Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M504516200 on June 20, 2005

J. Biol. Chem., Vol. 280, Issue 33, 29912-29920, August 19, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/33/29912    most recent
M504516200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, J.
Right arrow Articles by Baserga, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, J.
Right arrow Articles by Baserga, R.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Functional Significance of Type 1 Insulin-like Growth Factor-mediated Nuclear Translocation of the Insulin Receptor Substrate-1 and {beta}-Catenin*

Jia Chen{ddagger}, An Wu{ddagger}, Hongzhi Sun{ddagger}, Robert Drakas{ddagger}, Cecilia Garofalo§, Sandra Cascio§, Eva Surmacz§, and Renato Baserga{ddagger}

From the {ddagger}Kimmel Cancer Center, Thomas Jefferson University, Philadelphia, Pennsylvania 19107 and the §Sbarro Institute for Cancer Research and Molecular Medicine, Center for Biotechnology, Temple University, Philadelphia, Pennsylvania 19122

Received for publication, April 25, 2005 , and in revised form, June 9, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Previous work has shown that the transcriptional regulator {beta}-catenin can translocate to the nuclei when cells are stimulated with the type 1 insulin-like growth factor (IGF-1). We show by immunocoprecipitation and by confocal microscopy that {beta}-catenin binds to and co-localizes with the insulin receptor substrate-1 (IRS-1), a docking protein for both the insulin and the IGF-1 receptors. IRS-1 is required for IGF-1-mediated nuclear translocation of {beta}-catenin, resulting in the activation of the {beta}-catenin target genes. IGF-1-mediated nuclear translocation of {beta}-catenin is facilitated by the nuclear translocation of IRS-1. Both IRS-1 and {beta}-catenin are recruited to the cyclin D1 promoter, an established target for {beta}-catenin, but only IRS-1 is recruited to the ribosomal DNA (rDNA) promoter. UBF proteins (known to interact with both IRS-1 and {beta}-catenin) are also detectable in the cyclin D1 and rDNA promoters. These results indicate that IRS-1 (activated by the IGF-1 receptor) is one of several proteins that regulate the subcellular localization and activity of {beta}-catenin. The ability of IRS-1 to localize to both RNA polymerase II (with {beta}-catenin) and RNA polymerase I-regulated promoters suggest an explanation for the effect of IRS-1 on both cell growth in size and cell proliferation. This possibility is supported by the demonstration that enforced nuclear localization of IRS-1 causes nuclear translocation of {beta}-catenin and transformation of normal mouse embryo fibroblasts (colony formation in soft agar).


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The important roles played by {beta}-catenin in adhesion, cancer, and development and its connections to Wnt and APC have been discussed in recent reviews (1-3). Briefly, there is usually a large pool of {beta}-catenin in the cytoplasm, where it is targeted for destruction by phosphorylation of the N terminus (2, 4). Under certain circumstances, for instance Wnt signaling, {beta}-catenin is stabilized and transferred to the nuclei where it binds members of the family of T-cell factor/lymphoid enhancer factors (Tcf/Lef) and activates transcription of target genes (5, 6). Among genes regulated by {beta}-catenin are c-myc (7) and cyclin D1 (8, 9), which encode critical cell-cycle progression proteins (a list of target genes can be found at www.stanford.edu/~rnusse/pathways/targets.html). Recently, we found by our modified TAPtag technique that the insulin receptor substrate-1 (IRS-1)1 interacts in the nuclei with {beta}-catenin (10). IRS-1, a docking protein for both the IGF-1 and insulin receptors, sends a strong mitogenic, anti-apoptotic, and anti-differentiation signal (11, 12). Overexpression or ectopic expression of IRS-1 can cause cell transformation, including the ability of cells to form colonies in soft agar and tumors in mice (13). Under certain circumstances, IRS-1 translocates to the nuclei (14-16) where it interacts with nuclear proteins, including viral oncoproteins (14, 17), the upstream binding factor 1 (UBF1) (15, 16), and the estrogen receptor (18).

IGFs are known to cause translocation of {beta}-catenin to the nuclei, where it activates the target genes (5, 19-21). We have previously reported that IGF-1 stimulates the expression of both c-myc and cyclin D1 (22, 23), two targets of {beta}-catenin. The exact molecular mechanism of this effect has not been fully explored. Our recent discovery of a direct binding between IRS-1 and {beta}-catenin has prompted us to investigate the mechanism(s) and the functional significance of the interaction, in the context of IGF-1R signaling. Because IRS-1 is known to interact with UBF1 (a regulator of RNA polymerase I activity), whereas {beta}-catenin has been reported to interact with UBF2 in the cyclin D1 promoter (24), we also examined the possibility that IGF-1 stimulation may recruit IRS-1 and {beta}-catenin together or separately to the cyclin D1 and the rDNA promoters.

We report here that {beta}-catenin and IRS-1 co-immunoprecipitate in nucleus and cytosol of mouse embryo fibroblasts (MEFs). IGF-1 promotes {beta}-catenin translocation in R+ cells, where IRS-1 is also nuclear, but not in R12 cells, where IRS-1 is confined to the cytosol. The nuclear translocation of IRS-1 and {beta}-catenin to the nuclei activates the Tc/Lef reporter. We find also that IRS-1 and {beta}-catenin are both recruited to the cyclin D1 promoter with the UBF proteins, as already reported for {beta}-catenin (24). IRS-1, but not {beta}-catenin, is recruited to the rDNA promoter, where it is known to bind UBF1 and stimulate the synthesis of rRNA (16). Using R12 and BT20 mammary cancer cells (25), we show that IRS-1 is required for IGF-1-mediated nuclear translocation of {beta}-catenin. The role of IRS-1 in the nuclear translocation of {beta}-catenin has been confirmed by using a plasmid in which IRS-1 is expressed in fusion to a Nuclear Localization Signal (NLS). Stable expression of this plasmid in growth-regulated, contact-inhibited mouse fibroblast R12 cells (where both IRS-1 and {beta}-catenin are normally cytoplasmic) causes both proteins to co-localize to the nuclei and induces the transformation of R12 cells into cells capable of forming colonies in soft agar (the best criteria for in vitro transformation). Although {beta}-catenin can be translocated to the nuclei by different stimuli and pathways (see above), independently of IGF-1R signaling, these results indicate that IRS-1 can be considered one of the proteins that regulate the subcellular localization and activity of {beta}-catenin, especially in cells responsive to the mitogenic action of IGF-1.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cells and Cell Cultures—R-cells and R--derived cells are 3T3-like cells originating from mouse embryos with a targeted disruption of the IGF-1R genes (26). They were described in previous reports (22, 27, 28) and are briefly described again under "Results." Cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum plus L-glutamine plus the appropriate antibiotics. For stimulation with IGF-1 (20 ng/ml), cells were starved in serum-free medium for 24-48 h before addition of IGF-1.

Plasmids—The UBF1 plasmid with a FLAG tag has been described by Maiorana et al. (29). The UBF2 with a FLAG tag was constructed in the same manner. The mutant plasmids of {beta}-catenin ({partial}C and {partial}N), a kind gift of Dr. Kamel Khalili (Temple University, Philadelphia, PA), are described in the report by Gan and Khalili (30). The plasmid with a nuclear localization signal was the pCMV/myc/nuc plasmid (Invitrogen). IRS-1 was cloned in the XhoI/NotI site.

Immunoprecipitation and Western Blots—Western blots and immunoprecipitations (IPs) were carried out according to standard procedures, described in detail in previous reports from this laboratory (15, 16). Unless otherwise indicated, 20 µg of cytoplasmic or nuclear fractions was separated on a 4-14% gradient gel (Bio-Rad) and transferred to a nitrocellulose membrane. For immunoprecipitation, 100-200 µg of proteins was used, depending on the protein to be precipitated.

