. The labeled probe (30,000 cpm) was combined with proteins isolated from rat liver nuclei in binding buffer containing 80 mM KCl, 25 mM Tris HCl, pH 7.4, 0.1 mM EDTA, 1 mM dithiothreitol, and 10% glycerol (20, 23). The nonspecific competitor added to each binding reaction was 1 µgof a 1:1 ratio of poly(dI·dC):poly(dA·dT). Antibodies were added to the binding reaction before the addition of nuclear protein extract. The antibody to HNF4 (Santa Cruz, sc-8987) was purchased from Santa Cruz. Binding reactions were incubated at room temperature for 20 min and resolved on a 5% nondenaturing acrylamide gel (80:1, acrylamide/bisacrylamide) in Tris borate running buffer (0.5x Tris borate EDTA) at 4 °C. Proteins from rat liver nuclei were isolated by the method of Gorski et al. (25).

Chromatin Immunoprecipitation (ChIP) Assays—Rat primary hepatocytes (3 x 106 in a 60-mm dish) were maintained for 48 h in RPMI 1640 media. Cross-linking was performed with 1% formaldehyde for 15 min at room temperature and stopped by the addition of 125 mM glycine for 5 min (14, 26). Cross-linked hepatocytes were washed with phosphate-buffered saline. Cells were scraped from the plate and collected by centrifuging for 5 min at 2000 rpm. The cell pellets were resuspended in 200 µl of cell lysis buffer (50 mM Tris-HCl, pH 8.0, 85 mM KCl, 0.5% Nonidet P-40) containing protease inhibitor cocktails (Sigma #P8340). Samples were incubated on ice for 30 min and vortexed once, and the pellet was collected by centrifugation at 14,000 rpm for 5 min. The pellets were resuspended in 200 µl of SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8.1) with protease inhibitor cocktails and incubated on ice for 15 min. The pellets were sonicated 9 times for 30 s at 1-min intervals (with a Branson Sonifer 250W, 2-mm micro tip setting = 7) followed by centrifugation at 14,000 x g for 10 min. The supernatant-containing DNA-protein complex was diluted 10-fold in ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl, pH 8.1, 167 mM NaCl) with protease inhibitors. The samples were precleared by the addition of 80 µl of salmon sperm DNA/protein A-agarose (50% slurry; Upstate, #16-157) for 30 min at 4 °C with rotation. The supernatant was incubated with 5–10 µg of anti-PGC-1{alpha} (Santa Cruz, sc-13067) or anti-HNF4 (Santa Cruz, sc-8987) at 4 °C overnight using rabbit IgG as the control. To collect the antibody-protein-DNA complex, 60 µl of protein A-agarose slurry was added for 2 h at 4 °C.

The protein A-agarose was washed 1 time with 1 ml of each of the following buffers: low salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 150 mM NaCl); high salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 500 mM NaCl); LiCl wash buffer (0.25 M LiCl, 1% Nonidet P-40, 1% deoxycholate, 1 mM EDTA, 10 mM Tris-HCl, pH 8.1). This was followed by two 1-ml washes with 10 mM Tris and 1 mM EDTA, pH 8.0, buffer. Precipitates were eluted with elution buffer (1% SDS, 0.1 M NaHCO3). The DNA protein complexes were incubated overnight at 65 °C to reverse the cross-links. The DNA was precipitated with the addition of 2.5 volumes of ethanol. The pellet was resuspended in 100 µl of water, 4 µl of Tris, pH 6.8, 2 µl of 0.5 M EDTA, pH 8.0, and 1 µl of 20 mg/ml proteinase K. After incubation at 45 °C for 1 h, genomic DNA fragments were purified using Qiaquick spin columns (Qiagen, #28104). A total of 2–5 µl of purified sample were used in 30–35 cycles of PCR. Primers for the rat PDK4 gene are listed in Table II. The PCR products were analyzed on 2% Nusieve 3:1-agarose (Cambrex, #50094) and visualized by with MultiImage Light Cabinet with Quantity One software.