Subcellular Fractionation—Cell lysates and subcellular fractionation have been described in detail in Wu et al. (31). The purity of the subcellular fractions was routinely monitored with appropriate antibodies to either nuclear or cytoplasmic proteins. In this latter case, the Western blot was done directly on the nuclear or cytoplasmic lysates, without immunoprecipitation.

Confocal Microscopy—Confocal microscopy studies followed the same procedures described in detail in previous reports from our laboratory (16, 17, 29). The antibodies used are indicated in the appropriate figures.

GST Pull-down Assays—GST fusion proteins were constructed using PCR products corresponding to different regions of IRS-1 coding for amino acids 1-300, 301-700, 701-1000, and 1001-1234. These regions were generated using specific oligonucleotide primers containing the appropriate restriction sites (all of the start primers contain XhoI restriction site and end primers contain EcoRI restriction sites in the overhangs). Purified PCR products were then digested with XhoI and EcoRI and ligated into XhoI/EcoRI cloning sites of pGEX-5X-1 vector (Amersham Biosciences). All plasmids constructs were confirmed by DNA sequencing and protein expression to guarantee accuracy and amounts of GST proteins in each reaction. The detailed cloning strategies are available upon request. Binding and elution of proteins were carried out by standard procedures.

TOPFLASH Assay—The activity of {beta}-catenin was measured using the TOPFLASH/FLOPFLASH luciferase assay (32). The plasmids used were the same as those reported by Korinek et al. (25). The activity is usually determined after transient expression. We followed the procedure given in detail by Playford et al. (20). We used for transient expression the Nucleofector (Amaxa Biosystem at www.amaxa.com), with which we have been obtaining high levels of transfection (70% with difficult cells like 32D cells, even higher in MEFs). Both R+ and other R- and R--derived cells were used for these experiments.

ChIP Assays—Chromatin immunoprecipitation (ChIP) assays were carried out by standard methods (33). Subconfluent cultures were made quiescent and then stimulated with IGF-1 (see "Materials and Methods"). Following treatment, the cells were cross-linked with 1% formaldehyde at 37 °C for 10 min. The cells were collected and resuspended in 200 µl of lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8.1) and left on ice for 10 min. They were sonicated 4x for 10 s at 30% of maximal power (Fisher Sonic Dismembrator) and collected by centrifugation at 4 °C for 10 min at 14,000 rpm. The supernatants were collected and diluted in 1.3 ml of IP buffer (0.01% SDS, 1.1% Triton, 1.2 mM EDTA, 16.7 mM Tris-HCl, pH 8.1, 16.7 mM NaCl) followed by immunoclearing with 80 µl of sonicated salmon sperm DNA/protein A-agarose (Upstate%20Biotechnology">Upstate Biotechnology Inc.) for 1 h at 41 °C. The pre-cleared chromatin was immunoprecipitated for 12 h with specific antibodies (see below). After IP, 60 µl of salmon sperm/protein A-agarose was added and precipitation continued for 2 h at 41 °C. After pelletting, precipitates were washed sequentially for 5 min with the following buffers: wash A (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris HCl, pH 8.1, 150 mM NaCl), wash B (same as wash A but with 500 mM NaCl), wash C (0.25 M LiCl, 1% Nonidet P-40, 1% sodium deoxycholate, 1 mM EDTA, 10 mM Tris-HCl, pH 8.1), and then twice with TE buffer (10 mM Tris, 1 mM EDTA). The immune complexes were eluted with elution buffer (1% SDS, 0.1 M NaCO3). The eluates were reverse cross-linked by heating at 65 °C for 12 h and digested with proteinase K (0.5 µg/ml) for 1 h. DNA was obtained by phenol and phenol/chloroform extraction, precipitated with ethanol at 4 °C for 12 h, and then re-suspended in 20 µl of TE buffer. For PCR, 5 µl of each sample was used with specific primers. For the cyclin D1 promoter, chromatin was immunoprecipitated first with an antibody to {beta}-catenin, which served as the positive control, because {beta}-catenin is known to bind to the cyclin D1 promoter. Enrichment was detected with the primers for the Tcf sequence of the cyclin D1 promoter. The primers were the following: left, cggactacaggggagttttgttg; right, tccagcatccaggtggcgacgat (34). For ChIP assays with the rDNA promoter, we used the methodology of James and Zanerdijk (35) but different primers, because we were dealing with a mouse rDNA promoter. The primers we used were as follows: forward P1, 5'-CCC TGT ACG TCT GAG GCC GAG-3' (-250); rDNA promoter reverse P2, 5'-GTT AAT AGG GAA AGG ACA GCG TG-3' (+26). We also used two other primers of the rDNA gene, located in a transcribed spacer (see text). These primers were as follows: left, gtgggtgctgcgcggctgggagt; right, accagtctttctcggtcccgtgcc. For the mouse GAPDH promoter, the primers were forward P1 (5'-AGTGCCAGCCTCGTCCCGTAGACAAAATG-3) and promoter reverse P2 (5'-AAGTGGGCCCCGGCCTTCTCCAT-3'). By trial and error, we established that the best number of cycles during the PCR reaction should not be above 29 cycles. At 30-32 cycles, one could get a weak false-positive. All the data presented in this report are based on 29 cycles. The amplification products were analyzed in a 2% agarose gel and visualized by ethidium bromide staining.

Colony Formation in Soft Agar—The methodology previously described was followed (29). Briefly, to compare anchorage-independent growth of different cell lines, cells were plated at 2 x 103 in essential modified Eagle's medium containing 10% fetal bovine serum (plus or minus IGF-1) and 0.2% agarose (with 0.4% agarose underlay). The number of colonies larger than 125 µm in diameter was determined at 3 weeks following plating.

Antibodies—The antibodies used were the following: {beta}-catenin antibody (catalog no. MAB13291 R&D Systems Inc, Minneapolis, MN); IRS-1 rabbit polyclonal IgG (catalog no. G3003, Santa Cruz Biotechnology, Santa Cruz, CA); UBF, mouse monoclonal IgG1 (catalog no. SC-13125 Santa Cruz Biotechnology); anti-flag.M2-peroxidase conjugate (catalog no. a8592, Sigma); the phospho-{beta}-catenin (Ser-33/47/Thr-41) antibody (Cell Signaling, www.cellsignal.com); anti-Grb2 monoclonal antibody (catalog no. 610111BD, BD Transduction Laboratory); c-Jun Sc4, rabbit polyclonal IgG (catalog no. F9, Santa Cruz Biotechnology); second antibody anti-IgG, mouse (SC-45, Oncogene, San Diego, CA); Second Antibody Peroxidase-conjugated AffiniPure Rabbit-mouse IgG (Jackson ImmunoResearch); goat anti-mouse IgG2a-FITC,(SC2079, Santa Cruz Biotechnology); and donkey anti-rabbit IgG-R (SC-2095, Santa Cruz Biotechnology).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
IRS-1 and {beta}-Catenin Co-immunoprecipitate in the Nuclei and Cytoplasm of R--derived Cells—Our first step was to confirm by co-immunoprecipitation the IRS-1-/{beta}-catenin interaction we originally detected by our modified TAPtag technique (10). We used cell lines derived from R-cells, the original MEFs obtained from mouse embryos with a targeted disruption of the IGF-1R genes (26). R12 cells are derived from R-cells and express 7 x 103 IGF-R/cell (27), whereas R+ cells are R-cells stably transfected with a cDNA plasmid expressing the human IGF-R at high levels (28). R12 cells are not transformed, do not grow in serum-free medium (SFM), and do not respond to IGF-1 (22, 27). However, IGF-1 induces in R12 cells tyrosine phosphorylation of IRS-1 and an increase in c-myc expression (22, 27). R+ cells respond to IGF-1 with cell proliferation and form colonies in soft agar (28). We first determined in whole cell lysates of these cells the levels of expression of IRS-1, {beta}-catenin, UBF1, and Grb2. We chose the latter two proteins because UBF1 interacts with IRS-1 and is an exclusively nuclear/nucleolar protein (36), whereas Grb2 is an exclusively cytoplasmic protein that can be used to monitor protein amounts in each lane of a Western blot. All four proteins are well expressed in both cell lines, regardless of whether the cells are stimulated or not with IGF-1 (data not shown).