View this table:
[in this window]
[in a new window]
  		TABLE II
The following primers were used for the ChIP assay to demonstrate interactions of PGC-1{alpha} and HNF-4 with the PDK4 gene

 

   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
PGC-1{alpha} and PDK4 gene expression are elevated in the liver of diabetic and fasted animals (4, 13). Our first experiments were designed to determine whether PGC-1{alpha} could stimulate the expression of hepatic genes involved in glucose and lipid metabolism. We infected primary rat hepatocytes with adenoviruses expressing either GFP (Ad-GFP) or PGC-1{alpha} (Ad-PGC-1{alpha}). After 48 h, RNA was harvested, and the PDK2 and PDK4 mRNA abundance were measured by real-time PCR. As is shown in Fig. 1A, overexpression of PGC-1{alpha} increased the PDK4 mRNA abundance 6.2 ± 0.9-fold and the PDK2 mRNA abundance 9.0 ± 1.2-fold. PGC-1{alpha} stimulated the abundance of CPT-I{alpha} mRNA 4-fold. Interestingly, the expression of mitochondrial hydroxymethylglutaryl-CoA synthase, which is involved in ketogenesis, was not increased by PGC-1{alpha} overexpression (Fig. 1A). The expression of stearoyl-CoA desaturases 1 and 2 (SCD-1 and SCD-2) were not increased by PGC-1{alpha}. Long chain fatty acids will increase transcription of PDK4 (7). We tested whether the addition of long chain fatty acids would alter the ability of PGC-1{alpha} to stimulate the PDK4 or PDK2 genes. Hepatocytes were incubated with RPMI 1640 containing 20 mM glucose and either bovine serum albumin (BSA) or BSA with 350 µM oleate. Incubation with oleate increased basal expression of the PDK4 gene 2.5-fold in the cells infected with GFP (Fig. 1C). PGC-1{alpha} stimulated PDK4 gene expression an additional 2.5-fold in hepatocytes incubated with fatty acids as opposed to 4-fold with the bovine serum albumin alone (Fig. 1C). These experiments indicate that PGC-1{alpha} can induce PDK4 even when the PDK4 gene expression is elevated by fatty acids. On the other hand, the induction of PDK2 by PGC-1{alpha} was equal in the presence or absence of the fatty acids (data not shown).

Because PDK2 and PDK4 are elevated in the hearts of fasted animals, we tested the ability of PGC-1{alpha} to induce the expression of PDK4 and PDK2 mRNA in primary cardiac myocytes. Ventricular myocytes were prepared from newborn rats and infected with either Ad-GFP or Ad-PGC-1{alpha}. After infection, the myocytes were maintained in serum-free media containing 20 mM glucose. PDK4 was robustly induced 14.0 ± 3.4-fold by PGC-1{alpha} overexpression, whereas PDK2 was stimulated 3.5 ± 0.6-fold (Fig. 1B). The CPT-I{alpha} and CPT-I{beta} isoforms were induced 4.5- and 3.3-fold respectively, whereas the mitochondrial hydroxymethylglutaryl-CoA synthase was not increased. Expression of SCD-1 but not SCD-2 was elevated by PGC-1{alpha} overexpression (Fig. 1B). We observed that the induction of PDK4 mRNA abundance by PGC-1{alpha} varied in ventricular myocytes under different culture conditions. When the myocytes were cultured in high glucose (20 mM) containing 5% calf serum and 5% fetal bovine serum, the induction of PDK4 and PDK2 mRNA abundance was 31.7 ± 0.7- and 7.6 ± 2.4-fold, respectively (data not shown). However, altering the culture media did not affect the ability of PGC-1{alpha} to induce either the CPT-I{alpha} or CPT-I{beta} isoforms, suggesting that this effect was limited to the PDK genes (data not shown). When the myocytes were cultured in media containing 5.5 mM glucose in the absence of serum, the PDK4 and PDK2 mRNA abundance was increased 7.5- and 4.5-fold, respectively, by PGC-1{alpha}. Overall, our data demonstrated that the PDK4 gene is highly regulated by PGC-1{alpha}. Given this extensive regulation of PDK genes by PGC-1{alpha} and the key role of PDK4 in pyruvate metabolism, we decided to investigate the control of PDK4 gene expression.

We examined the relative expression of PGC-1{alpha} expression in infected hepatocytes and diabetic liver (Fig. 1D). Primary rat hepatocytes were infected with PGC-1{alpha} at three increasing multiplicities of infection. In addition, rats were made diabetic by injection of streptozotocin. The hepatocytes and the livers were harvested, and PGC-1{alpha} abundance was assessed by Western analysis. The data shown in Fig. 1D indicate that PGC-1{alpha} protein abundance was similarly increased by adenoviral infection of hepatocytes and in the liver of diabetic rats.