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 1.
Co-immunoprecipitation of IRS-1 with {beta}-catenin in subcellular fractions of R- and R+ cells. Immunoprecipitations and Western blots were carried out as described under "Materials and Methods," where subcellular fractionation is also described. The Western blots with c-Jun and Grb2 antibodies were done on lysates from fractions, without previous immunoprecipitation. In panel A, nuclear extracts were immunoprecipitated with an antibody to {beta}-catenin, Western blot with antibodies to IRS-1and {beta}-catenin (c-Jun, a nuclear protein, and Grb2, a cytosol protein, were used to monitor the purity of the fractions). IRS-1 is nuclear only in R+ cells and is detectable when an antibody to {beta}-catenin is used for immunoprecipitation. In panel B, nuclear extracts were immunoprecipitated with an antibody to IRS-1, and probed with antibodies to IRS-1and {beta}-catenin (control proteins as usual). Only in R+ cells do {beta}-catenin and IRS-1 interact in the nuclei. In panel C, cytoplasmic fractions were immunoprecipitated with an antibody to {beta}-catenin, and probed with antibodies to {beta}-catenin and IRS-1. {beta}-Catenin and IRS-1 interact also in the cytoplasm. The reverse experiment (immunoprecipitation with an antibody to IRS-1 on cytoplasmic extracts) was also done with the same results (not shown). +, cells stimulated with IGF-1; -, cells left in serum-free medium.

 
We then tested the interaction between IRS-1 and {beta}-catenin in nuclear and cytoplasmic fractions. Fig. 1A shows a Western blot from nuclear extracts immunoprecipitated with an antibody to {beta}-catenin, and stained with antibodies to IRS-1 and {beta}-catenin. The purity of the fractions was monitored with antibodies to c-Jun (a nuclear marker) and Grb2 (a cytoplasmic marker), directly on the lysates, without previous immunoprecipitation. There is interaction between the two proteins only in R+ cells, where IRS-1 is nuclear (15, 16). There is some nuclear IRS-1 in unstimulated R+ cells. We reported before (16) that R+ cells secrete some IGF-1, which allows them to grow, albeit slowly, in SFM. The reverse immunoprecipitation experiment (with an antibody to IRS-1) is shown in Fig. 1B. Again, both proteins are detectable only in R+ cells. There is no apparent interaction between IRS-1 and {beta}-catenin in R- and R12 cells, where IRS-1 is cytoplasmic (Ref. 16 and see below). However, Fig. 1C shows that {beta}-catenin and IRS-1 interact in the cytoplasm of all cell lines. The same result was obtained in the reverse experiment, where cytoplasmic extracts were immunoprecipitated with an antibody to IRS-1 and stained with antibodies to {beta}-catenin and IRS-1 (not shown). These results confirm an interaction between IRS-1 and {beta}-catenin, both in the cytoplasm and in the nuclei of R+ cells. In R- and R12 cells, stimulated with IGF-1, the interaction is limited to the cytoplasm, in agreement with the finding that IRS-1 is not found in the nuclei of these cells.



View larger version (58K):
[in this window]
[in a new window]
  		FIG. 2.
Co-localization of IRS-1 and {beta}-catenin in mouse embryo fibroblasts by confocal microscopy. The cells were stained with antibodies to IRS-1 (red) or to {beta}-catenin (green), and the pictures were merged in the third panel. A, R-cells stimulated for 16 h with IGF-1; B, unstimulated R+ cells; C, R+ cells 24 h after stimulation with IGF-1. IGF-1 stimulation causes both IRS-1 and {beta}-catenin to move significantly to the nuclei. D, R12 cells in serum-free medium and (E) 24 h after IGF-1 (20 ng/ml). Both IRS-1 and {beta}-catenin are essentially cytoplasmic in R- and R12 cells, even after IGF-1 stimulation.

 
Confocal Microscopy of R--derived Cells—To confirm the IRS-1/{beta}-catenin interaction, we studied it by confocal microscopy on R-, R12, and R+ cells. The cells were stained with antibodies to IRS-1 (red) and {beta}-catenin (green) as shown in Fig. 2, where the merged pictures are also presented. In R-cells (here stimulated with IGF-1, to which they do not respond), both IRS-1 and {beta}-catenin are largely cytoplasmic (panel A), although there is a little {beta}-catenin in the nuclei. In R+ cells, before stimulation with IGF-1, most of the IRS-1 is cytoplasmic, and in fact so is most of {beta}-catenin (panel B), although the nuclei are partially stained. After stimulation of R+ cells by IGF-1, both IRS-1 and {beta}-catenin are much more localized to the nuclei (panel C). We show in panel C a representative field for R+ cells after stimulation with IGF-1 for 24 h (panel C), but the results were the same at 16 h. In R+ cells, nuclear localization of IRS-1 after IGF-1 stimulation reaches a peak at 16-24 h (16). In R12 cells, unresponsive to mitogenic stimulation by IGF-1, both IRS-1 and {beta}-catenin are cytoplasmic before (panel D) or after 24 h stimulation with IGF-1 (panel E). The merged pictures clearly show the co-localization of the two proteins.

It could be objected that Fig. 2 does not show a nuclear staining of the cells, to validate the subcellular localization of either IRS-1 or {beta}-catenin. This is shown in Fig. 3, where R12 cells were stained with antibodies to IRS-1 (upper panels) or {beta}-catenin (lower panels) and counterstained with propidium iodide (PI). Whether in SFM or after IGF-1, in R12 cells, both IRS-1 and {beta}-catenin are essentially localized to the cytoplasm. We repeated the PI experiment with R+ and R-cells (not shown, but see Tu et al. (16) and Sun et al. (15)).

IRS-1 Is Required for IGF-1-mediated Nuclear Translocation of {beta}-Catenin—The next question is whether the IGF-1-mediated nuclear translocation of {beta}-catenin requires IRS-1. For this purpose, we used BT20 cells, a breast cancer cell line that does not express IRS-1 (Castles et al. (25)). Fig. 4B shows a confocal microscopy of BT20 cells, either in SFM (upper panels) or after IGF-1 stimulation. The cells were again stained with an antibody to {beta}-catenin and counterstained with PI. The images clearly show that {beta}-catenin in these cells remains cytoplasmic after stimulation with IGF-1. BT20 cells grow slowly but significantly after IGF-1 stimulation.2 Fig. 4A confirms in Western blots that BT20 cells do not express IRS-1 (R+ and R-cells are the positive controls). To confirm the importance of IRS-1 in IGF-1-mediated translocation of {beta}-catenin, we transfected BT20 cells with a plasmid expressing wild type mouse IRS-1 (13). Cells in SFM or 24 h after stimulation with IGF-1, counterstained with PI, were stained with antibodies to either IRS-1 or {beta}-catenin. Fig. 5 shows the results. IRS-1 is now detectable in transfected cells (in the 24-h merged panel, one can see a few untransfected cells that stain only with PI). In some IRS-1-positive cells, IRS-1 is cytoplasmic, which is not unexpected, given the lower than average number of IGF-1Rs in these cells. After IGF-1 stimulation, most of the cells show a nuclear {beta}-catenin. The cells with a cytoplasmic {beta}-catenin could be cells not responding to IGF-1 or untransfected cells.