To further analyze the regulation of the PDK4 gene by PGC-1{alpha}, we cloned the promoter for the rat PDK4 gene. The rat PDK4 promoter was cloned using PCR amplification of rat genomic DNA with PDK4-specific primers. The PDK4 promoter contained 2989 base pairs of 5'-flanking sequence. We confirmed the identity of the rat PDK4 promoter by RACE analysis using nested primers from the second exon of the PDK4 gene, which is within the protein-coding sequence (Fig. 2A). All the RACE products contained a single first exon, and we did not identify any alternate exons with this approach. Approximately, 80% of the PCR reactions stopped at the adenosine nucleotides in the AGACA sequence at the end of the PDK4 first exon (Fig. 2). The remaining reverse transcriptase reactions did not extend as far 5' into the first exon. We chose the most 5' adenosine as the start site of transcription and assigned it +1 in our nucleotide numbering scheme (Fig. 2B). The ATG that initiates protein translation is found at nucleotide +148 in the first exon. The initiating ATG is also found in the first exon of the mouse and human genes (27, 28). The rat PDK4 promoter does not have a consensus TATA box, although there is a TAAATAAA sequence at –31 to –24 that resembles a TATA element. There is a consensus Sp1 binding site at nucleotides –43/–36. Sp1 binding sites are frequently observed near the start site of transcription in TATA-less promoters (29). The rat and mouse promoters are more than 90% identical within the first 600 base pairs.



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 1.
PGC-1{alpha} induces PDK4 and PDK2 gene expression. A, primary rat hepatocytes were infected with adenoviral vectors expressing PGC-1{alpha} (Ad-PGC-1{alpha}). The infection conditions are described under "Materials and Methods." After 48 h RNA was isolated, and the mRNA abundance of the various genes was measured by real-time PCR as described under "Materials and Methods." 18 S rRNA was used as the control. The infections were repeated four times on independent preparations of hepatocytes. The data are expressed as-fold induction of mRNA abundance of the PGC-1{alpha}-infected cells relative to the GFP-infected cells. B, primary neonatal myocytes were infected with adenoviral vectors exactly as with the hepatocytes. Determination of RNA abundance from the myocytes was conducted as described under "Materials and Methods." The data represent the average of three independent infections of myocytes. C, hepatocytes were incubated in RPMI 1640-containing bovine serum albumin (BSA) or BSA and 350 µM oleate. Infections with Ad-GFP and Ad-PGC-1{alpha} were conducted as described in A. RNA was harvested, and the PDK4 mRNA was assessed by real-time PCR. The data are the average of three independent infections of hepatocytes. D, hepatocytes were infected with Ad-PGC-1{alpha} at three different multiplicities of infection (MOI) as indicated above the Western blot. Proteins were prepared from whole liver extract of streptozotocin-induced diabetic and control rats. The PGC-1{alpha} abundance was determined by Western analysis, and the protein source is indicated above the immunoblot.

 



View larger version (35K):
[in this window]
[in a new window]
  		FIG. 2.
Identification of the rat PDK4 promoter. A, a model of the rat PDK4 first and second exons is shown. The location of gene-specific primers (GSP2 and GSP3), which were used in the RACE reactions, is shown. The highlighted adenosine (A) at +1 indicates the transcriptional start site in exon 1. B, the sequence of the rat proximal promoter is shown. Specific protein binding sites for HNF4, FOXO1, and Sp1 are underlined. The ATG (Met), where protein translation initiates, are the final nucleotides in the sequence.

 



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 3.
PGC-1{alpha} and HNF-4 will stimulate rat and mouse PDK4 gene expression. HepG2 hepatoma cells were transfected with 2 µgof either rat (rPDK4)- or mouse PDK4 (mPDK4)-luciferase reporter gene and expression vectors for HNF-4 (0.25 µg) or pSV-PGC-1{alpha} (1.0 µg). TK-Renilla (1.0 µg) was included as a transfection control. Cells were harvested 36 h after transfection. The luciferase activity was corrected for protein content and Renilla activity. The data are expressed as -fold induction by the particular transcription factor. All transfections were done in duplicate and repeated four to six times.

 
Our next experiments examined the ability of PGC-1{alpha} to induce the rat and mouse PDK4 promoters in transient transfection assays. We transfected the –2083/+87 rat PDK4-luc or the mouse PDK4-luc vectors into HepG2 hepatoma cells in the presence or absence of PGC-1{alpha}. Both reporter genes were induced by PGC-1{alpha} overexpression (Fig. 3). In addition, we examined the ability of HNF-4 to induce the rat PDK4 gene since HNF-4 is a nuclear receptor that interacts with PGC-1{alpha} and regulates the expression of numerous hepatic genes (30). We found that HNF-4 stimulated both the rat and mouse PDK4 genes. Although the extent of the induction varied between these rodent promoters, they are both clearly responsive to PGC-1{alpha} and HNF-4.