View larger version (46K):
[in this window]
[in a new window]
  		FIG. 3.
Cytoplasmic localization of IRS-1 and {beta}-catenin in R12 cells. Confocal microscopy of R12 cells stained with antibodies to IRS-1 (upper panels) or {beta}-catenin (lower panels) and counterstained with PI (red). The cells were either in serum-free medium (SFM) or 24 h after IGF-1 stimulation. Both IRS-1 and {beta}-catenin are excluded from the nuclei of R12 cells stimulated with IGF-1.

 
Taken together, these results indicate that {beta}-catenin can be translocated to the nuclei by IGF-1 stimulation, and that IRS-1 plays a crucial role in IGF-1-mediated translocation. Whether IRS-1 must also be nuclear will be taken up later.



View larger version (50K):
[in this window]
[in a new window]
  		FIG. 4.
IGF-1 stimulation does not promote nuclear translocation of {beta}-catenin in the absence of IRS-1. BT20 cells are a breast cancer cell line that does not express IRS-1. This is confirmed in A, a Western blot of whole cell lysates stained with an antibody to IRS-1 (R- and R+ cells are the positive controls). An actin antibody was used to monitor the amount of protein in each lane. B, confocal microscopy of BT20 cells. The cells were stained with an antibody to {beta}-catenin (green) and counterstained with PI (red). {beta}-Catenin remains cytoplasmic even after the serum starved cells are stimulated with IGF-1 (20 ng/ml).

 



View larger version (43K):
[in this window]
[in a new window]
  		FIG. 5.
IRS-1 restores IGF-1-mediated translocation of {beta}-catenin. BT20 cells (see Fig. 4) were transfected in transient with a plasmid expressing wild-type IRS-1. Confocal microscopy was carried out on the transfected cells, all counter-stained with PI (red). In the upper panels, the cells were stained with an antibody to IRS-1; in the lower panels cells were stained with an antibody to {beta}-catenin. IRS-1 moves to the nucleus of most, but not all, cells, and the same can be said for {beta}-catenin. An occasional untransfected cell can be seen in the merged images of both panels.

 
Sequences Required for the Interaction of IRS-1 and {beta}-Catenin—To determine the sequences of IRS-1 that interact with {beta}-catenin, we used GST constructs of IRS-1 (described under "Materials and Methods") and cell lysates from R+ cells. The results of representative experiments are shown in Fig. 6. Fig. 6A shows that {beta}-catenin binds two fragments of IRS-1, the sequence between 601 and 900, and the sequence between residue 900 and the C terminus. IRS-1 is a scaffolding protein, prone to widespread interactions (37) and has at least two binding sites for the regulatory p85 subunit of phosphatidylinositol 3-kinase (38). It is therefore not surprising that IRS-1 binds {beta}-catenin through more than one domain. To identify the sequences of {beta}-catenin binding to IRS-1, we used two mutants of {beta}-catenin, with an N- and a C-terminal deletion, respectively. One mutant has a deletion of residues 1-132, whereas the second mutant has a deletion at the C terminus from residues 695 to 781 (30). These mutants were transfected into R+ cells; lysates were made and immunoprecipitated with an antibody to IRS-1. The results are shown in Fig. 6B. IRS-1 interacts only with the {beta}-catenin mutant that has a deletion of the N-terminal, indicating that the C terminus is the binding site for IRS-1. The antibody used recognized both mutant forms (Fig. 6C). The importance of these interactions was confirmed by Western blots with an antibody to phosphorylated {beta}-catenin. This antibody recognizes phosphorylation at serines 33 and 37 and threonine 41 of {beta}-catenin, which are the targets of glycogen synthase kinase 3{beta} and lead to the eventual degradation of {beta}-catenin itself (39, 40). The antibody recognizes a phosphorylated {beta}-catenin only in R12 cells (Fig. 6D); R+ cells are negative at all stages, indicating that {beta}-catenin is targeted for destruction in R12 cells but not in R+ cells (see "Discussion").



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 6.
Sequences of IRS-1 and {beta}-catenin involved in their interactions. In A, we used GST constructs, expressing specific sequences of IRS-1 (see "Materials and Methods"). The sequences are from 1 to 4, respectively: amino acids 1-315, 300-600, 601-900, and 900 to C terminus. Lane 0 is the empty GST construct. IRS-1 sequences between 601 and 900 and between 900 and the C terminus interact with {beta}-catenin (lysates from R+ cells). The amounts of GST protein used are shown in the lower row of panel A. In panel B, the mutant {beta}-catenin plasmids (see text) were transiently transfected into R+ cells. Lysates from the transfected cells were immunoprecipitated with an antibody to IRS-1 followed by Western blot with an antibody to {beta}-catenin. IRS-1 interacts only with the mutant lacking the amino terminus. C, the antibody to {beta}-catenin recognizes both mutants, Western blot on lysates from transient expression. D, Western blot of lysates from R12 cells and R+ cells at various times after IGF-1 stimulation, using an antibody to the phosphorylated N terminus of {beta}-catenin (see text). In R12 cells, the N terminus is phosphorylated (marked for degradation), whereas R+ cells are negative for the same antibody at any time after IGF-1 stimulation. The protein amounts in each lane were monitored with an antibody to Grb2.

 
Stimulation of {beta}-Catenin Activity by IGF-1—Having established that the IGF/IRS-1 axis can translocate {beta}-catenin to the nuclei, our next goal was to study the effects of these translocations. We asked first whether IGF-1 stimulation increased the activity of {beta}-catenin in MEFs, and whether {beta}-catenin activity may depend on the strength of IGF-1R signaling. We used the TOPFLASH/FLOPFLASH luciferase assay (32), which measures {beta}-catenin-dependent transcription from the Tcf promoter (FLOPFLASH contains a mutant Tcf/Lef promoter and serves as the negative control). We examined the R--derived cells described in Figs. 1 and 2 and two other R--derived cell lines, R-/T cells (that are R-cells expressing the SV40 T antigen) and R508 cells (that have about 13 x 103 IGF-1 receptors/cell). R-, R-/T, R12, and R508 cells are not transformed, do not grow in SFM, and do not respond to IGF-1 with mitosis. However, R508 cells enter S phase, but without dividing, after IGF-1 stimulation (22, 27). R- and R--derived cells were transiently transfected with the appropriate plasmids and the activities were determined as described under "Materials and Methods." Fig. 7 shows the results of separate experiments in which the activity was measured at 8, 16, and 24 h after stimulation with IGF-1. TOPFLASH activity is the same as FLOPFLASH activity in all cell lines, except R+ and R508 cells at 8 and 16 h. In R+ cells, TOPFLASH activity is markedly increased at 16 h, but it is also significantly increased at 8 h. The activity of TOPFLASH in R+ cells returns to base levels at 24 h after IGF-1. In R508 cells, there is a significant increase only at 16 h. These experiments have been repeated several times, with essentially similar results, and are compatible with the observation of Playford et al. (20) that IGF-1 stimulates {beta}-catenin activity in colon cancer cells. The decreased response of R508 and R12 cells suggests that the levels of expression of the IGF-1 receptor may condition the response of {beta}-catenin to IGF-1.

Recruitment of IRS-1, UBF, and {beta}-Catenin to the Cyclin D1 Promoter—To determine whether IRS-1 and {beta}-catenin could both be found in association with the regulatory sequences of {beta}-catenin target genes, like cyclin D1, we studied the recruitment of {beta}-catenin to the cyclin D1 promoter by standard ChIP procedures (33). Sonicated chromatin was also immunoprecipitated with antibodies to UBF and to IRS-1, and the procedure was repeated. The results are shown in Fig. 8, where the cells used were R+ cells in SFM (0 time) or 1, 16, and 24 h after stimulation with IGF-1. The band shown is of the correct size for the selected fragment of the cyclin D1 promoter (see "Materials and Methods"). The main panel shows the results with antibodies to IRS-1, UBF, and {beta}-catenin. IRS-1 is detectable on the cyclin D1 promoter at 16 and 24 h after stimulation with IGF-1. A weak signal is already detectable with {beta}-catenin in unstimulated cells, and it becomes quite clear after 1 h of stimulation, persisting at later hrs. UBF is detectable on the cyclin D1 promoter in cells stimulated with IGF-1 for 16 (weak) and 24 h (strong signal). The GAPDH control was negative. Other controls included immunoprecipitation with an antibody to Grb2 (a cytoplasmic protein, negative) and non-immune serum (not shown, but see Fig. 9 for an illustration). This experiment indicates that IRS-1 and UBF are recruited with {beta}-catenin to the promoter of cyclin D1. The antibody used for UBF cannot distinguish between UBF1 and UBF2. This problem is addressed below.