To extend these observations we undertook to identify PGC-1{alpha}- and HNF4-responsive regions in the rat PDK4 promoter. We created serial deletions from the 5' end of the rat PDK4 promoter that were ligated to the luciferase reporter gene and transfected these reporter genes into HepG2 cells. Overexpression of PGC-1{alpha} increased the expression of rat PDK4-luciferase 3.5 ± 0.1-fold (Fig. 4). This induction was lost between nucleotides –578 and –375. HNF-4 strongly stimulated the –2989/+87 PDK4-luc gene, and the induction by PGC-1 and HNF-4 was additive. Most of the HNF-4 induction was lost with deletion of the nucleotides –1504 to –1197. The remaining 2-fold induction by HNF-4 was lost between –375 and –18. These results indicate that there are at least two HNF-4 binding sites in the PDK4 promoter. However, the stimulation by PGC-1{alpha} occurs through different regions of the promoter than the induction by HNF-4.

We created a set of smaller serial deletions between nucleotides –1504 and –1197 and tested these luciferase vectors for HNF-4 and PGC-1{alpha} responsiveness. In these experiments, the 7-fold induction by HNF-4 was decreased to 2-fold with deletion of the sequences between –1258 and –1197 (Fig. 5). The next experiments were designed to identify binding sites for HNF-4 in the PDK4 promoter. First, we generated three double-stranded oligonucleotides that represented all the sequences in the –1258 to –1197 region of the promoter. The ability of these oligomers to bind factors in rat liver nuclear extract was tested with gel shift mobility assays. Two oligomers containing nucleotides –1221 to –1197 and –1210 to –1184 were able to bind nuclear proteins. However, none of the DNA protein complexes was altered by an antibody to HNF4 in the gel shift assays, indicating that HNF4 did not bind in this region (data not shown). Further inspection of the promoter led to the identification of a sequence between –1115 and –1092 that contained a consensus HNF-4 site. We tested this DNA element in gel shift mobility assays using rat liver nuclear extract and an antibody to HNF-4 (Fig. 6A). The antibody to HNF4 super-shifted the DNA protein complex indicating that this element could bind HNF-4. Because we could not demonstrate HNF4 binding in the –1258 to –1197 region, this observation suggested that HNF-4 may interact with some factor between –1258 to –1197 to mediate a transcriptional induction. We conducted gel shift mobility assays with four oligomers representing consensus HNF-4 sites in the –375 to –18 region. Two of the oligomers containing the sequences between –212/–192 and –130/–110 bound HNF-4 in gel shift mobility assays (Fig. 6A). Overall, the data demonstrate that HNF-4 can bind to several sites in the promoter.



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 4.
Different regions of rat PDK4 promoter respond to PGC-1{alpha} and HNF-4. Serial deletions were created from the 5' end of the rPDK4 promoter. A model of the truncated promoters is shown on the left side. HepG2 cells were transfected with 2 µg of rPDK4-luciferase reporter gene and expression vectors for HNF-4 and pSV-PGC-1{alpha} as described in the legend to Fig. 3. The luciferase activity was corrected for protein content and Renilla activity. The data are expressed as -fold induction by the particular factor. All transfections were done in duplicate and repeated four times.

 
To evaluate the importance of these HNF-4 binding sites in the regulation of PDK4 by HNF-4, we disrupted each of these sites by site-directed mutagenesis. The –2989/+87 PDK4-luc vectors with mutations in each of the HNF-4 binding sites were transfected into HepG2 cells along with the expression vectors for HNF-4 or PGC-1{alpha}. As can be seen in Fig. 6B, disruption of the –1115/–1093 site decreased the ability of HNF-4 to stimulate PDK4 expression, indicating that this element mediates the induction by HNF4. However, disruption of the more proximal HNF-4 sites did not decrease the induction by HNF-4. Overall, the data indicate that HNF-4 stimulates PDK4 primarily through the upstream element. In addition, we tested whether disruption of these sites would decrease the ability of PGC-1{alpha} to induce PDK4 gene expression. The mutations did not decrease the ability of PGC-1{alpha} to induce the expression of PDK4 (Fig. 6B). The results indicate that HNF-4 does not contribute to the recruitment of PGC-1{alpha} to the PDK4 gene.



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 5.
Characterization of HNF-4-responsive regions in the PDK4 promoter. Serial deletions were created between –1502 and –1197 in the rPDK4 promoter. A model of the truncated promoters is shown on the left side. HepG2 cells were transfected with 2 µg of rPDK4-luciferase reporter gene and expression vectors for HNF-4 (0.25 µg), pSV-PGC-1{alpha} (1 µg), and TK-Renilla (1.0 µg) as described in the legend to Fig. 3. All transfections were done in duplicate and repeated four times.

 



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 6.
Identification of HNF-4 binding sites in the PDK4 promoter. A, gel shift mobility assays were conducted to demonstrate the binding of HNF-4 to specific oligomers. The nucleotides contained in the 32P-labeled oligomer are indicated at the top. The oligomers were incubated with either rat liver nuclear extract (RLNE) or an antibody against HNF-4 (HNF-4 Ab). The resulting protein DNA complexes were resolved on a non-denaturing acrylamide gel. B, the HNF4 binding sites were mutated by site-directed mutagenesis in the PDK4-luc vector. Transfections with expression vectors for HNF4 and PGC-1{alpha} were conducted as described in the legend to Fig. 3. The data are expressed as the induction by HNF4 or PGC-1{alpha}. All transfections were done in duplicate and repeated three times.

 
To identify which sequences in the –578 to –375 region might be important for recruiting PGC-1{alpha}, we generated additional deletions in this region. The deletion of nucleotides between –504/–461 and –423/–375 decreased the ability of PGC-1{alpha} to induce the PDK4 promoter, suggesting that at least two factors are recruiting PGC-1{alpha} to the gene (Fig. 7). We ligated the –578/–328 and –578/–375 regions in front of the enhancerless SV40-luc reporter gene. These vectors were transfected with either pSV or pSV-PGC-1{alpha} into HepG2 cells. As shown at the bottom of Fig. 7, deletion of nucleotides –375 to –328 greatly decreased the ability of PGC-1 to stimulate gene expression. Two copies of the –375/–328 regions were ligated in front of SV40-luciferase, and this region mediated an induction by PGC-1{alpha}. The data in this figure demonstrate that at least two regions between –578 and –328 are involved in the induction of the PDK4 gene by PGC-1{alpha}.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 7.
PGC-1{alpha} induces PDK4 through proximal promoter sequences. Serial deletions were created between –578 and –375 in the PDK4 promoter and ligated to the luciferase reporter gene. In addition, regions of the PDK4 promoter were ligated in front of the SV40-luciferase reporter. Transfections were conducted in HepG2 cells as described in the legend for Fig. 3. The data are expressed as the induction by PGC-1{alpha}. All transfections were done in duplicate and repeated three times.

 
We conducted ChIP assays with the PDK4 promoter to test whether HNF-4 and PGC-1{alpha} were associated with the PDK4 gene in vivo. Primary rat hepatocytes were cross-linked with 1% formaldehyde, and the chromosomal DNA was sheared by repeated sonication. The DNA-protein complexes were immunoprecipitated using either rabbit IgG as a control or antibodies to HNF-4 and PGC-1{alpha}. Using primers to the –1504/–1197 region of the PDK4 gene, we observed a strong PCR product with DNA immunoprecipitated with the HNF-4 antibody but not with the PGC-1{alpha} antibody (Fig. 8). The PGC-1{alpha} antibody did immunoprecipitate some chromosomal DNA based upon the weak PCR product. On the other hand, PCR primers around the proximal promoter generated substantial PCR products with DNA immunoprecipitated by both the PGC-1{alpha} and HNF-4 antibodies. These results indicate that HNF-4 and PGC-1{alpha} are bound to the rat PDK4 promoter in vivo.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In this study we have identified new mechanisms by which PDK gene expression is induced. Our data demonstrate that PGC-1{alpha} will stimulate PDK4 and PDK2 gene expression and suggest that this induction may have an important role in glucose metabolism. PDC catalyzes the metabolism of pyruvate to acetyl-CoA, and the activity of this enzyme controls the fate of pyruvate. PDC is inhibited by phosphorylation by the PDK enzymes. The inhibition of PDC will lead to the accumulation of pyruvate in the liver (1, 2). Pyruvate can enter the hepatic gluconeogenic pathway after conversion to oxaloacetate. The PDK4 and PDK2 genes are up-regulated in the liver of fasted and diabetic animals (4, 6, 7). Our data suggest that PGC-1{alpha} will provide gluconeogenic substrates by reducing pyruvate metabolism to acetyl-CoA. Our results have outlined a new mechanism by which PGC-1{alpha} contributes to hepatic gluconeogenesis and hyperglycemia observed in the diabetic phenotype.



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 8.
PGC-1 and HNF-4 are associated with PDK4 promoter in vivo. Chromatin immunoprecipitation assays were conducted to analyze the binding of proteins to the PDK4 promoter. A model of the PDK4 promoter and the location of the PCR primers are shown at the top of the figure. Rat hepatocytes were cross-linked with 1% formaldehyde as described under "Materials and Methods." Cross-linked DNA was immunoprecipitated with either rabbit IgG (IgG) or antibodies to HNF4 (anti-HNF4) or PGC-1{alpha} (anti-PGC-1{alpha}). The bands in the gel are ethidium bromide-stained PCR products. PCR conditions are described under "Materials and Methods." The ChIP assays were repeated three times on independent hepatocytes preparations.