Recruitment of IRS-1 and {beta}-Catenin to the rDNA Promoter—A promoter strongly activated by IRS-1 is the rDNA promoter (15, 16, 41). The mechanism by which IRS-1 activates the rDNA promoter is, at least in part, due to its participation in a complex with UBF1 (16), one of the proteins that up-regulates RNA polymerase I activity (42). We asked whether IRS-1, {beta}-catenin, and UBF1 are recruited together to the rDNA promoter in R+ cells stimulated with IGF-1. A ChIP assay analogous to the one described above was carried out, using sequences for the mouse rDNA promoter (see "Materials and Methods" for the sequences). It is essential to use the mouse sequences, because RNA polymerase I activity is species-specific, and a human rDNA promoter is inactive in mouse cells (43). As expected (44), UBF is detectable at the rDNA promoter before and after stimulation with IGF-1 (Fig. 9A). IRS-1 is detectable only 16 and 24 h after IGF-1 stimulation, as with the cyclin D1 promoter. {beta}-catenin, with this technology, is not detectable at the rDNA promoter at any time. The controls used included Grb2, non-immune mouse IgG, and non-immune rabbit Ig-G, all negative.

To validate further this result, we used the ChIP assays to assess the presence of IRS-1 in the rDNA promoter of R12 cells, where IRS-1 is cytoplasmic (see above). IRS-1 is no longer detectable on the rDNA promoter, whereas UBF still is (Fig. 9B). The PCR for the GAPDH promoter is negative, except when tested for input. This experiment confirms that the presence of IRS-1 on the rDNA promoter of R+ cells is not an artifact of the procedure.

Transcribed rDNA Spacer—It has been reported that the same proteins that are detectable on the proximal rDNA promoter can also be found in other segments, especially the transcribed spacers, of the rDNA genes (45, 46), suggesting that the same proteins are involved in the synthesis and processing of rRNA. To confirm the previous results on the rDNA promoter, we carried out a ChIP experiment using for PCR primers located on a transcribed spacer of rDNA (Fig. 10, see "Materials and Methods" for the primers). It shows essentially the same results as with the proximal rDNA promoter. This experiment also indirectly confirms the absence of {beta}-catenin from the rDNA genes.



View larger version (14K):
[in this window]
[in a new window]
  		FIG. 7.
Activity of {beta}-catenin in R--derived cells. The TOPFLASH/FOPFLASH plasmids were transfected (in transient) into the designated R--derived cells, R-, R+, R12, R508, and R-/T cells, described in the text. For each cell line, one single aliquot of cells was transfected, then divided into groups that were non-stimulated (serum-free medium) or stimulated with IGF-1 (20 ng/ml) for the indicated times in hours. The data are the average (±S.D.) of three separate transfections. The experiments with R+, R-, and R508 cells were repeated several times with similar results. The experiments with the other two cell lines were repeated only twice. TOPFLASH/FLOPFLASH activity was measured at 8 (upper row), 16 (middle row), and 24 (lower row) h after stimulation with IGF-1. Empty bars are cells stimulated with IGF-1; black bars are cells in serum-free medium.

 



View larger version (36K):
[in this window]
[in a new window]
  		FIG. 8.
IRS-1, {beta}-catenin, and UBF are detectable on the cyclin D1 promoter. Chromatin immunoprecipitation (ChIP) was carried out as described under "Materials and Methods," using the published primers for amplification of the cyclin D1 promoter. The main panel shows the results of experiments in which the sonicated chromatin from R+ cells was immunoprecipitated with antibodies to IRS-1, {beta}-catenin, and UBF. In all instances, the first lane is 0 time (no stimulation with IGF-1), and the second, third, and fourth lanes are from cells stimulated with IGF-1 for 1, 16 and 24 h, respectively. ChIP with GAPDH was negative. Additional controls were done and are described in the text (same as in Fig. 9).

 
Functional Effects of Nuclear Translocation of IRS-1 and {beta}-Catenin—For this purpose, we selected R12 cells, where IRS-1 and {beta}-catenin are cytoplasmic even after stimulation with IGF-1 (see above). We also showed that IRS-1 is not detectable on the rDNA promoter of parental R12 cells (Fig. 10). To test the functional effect on cells, we inserted IRS-1 into an expression plasmid with a nuclear localization signal (see "Materials and Methods") and transfected it into R12 cells. The confocal microscopy image in Fig. 11A, shows that, in R12 cells transfected with the IRS-1/NLS plasmid, IRS-1 and {beta}-catenin are now partially localized in the nuclei. The transfection was done in transient, and the untransfected cells serve as the internal control. We then asked whether IRS-1 would now be detectable on the cyclin D1 promoter. This experiment is shown in Fig. 11 (B and C). In R12 cells expressing an IRS-1 with a NLS, IRS-1 is now detectable on the cyclin D1 promoter (C), whereas it is not detectable in parental R12 cells (B). IRS-1/NLS also became detectable on the rDNA promoter of R12 cells, 16 and 24 h after IGF-1 (D).

The R12 cells expressing the NLS IRS-1 were then tested for the ability of forming colonies in soft agar, which is, at least for MEFs, the best test of transformation. The results of such an experiment are summarized in Fig. 11E. Parental R12 cells form few small colonies, whereas R12 cells expressing the NLS/ IRS-1 form a significant number of colonies in soft agar, indicating that the enforced nuclear localization of IRS-1 causes not only the nuclear translocation of {beta}-catenin but also the transformation of contact-inhibited MEFs. Not shown, for clarity, are R- and p6 cells. R-cells, as usual, did not form colonies in soft agar while the positive controls, p6 cells (22), formed more than 300 colonies/plate.



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 9.
IRS-1 and UBF (but not {beta}-catenin) are detectable on the rDNA promoter. The sonicated chromatin was immunoprecipitated with antibodies to IRS-1, or {beta}-catenin, or UBF. The primers used are described under "Materials and Methods," and they encompass the proximal rDNA promoter of mouse. The cells in panel A were R+ cells, and the numbers above the lanes indicate time in hours: 0, 1, 16, and 24 h after stimulation with IGF-1. UBF is present in the rDNA promoter even at 0 time, whereas IRS-1 makes its appearance only at 16 h after IGF-1. In B, the same experiment is shown with R12 cells, where both IRS-1 and {beta}-catenin are cytoplasmic (see above). In these cells, only UBF can be detected in the rDNA promoter. The control input and the control GAPDH promoter (C) are shown as well as three other controls, in which the sonicated chromatin was immunoprecipitated with an antibody to Grb2 (a cytoplasmic protein) or with mouse or rabbit IgG.

 



View larger version (13K):
[in this window]
[in a new window]
  		FIG. 10.
IRS-1 and UBF are detectable on the transcribed spacer of the rDNA gene. ChIP of a transcribed spacer of the rDNA gene was performed using the primers and the technique given in the text. UBF is detectable at all times, as expected. IRS-1 is detectable only at 16 and 24 h after stimulation of R+ cells with IGF-1 (50 ng/ml). The ChIPs are negative for {beta}-catenin, Grb2, and GAPDH or when the chromatin is immunoprecipitated with mouse or rabbit IgG.

 
Interaction of {beta}-Catenin with IRS-1, UBF1, and UBF2—The experiments described above establish the presence on the cyclin D1 promoter of IRS-1, {beta}-catenin, and a UBF protein and of IRS-1 and a UBF protein on the rDNA promoter. The antibody against UBF commercially available cannot distinguish between UBF1 and UBF2, the latter being a slightly shorter isoform of UBF1 (47, 48). In the case of the rDNA promoter, it should be UBF1, which is known to be involved in rDNA transcription (36). UBF2 is apparently inactive in rDNA transcription (44). On the other hand, Grueneberg et al. (24) have reported that UBF2 interacts with RNA polymerase II as a transcription factor that enhances the {beta}-catenin signaling pathway. The next step was to establish the connection between the IRS-1/{beta}-catenin interaction and the two UBF proteins. For this purpose, we first used R+ cells nuclear extracts. The extracts were immunoprecipitated with an antibody to IRS-1 (Fig. 12A, lanes 1 and 2) or with an antibody to {beta}-catenin (lanes 3 and 4). The Western blots were developed with an antibody to UBF that recognizes both UBFs. UBF2 is shorter than UBF1, and a shorter band can be detected in nuclear extracts immunoprecipitated with an antibody to {beta}-catenin, but not with an antibody to IRS-1. To confirm this result, we used R+ cells stably transfected with either a UBF2 or UBF1 cDNA, tagged with FLAG at the 3'-end (see "Materials and Methods"). We prepared nuclear fractions from which lysates were immunoprecipitated with antibodies to either {beta}-catenin or IRS-1. The blots were developed with an anti-FLAG antibody. The results are shown in Fig. 12B. Antibodies to {beta}-catenin or IRS-1 now immunoprecipitate both UBF1 and UBF2. In previous work, we have shown that the antibody to FLAG is specific on Western blots, but not in immunoprecipitations. Therefore, the reverse experiment, immunoprecipitation with an anti-FLAG antibody, could not be done properly. The discrepancy between panels A and B will be taken up under "Discussion."


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Our novel findings can be summarized as follows: 1) IRS-1 and {beta}-catenin co-immunoprecipitate in both the cytosol and the nucleus of MEFs in an IGF-1-dependent manner. 2) IRS-1 plays a crucial role in IGF-1-mediated nuclear translocation of {beta}-catenin. 3) The role of IRS-1 in IGF-1-mediated nuclear translocation of {beta}-catenin has been confirmed by using a plasmid expressing an IRS-1 with a NLS. In R12 MEFs, in which both proteins are usually located in the cytoplasm (Fig. 3), the fusion protein translocates with {beta}-catenin to the nuclei, and the cells now assume the transformed phenotype (colony formation in soft agar). 4) In ChIP assays, IRS-1, UBF, and {beta}-catenin can be detected on the cyclin D1 promoter, but only UBF and IRS-1 can be found on the rDNA promoter. In the former, IRS-1 and {beta}-catenin associate more with UBF2 than UBF1, whereas on the rDNA promoter, IRS-1 associates mostly with UBF1, a regulatory protein for RNA polymerase I (42). 5) IRS-1 binds to {beta}-catenin with sequences located between amino acid residue 600 and the C terminus. {beta}-Catenin binds to IRS-1 with sequences in the C terminus. We have also confirmed that an activated IGF-1R activates the Tcf/Lef family of proteins and their target genes. These findings will be discussed separately.



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 11.
Confocal microscopy and ChIPs of the cyclin D1 promoter and rDNA promoter of R12 cells transfected with a plasmid expressing an IRS-1 with a NLS. The subcellular localization of IRS-1 and {beta}-catenin in parental R12 cells was shown in Fig. 2. A shows images of R12 cells transfected in transient with a plasmid expressing IRS-1 with an added NLS. Cells were stained with antibodies to either IRS-1 or {beta}-catenin and counterstained with PI. Both IRS-1 and {beta}-catenin are now detectable in the nuclei of cells, 24 h after IGF-1 stimulation. The untransfected cells serve as controls. ChIPs of the cyclin D1 and rDNA promoters are shown in the lower panels. B shows cyclin D1 promoter ChIPs of the parental R12 cells, after immunoprecipitation of the chromatin with an antibody to IRS-1. C and D show the same experiment in R12 cells transfected with the NLS/IRS-1 plasmid. IRS-1 is now detectable on the cyclin D1 and rDNA promoters of R12 cells expressing an IRS-1 with a nuclear localization signal. E shows the number of colonies produced in soft agar by parental R12 cells and of R12 cells stably transfected with a plasmid expressing IRS-1 with a NLS. The methodology is described under "Materials and Methods." The role of IRS-1 in transformation of these cells is confirmed by the effect of IGF-1 addition (closed bars).

 



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 12.
IRS-1 and {beta}-catenin interact with both UBF1 and UBF2. In the upper panel, nuclear extracts from R+ cells were immunoprecipitated with antibodies to IRS-1 (lanes 1 and 2) or {beta}-catenin (lanes 3 and 4), and the blots were developed with an antibody to UBF that recognizes both forms of UBF proteins. The shorter form of UBF (UBF2) is recognizable in nuclear lysates immunoprecipitated with the antibody to {beta}-catenin, but not in lysates immunoprecipitated with an antibody to IRS-1. Purity of nuclear lysates was monitored with antibodies to c-Jun and Grb2. In the lower panels, R+ cells were transiently transfected with plasmids expressing respectively UBF1 and UBF2, tagged with a FLAG epitope. Nuclear extracts were immunoprecipitated with antibodies to IRS-1 (lanes 1-4) or {beta}-catenin (lanes 5-8), and blots were developed with an anti-FLAG antibody. Lanes 1, 2, 5, and 6 are lysates from cells transfected with the UBF1-FLAG construct; lanes 3, 4, 7, and 8 are from cells transfected with the UBF2 FLAG construct. In the absence of FLAG constructs, the Western blots are totally negative for FLAG antibodies (not shown, but shown in previous reports). +, indicates stimulation with IGF-1; -, indicates serum-free medium.

 
Significance of the Interaction—{beta}-Catenin plays a major role in cancer, as pointed out in the introduction. IRS-1 is known to send a strong mitogenic, anti-apoptotic, and anti-differentiation signal. Their interaction provides one mechanism for their effects on cell proliferation. We wish to emphasize that by no means we propose that IRS-1 is the exclusive, or even the main conveyor of {beta}-catenin to the nuclei. Other growth factors and other pathways (2, 49, 50) can cause the translocation of {beta}-catenin to the nuclei. But IRS-1 should be considered as one of the factors that regulate the subcellular localization of {beta}-catenin. The association IRS-1/{beta}-catenin seems to be more important for {beta}-catenin translocation than the activation of the conventional signaling pathway. In R12 cells, IGF-1 induces IRS-1 phosphorylation and activation, all the way up to induction of c-myc (22), yet, with a cytoplasmic IRS-1, {beta}-catenin remains in the cytoplasm.

Recruitment of IRS-1 and {beta}-Catenin to the Cyclin D1 and rDNA Promoters—IRS-1 and {beta}-catenin are found by ChIPs on the cyclin D1 promoter, a well known target of {beta}-catenin (8, 9). UBF2 co-localizes with them on the cyclin D1 promoter, confirming and extending the findings of Grueneberg et al. (24) on the co-operation between {beta}-catenin and UBF2 on the cyclin D1 promoter. Our results suggest that IRS-1 can be added to the activation complex. {beta}-catenin, however, is absent from the rDNA promoter, at least using the methodology described in this report. Although we have used all the conventional controls to validate our ChIP experiments, the best demonstration of their validity is the experiment with R12 cells, in which IRS-1, cytoplasmic in these cells, is not found in association with the rDNA promote (this report). As to the UBF proteins, we favor the possibility that both UBFs are present in either the cyclin D1 or rDNA promoters, despite the fact that direct immunoprecipitation seems to suggest that UBF2 is not detectable in the rDNA promoter. These data with the FLAG-tagged UBFs are, in our opinion, more convincing. The recruitment of IRS-1 to both the cyclin D1 and rDNA promoters may provide an explanation of why IRS-1 can accomplish both cell cycle progression and increase in cell size (51), a role that has also been suggested for c-myc (52).