 
In our studies we have provided the first cloning and characterization of the rat PDK4 promoter. The mouse and human PDK4 promoters have also been cloned (27, 28). We found with our RACE analysis that the transcriptional start site was about 50 base pairs 5' to the previously reported 5' end of the rat PDK4 cDNA. The rat gene is 91% homologous to the mouse gene within the first 500 base pairs of the proximal promoter, whereas the human PDK4 promoter has only a limited homology to the rat promoter. There is no TATA box in either the rat or mouse promoter (27, 28). Conserved elements include an Sp1 site, which may contribute to the basal expression. In addition, the two HNF-4 binding sites in the rat proximal promoter are perfectly conserved in the mouse gene, and we have shown that HNF4 can stimulate the mouse promoter. A binding site for forkhead transcription factor FKHR/FOXO1 has been identified in the mouse promoter at –362/–355, and this site is conserved in the human and rat genes (27, 28). FOXO1 participates in the stimulation of human PDK4 by glucocorticoids (27, 28). The sequence conservation between the rodent species suggests that these factors are important regulatory factors for this gene.

Multiple lines of evidence indicate that PGC-1{alpha} will promote hepatic gluconeogenesis (10, 13, 18). Overexpression of PGC-1{alpha} will stimulate PEPCK and glucose-6-phosphatase gene transcription (10, 13, 18). Expression of the PEPCK gene is inhibited by small interfering RNA to PGC-1{alpha} (31). ChIP assays have shown that PGC-1{alpha} is associated with the PEPCK and glucose-6-phosphatase promoters (17, 31). Finally, hepatocytes prepared from PGC-1{alpha} knock-out mice have reduced PEPCK expression (32). In our studies we have found that PGC-1{alpha} will stimulate PDK4 and PDK2 gene expression, and our ChIP assays demonstrated that PGC-1{alpha} is directly associated with the rat PDK4 promoter in primary hepatocytes. When pyruvate was given to PGC-1{alpha} knock-out mice, there was reduced conversion of this pyruvate into glucose (32). This observation suggests that PGC-1{alpha} has a role in regulating pyruvate metabolism. Overall, our data support the concept that PGC-1{alpha} will stimulate multiple steps in the gluconeogenic pathway.

We have found that HNF4 will stimulate the PDK4 gene at least in the liver. HNF4 directs the expression of multiple genes in the pancreas and liver. Mutations in HNF4 are associated with maturity onset diabetes type 1 (MODY1) (33, 34). In fact, it was found that HNF4 is associated with 42% of the promoters of actively transcribed genes in human hepatocytes (30). The human PDK4 gene was among the genes that bound HNF4, although specific binding sites were not identified in the human promoter (30).

In the liver, PGC-1{alpha} stimulates PEPCK gene expression through interactions with multiple transcription factors including HNF-4, FOXO1, and the glucocorticoid receptor (10, 13, 18). Mutation of the binding sites for any of these factors decreased the induction of the PEPCK gene by PGC-1{alpha}. HNF-4 is also involved in the stimulation of the glucose-6-phosphatase gene by PGC-1{alpha} (10, 13, 18). In the PDK4 gene, the induction by PGC-1{alpha} is decreased by deletion of sequences between –504 and –328. Because the PGC-1{alpha} induction decreased with sequential deletions suggests that several factors recruit PGC-1{alpha}. However, unlike the PEPCK and glucose-6-phosphatase genes, HNF-4 is not involved in the recruitment of PGC-1{alpha}. In addition, glucocorticoids do not stimulate rat PDK4 gene expression through the portion of the promoter that we cloned (data not shown). This observation suggests that the glucocorticoid receptor is not necessary for the recruitment of PGC-1{alpha} to the rat PDK4 promoter. FOXO1 may participate in the recruitment of PGC-1{alpha} since there is a FOXO1 site in the –375/–328 region that is perfectly conserved among rat, mouse, and human genes. However, it is clear that PGC-1{alpha} stimulates the PEPCK and PDK4 genes by different mechanisms.


   FOOTNOTES
 
* This work was supported by National Institutes of Health Grant DK-059368 (to E. A. P.), the American Diabetes Association (to E. A. P.), National Institutes of Health Grant HL-66924 (to G. A. C.), and a Veterans Affairs merit award (to M. B. E.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§ These authors contributed equally to this work. Back

|| To whom correspondence should be addressed: Dept. of Pharmacology, University of Tennessee, College of Medicine, 874 Union Ave., Memphis, TN 38163. Tel.: 901-448-4779; Fax: 901-448-7206; E-mail: epark{at}utmem.edu.