Effects of the IGF-1R/IRS-1 Axis on {beta}-Catenin—The previous reports that the IGF-1R could activate {beta}-catenin (19-21, 53) have been confirmed in this report. We now show that this is mediated by the IRS-1 interaction with {beta}-catenin that leads to nuclear translocation. This leads in turn to increased {beta}-catenin nuclear activity. IGF-1, however, is not the only growth factor that activates {beta}-catenin, which can also be activated by the epidermal growth factor (54).

IRS-1/{beta}-Catenin Interaction—The interaction between IRS-1 and {beta}-catenin, first detected using our modified TAPtag purification method (10), has been confirmed in this report by co-immunoprecipitation. The interaction occurs both in the cytoplasm and in the nucleus. It was further confirmed by the use of GST constructs for IRS-1 and mutants of {beta}-catenin. The IRS-1 sequences (between residues 600 and the C terminus) binding {beta}-catenin are not the IRS-1 sequences required for its nuclear translocation, which is the PTB domain (17). The sequences interacting with {beta}-catenin contain binding sites for several proteins, such as the p85 subunit of phosphatidylinositol 3-kinase, Grb2, and 14.3.3 (38). In turn, {beta}-catenin binds to IRS-1 with its C terminus, between residues 695 and 781. The C terminus of {beta}-catenin also binds the JC virus T antigen (30). Binding to this sequence may prevent the phosphorylation of the N terminus of {beta}-catenin, an event that causes {beta}-catenin ubiquitination and degradation (2, 4, 55). Alternatively, the IRS-1/{beta}-catenin interaction may protect {beta}-catenin from degradation simply by favoring its nuclear translocation or by inhibiting glycogen synthase kinase 3{beta} (56). The interaction of {beta}-catenin with the JC virus T antigen is particularly interesting, because IRS-1 interacts with the simian homolog of JC virus, the SV40 T antigen in the nucleus (16). It provides an added indication that IRS-1 may participate in complexes with {beta}-catenin.

In conclusion, we have shown that IRS-1 and {beta}-catenin interact in the nuclei of IGF-1-stimulated cells. They are both recruited to the cyclinD1 promoter, a known target of activated {beta}-catenin. IRS-1 by itself (see the experiment with the NLS/IRS-1) can translocate {beta}-catenin to the nuclei of R12 cells, although we are aware that {beta}-catenin translocation to the nuclei can be induced by other conditions, independently of IRS-1 or any signaling from the IGF-1R. In the cyclin D1 promoter, IRS-1 and {beta}-catenin co-operate with the UBF proteins (24). We could not detect {beta}-catenin on the rDNA promoter or a transcribed spacer of the rDNA gene. We propose that IRS-1 (through signaling from the IGF-1R) should be considered among the factors that cause nuclear translocation and activation of {beta}-catenin. The presence of IRS-1 on both the cyclin D1 and rDNA promoters suggests an explanation for the powerful effects of IRS-1 on both mitogenesis (12) and cell size (54).


   FOOTNOTES
 
* This work was supported by Grants CA089640 and AG20956 from the National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

To whom correspondence should be addressed: Kimmel Cancer Center, Thomas Jefferson University, 233 S. 10th St., 624 Bluemle Life Sciences Bldg., Philadelphia, PA 19107. Tel.: 215-503-4507; Fax: 215-923-0249; E-mail: B_lupo{at}mail.jci.tju.edu.

1 The abbreviations used are: IRS-1, insulin receptor substrate-1; UBF1, upstream binding factor 1; IGF-1, insulin-like growth factor, type 1; IGF-1R, IGF-1 receptor; rDNA, ribosomal DNA; MEF, mouse embryo fibroblast; NLS, nuclear localization signal; CMV, cytomegalovirus; IP, immunoprecipitation; GST, glutathione S-transferase; ChIP, chromosomal immunoprecipitation; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; SFM, serum-free media; PI, propidium iodide. Back