1 The abbreviations used are: PDC, pyruvate dehydrogenase complex; PGC-1, peroxisome proliferator-activated receptor {gamma} coactivator; PDK, pyruvate dehydrogenase kinase; CPT, carnitine palmitoyltransferase; SCD, stearoyl-CoA desaturase; PEPCK, phosphoenolpyruvate carboxykinase; HNF-4, hepatic nuclear factor 4; FOXO1, forkhead transcriptional factor; ChIP, chromatin immunoprecipitation assay; GSP, gene-specific primer; PDK4-luc, PDK4-luciferase; RACE, rapid amplification of cDNA ends; r-, rat; GFP, green fluorescent protein. Back


   ACKNOWLEDGMENTS
 
We thank Dr. B. Spiegelman for the adenoviruses expressing PGC-1{alpha} and GFP, Dr. Furuyama for the mouse PDK4-luc vector, and Keerthi Gadiparthi for sequencing the RACE PCR products.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Harris, R. A., Bowker-Kinley, M. M., Huang, B., and Wu, P. (2002) Adv. Enzyme Regul. 42, 249–259[CrossRef][Medline] [Order article via Infotrieve]
  2. Sugden, M. C., and Holness, M. J. (2003) Am. J. Physiol. Endocrinol. Metab. 284, 855–862
  3. Huang, B., Wu, P., Popov, K. M., and Harris, R. A. (2003) Diabetes 52, 1371–1376[Abstract/Free Full Text]
  4. Harris, R. A., Huang, B., and Wu, P. (2001) Adv. Enzyme Regul. 41, 269–288[CrossRef][Medline] [Order article via Infotrieve]
  5. Holness, M. J., Bulmer, K., Smith, N. D., and Sugden, M. C. (2003) Biochem. J. 369, 687–695[CrossRef][Medline] [Order article via Infotrieve]
  6. Holness, M. J., Kraus, A., Harris, R. A., and Sugden, M. C. (2000) Diabetes 49, 775–781[Abstract]
  7. Huang, B., Wu, P., Bowker-Kinley, M. M., and Harris, R. A. (2002) Diabetes 51, 276–283[Abstract/Free Full Text]
  8. Holness, M. J., Smith, N. D., Bulmer, K., Hopkins, T., Gibbons, G. F., and Sugden, M. C. (2002) Biochem. J. 364, 687–694[Medline] [Order article via Infotrieve]
  9. Puigserver, P., Wu, Z., Park, C. W., Graves, R., Wright, M., and Spiegelman, B. M. (1998) Cell 92, 829–839[CrossRef][Medline] [Order article via Infotrieve]
  10. Puigserver, P., and Spiegelman, B. M. (2003) Endocr. Rev. 24, 78–90[Abstract/Free Full Text]
  11. Lehman, J. J., Barger, P. M., Kovacs, A., Saffitz, J. E., Medeiros, D. M., and Kelly, D. P. (2000) J. Clin. Investig. 106, 847–856[Medline] [Order article via Infotrieve]
  12. Vega, R. B., Huss, J. M., and Kelly, D. P. (2000) Mol. Cell. Biol. 20, 1868–1876[Abstract/Free Full Text]
  13. Yoon, J. C., Puigserver, P., Chen, G., Donovan, J., Wu, Z., Rhee, J., Adelmant, G., Stafford, J., Kahn, C. R., Granner, D. K., Newgard, C. B., and Spiegelman, B. M. (2001) Nature 413, 131–138[CrossRef][Medline] [Order article via Infotrieve]
  14. Zhang, Y., Ma, K., Song, S., Elam, M. B., Cook, G. A., and Park, E. A. (2004) J. Biol. Chem. 279, 53963–53971[Abstract/Free Full Text]
  15. Rhee, J., Inoue, Y., Yoon, J. C., Puigserver, P., Fan, M., Gonzalez, F. J., and Spiegelman, B. M. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 4012–4017[Abstract/Free Full Text]
  16. Louet, J. F., Hayhurst, G., Gonzalez, F. J., Girard, J., and Decaux, J. F. (2002) J. Biol. Chem. 277, 37991–38000[Abstract/Free Full Text]
  17. Puigserver, P., Rhee, J., Donovan, J., Walkey, C. J., Yoon, J. C., Oriente, F., Kitamura, Y., Altomonte, J., Dong, H., Accili, D., and Spiegelman, B. M. (2003) Nature 423, 550–555[CrossRef][Medline] [Order article via Infotrieve]
  18. Boustead, J. N., Stadelmaier, B. T., Eeds, A. M., Wiebe, P. O., Svitek, C. A., Oeser, J. K., and O'Brien, R. M. (2003) Biochem. J. 369, 17–22[CrossRef][Medline] [Order article via Infotrieve]
  19. Park, E. A., Steffen, M. L., Song, S., Park, V. M., and Cook, G. A. (1998) Biochem. J. 330, 217–224
  20. Steffen, M. L., Harrison, W. R., Elder, F. F., Cook, G. A., and Park, E. A. (1999) Biochem. J. 340, 425–432
  21. Deng, X., Cagen, L. M., Wilcox, H. G., Park, E. A., Raghow, R., and Elam, M. B. (2002) Biochem. Biophys. Res. Commun. 290, 256–262[CrossRef][Medline] [Order article via Infotrieve]
  22. Cook, G. A., Edwards, T. L., Jansen, M. S., Bahouth, S. W., Wilcox, H. G., and Park, E. A. (2001) J. Mol. Cell. Cardiol. 33, 317–329[CrossRef][Medline] [Order article via Infotrieve]
  23. Song, S., Zhang, Y., Ma, K., Jackson-Hayes, L., Lavrentyev, E. N., Cook, G. A., Elam, M. B., and Park, E. A. (2004) Biochim. Biophys. Acta 1679, 164–173[Medline] [Order article via Infotrieve]
  24. Park, E. A., Mynatt, R. L., Cook, G. A., and Kashfi, K. (1995) Biochem. J. 310, 853–858
  25. Gorski, K., Carneiro, M., and Schibler, U. (1986) Cell 47, 767–776[CrossRef][Medline] [Order article via Infotrieve]
  26. Jurado, L. A., Song, S., Roesler, W. J., and Park, E. A. (2002) J. Biol. Chem. 277, 27606–27612[Abstract/Free Full Text]
  27. Kwon, H. S., Huang, B., Unterman, T. G., and Harris, R. A. (2004) Diabetes 53, 899–910[Abstract/Free Full Text]
  28. Furuyama, T., Kitayama, K., Yamashita, H., and Mori, N. (2003) Biochem. J. 375, 365–371[CrossRef][Medline] [Order article via Infotrieve]
  29. Smale, S. T. (1997) Biochim Biophys Acta 1351, 73–88[Medline] [Order article via Infotrieve]
  30. Odom, D. T., Zizlsperger, N., Gordon, D. B., Bell, G. W., Rinaldi, N. J., Murray, H. L., Volkert, T. L., Schreiber, J., Rolfe, P. A., Gifford, D. K., Fraenkel, E., Bell, G. I., and Young, R. A. (2004) Science 303, 1378–1381[Abstract/Free Full Text]
  31. Koo, S. H., Satoh, H., Herzig, S., Lee, C. H., Hedrick, S., Kulkarni, R., Evans, R. M., Olefsky, J., and Montminy, M. (2004) Nat. Med. 10, 530–534[CrossRef][Medline] [Order article via Infotrieve]
  32. Lin, J., Wu, P. H., Tarr, P. T., Lindenberg, K. S., St-Pierre, J., Zhang, C. Y., Mootha, V. K., Jager, S., Vianna, C. R., Reznick, R. M., Cui, L., Manieri, M., Donovan, M. X., Wu, Z., Cooper, M. P., Fan, M. C., Rohas, L. M., Zavacki, A. M., Cinti, S., Shulman, G. I., Lowell, B. B., Krainc, D., and Spiegelman, B. M. (2004) Cell 119, 121–135[CrossRef][Medline] [Order article via Infotrieve]
  33. Ryffel, G. U. (2001) J. Mol. Endocrinol. 27, 11–29[Abstract]
  34. Gupta, R. K., and Kaestner, K. H. (2004) Trends Mol. Med. 10, 521–524[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Endocrinol.Home page
H. Wang, T. H. Peiris, A. Mowery, J. Le Lay, Y. Gao, and L. E. Greenbaum
CCAAT/Enhancer Binding Protein-{beta} Is a Transcriptional Regulator of Peroxisome-Proliferator-Activated Receptor-{gamma} Coactivator-1{alpha} in the Regenerating Liver
Mol. Endocrinol., July 1, 2008; 22(7): 1596 - 1605.
[Abstract] [Full Text] [PDF]

Home page
 BioinformaticsHome page
Y. Lai
Genome-wide co-expression based prediction of differential expressions
Bioinformatics, March 1, 2008; 24(5): 666 - 673.
[Abstract] [Full Text] [PDF]

Home page
 J. Appl. Physiol.Home page
O. H. Mortensen, P. Plomgaard, C. P. Fischer, A. K. Hansen, H. Pilegaard, and B. K. Pedersen
PGC-1beta is downregulated by training in human skeletal muscle: no effect of training twice every second day vs. once daily on expression of the PGC-1 family
J Appl Physiol, November 1, 2007; 103(5): 1536 - 1542.
[Abstract] [Full Text] [PDF]