2 J. Chen, A. Wu, H. Sun, R. Drakas, C. Garofalo, S. Cascio, E. Surmacz, and R. Baserga, unpublished data. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Nelson, W. J., and Nusse, R. (2004) Science 303, 1483-1487[Abstract/Free Full Text]
  2. Polakis, P. (2000) Genes Dev. 14, 1837-1851[Free Full Text]
  3. Sharpe, C., Lawrence, N., and Arias, A. M. (2001) BioEssays 23, 311-318[CrossRef][Medline] [Order article via Infotrieve]
  4. Gao, Z. H., Seeling, J. M., Hill, V., Jochum, A., and Virshup, D. M. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 1182-1187[Abstract/Free Full Text]
  5. Eastman, Q., and Grosschedl, R. (1999) Curr. Opin. Cell Biol. 11, 233-240[CrossRef][Medline] [Order article via Infotrieve]
  6. Korinek, V., Barker, N., Morin, P. J., van Wichen, D., de Weger, R., Kinzler, K. W., Vogelstein, B., and Clevers, H. (1997) Science 275, 1784-1787[Abstract/Free Full Text]
  7. He, T. C., Sparks, A. B., Rago, C., Hermeking, H., Zawel, L., da Costa, L. T., Morin, P. J., Vogelstein, B., and Kinzler, K. W. (1998) Science 281, 1509-1512[Abstract/Free Full Text]
  8. Rowlands, T. M., Pechenkina, I. V., Hatsell, H. J., Pestell, R. G., and Cowin, P. (2003) Proc. Natl. Acad. Sci. 100, 11400-11405[Abstract/Free Full Text]
  9. Tetsu, O., and McCormick, F. (1999) Nature 398, 422-426[CrossRef][Medline] [Order article via Infotrieve]
  10. Drakas, R., Prisco, M., and Baserga, R. (2005) Proteomics 5, 132-137[CrossRef][Medline] [Order article via Infotrieve]
  11. Baserga, R. (2004) Cell Growth: Control of Cell Size, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 235-263
  12. White, M. F. (1998) Mol. Cell. Biochem. 182, 3-11[CrossRef][Medline] [Order article via Infotrieve]
  13. Valentinis, B., Navarro, N., Zanocco-Marani, T., Edmonds, P., McCormick, J., Morrione, A., Sacchi, A., Romano, G., Reiss, K., and Baserga, R. (2000) J. Biol. Chem. 275, 25451-25459[Abstract/Free Full Text]
  14. Lassak, A., DelValle, L., Peruzzi, F., Wang, J. Y., Enam, S., Croul, S., Khalili, K., and Reiss, K. (2002) J. Biol. Chem. 277, 17231-17238[Abstract/Free Full Text]
  15. Sun, H., Tu, X., Prisco, M., Wu, A., Casiburi, I., and Baserga, R. (2003) Mol. Endocrinol. 17, 472-486[Abstract/Free Full Text]
  16. Tu, X., Batta, P., Innocent, N., Prisco, M., Casaburi, I., Belletti, B., and Baserga, R. (2002) J. Biol. Chem. 277, 44357-44365[Abstract/Free Full Text]
  17. Prisco, M., Santini, F., Baffa, R., Liu, M., Drakas, R., Wu, A., and Baserga, R. (2002) J. Biol. Chem. 277, 32078-32085[Abstract/Free Full Text]
  18. Morelli, C., Garofalo, C., Sisci, D., del Rincon, S., Cascio, S., Tu, X., Vecchione, A., Sauter, E. R., Miller, W. H., Jr., and Surmacz, E. (2004) Oncogene 23, 7517-7526[CrossRef][Medline] [Order article via Infotrieve]
  19. Morali, O. G., Delmas, V., Moore, R., Jeanney, C., Thiery, J. P. and Larne, L. (2001) Oncogene 20, 4942-4950[CrossRef][Medline] [Order article via Infotrieve]
  20. Playford, M. P., Bicknell, D., Bodmer, W. F., and Macaulay, V. M. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 12103-12108[Abstract/Free Full Text]
  21. Satiamoorthy, K., Li, G., Vaidya, B., Patel, D., and Herlyn, M. (2001) Cancer Res. 61, 7318-7324[Abstract/Free Full Text]
  22. Reiss, K., Valentinis, B., Tu, X., Xu, S. Q., and Baserga, R. (1998) Exp. Cell Res. 242, 361-372[CrossRef][Medline] [Order article via Infotrieve]
  23. Surmacz, E., Reiss, K., Sell, C., and Baserga, R. (1992) Cancer Res. 52, 4522-4525[Abstract/Free Full Text]
  24. Grueneberg, D. A., Pablo, L., Hu, Q., August, K, P., Weng, Z., and Papkoff, J. (2003) Mol. Cell. Biol. 23, 3936-3950[Abstract/Free Full Text]
  25. Castles, G. C., Fuqua, S. A. Klotz, D. M., and Hill, S. M. (1993) Cancer Res. 53, 5934-5939[Abstract/Free Full Text]
  26. Liu, J.-P., Baker, J., Perkins, A. S., Robertson, E. J., and Efstratiadis, A. (1993) Cell 75, 59-72[Medline] [Order article via Infotrieve]
  27. Rubini, M., Hongo, A., D'Ambrosio, C., and Baserga, R. (1997) Exp. Cell Res. 230, 284-292[CrossRef][Medline] [Order article via Infotrieve]
  28. Sell, C., Rubini, M., Rubin, R., Liu, J.-P., Efstratiadis, A., and Baserga, R. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 11217-11221[Abstract/Free Full Text]
  29. Maiorana, A., Tu, X., Cheng, G., and Baserga, R. (2004) Oncogene 23, 7116-7124[CrossRef][Medline] [Order article via Infotrieve]
  30. Gan, D. D., and Khalili, K. (2004) Oncogene 23, 483-490[CrossRef][Medline] [Order article via Infotrieve]
  31. Wu, A., Tu, X., Prisco, M., and Baserga, R. (2005) J. Biol. Chem. 280, 2863-2872[Abstract/Free Full Text]
  32. Persad, S., Troussard, A. A., McPhee, T. R., Mulholland, D. J., and Dedhar, S. (2001) J. Cell Biol. 153, 1161-1173[Abstract/Free Full Text]
  33. Shang, Y., Hu, X., DiRenzo, J., Lazar, M. A., and Brown, M. (2000) Cell 103, 843-852[CrossRef][Medline] [Order article via Infotrieve]
  34. Kirmizis, A., Bartley, S. M., and Farnham, P. J. (2003) Mol. Cancer Ther. 2, 113-121[Abstract/Free Full Text]
  35. James, M. J., and Zomerdijk, J. C. B. M. (2004) J. Biol. Chem. 279, 8911-8918[Abstract/Free Full Text]
  36. Voit, R., Kuhn, A., Sander, E. E., and Grummt, I. (1995) Nucleic Acids Res. 23, 2593-2599[Abstract/Free Full Text]
  37. Service, R. F. (2005) Science 307, 1054-1055[Abstract/Free Full Text]
  38. Sun, X. J., Rothenberg, P. L., Kahn, C. R., Backer, J. M., Araki, E., Wilden, P. A., Cahill, D. A., Goldstein, B. J., and White, M. F. (1991) Nature 35, 73-77
  39. Henderson, B. R., and Fagotto, F. (2002) EMBO Rep. 3, 834-839[CrossRef][Medline] [Order article via Infotrieve]
  40. Wang, Z., Vogelstein, B., and Kinzler, K. W. (2003) Cancer Res. 63, 5234-5235[Abstract/Free Full Text]
  41. Drakas, R., Tu, X., and Baserga, R. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 9272-9276[Abstract/Free Full Text]
  42. Grummt, I. (2003) Genes & Dev. 17, 1691-1702[Free Full Text]
  43. Croce, C. M., Talavera, A., Basilico, C., and Miller, O. J. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 694-697[Abstract/Free Full Text]
  44. Grummt, I. (1999) Progr. Nucleic Acids Res. Mol. Biol. 62, 109-153[Medline] [Order article via Infotrieve]
  45. O'Sullivan, A. C., Sullivan, G. J., and McStay, B. (2002) Mol. Cell. Biol. 22, 657-668[Abstract/Free Full Text]
  46. Poortinga, G., Hannan, K. M., Snelling, H., Walkley, C. R., Jenkins, A., Sharkey, K., Wall, M., Brandenburger, Y., Palatsides, M., Pearson, R. B., McArthur, G. A., and Hannan, R. D. (2004) EMBO J. 23, 3325-3335[CrossRef][Medline] [Order article via Infotrieve]
  47. Jantzen, H. M., Admon, A., Bell, S. P., and Tjian, R. (1990) Nature 344, 830-836[CrossRef][Medline] [Order article via Infotrieve]
  48. O'Mahony, D. J., and Rothblum, L. I. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 3180-3184[Abstract/Free Full Text]
  49. vanNoort, M., and Clevers, H. (2002) Dev. Biol. 244, 1-8[CrossRef][Medline] [Order article via Infotrieve]
  50. Veeman, M. T., Axelrod, J. T., and Moon, R. T. (2003) Dev. Cell 5, 367-377[CrossRef][Medline] [Order article via Infotrieve]
  51. Hall, M. N., Raff, M., and Thomas, G. (eds) (2004) Cell Growth: Control of Cell Size, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  52. Oskarsson, T., and Trumpp, A. (2005) Nat. Cell Biol. 7, 215-217[CrossRef][Medline] [Order article via Infotrieve]
  53. Desbois-Mouthon, C., Cadoret, A., Blivet-van Heggelpoe, M. J., Bertrand, F., Cherqui, G., Perret, C., and Capeau, J. (2001) Oncogene 20, 252-259[CrossRef][Medline] [Order article via Infotrieve]
  54. Lu, Z., and Hunter, T. (2004) Cell Cycle 35, 571-573
  55. Zhou, B. P., Deng, J., Xia, W., Xu, J., Li, Y. M., Gunduz, M., and Hung, M. C. (2004) Nat. Cell Biol. 6, 931-940[CrossRef][Medline] [Order article via Infotrieve]
  56. Aberle, H., Bauer, A, Stappert, J., Kispert, A., and Kemler, R. (1997) EMBO J. 16, 3797-3804[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Cancer Res.Home page
S. Avnet, L. Sciacca, M. Salerno, G. Gancitano, M. F. Cassarino, A. Longhi, M. Zakikhani, J. M. Carboni, M. Gottardis, A. Giunti, et al.
Insulin Receptor Isoform A and Insulin-like Growth Factor II as Additional Treatment Targets in Human Osteosarcoma
Cancer Res., March 15, 2009; 69(6): 2443 - 2452.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
R. Vuononvirta, N. J. Sebire, A. R. Dallosso, J. S. Reis-Filho, R. D. Williams, A. Mackay, K. Fenwick, A. Grigoriadis, A. Ashworth, K. Pritchard-Jones, et al.
Perilobar Nephrogenic Rests Are Nonobligate Molecular Genetic Precursor Lesions of Insulin-Like Growth Factor-II-Associated Wilms Tumors
Clin. Cancer Res., December 1, 2008; 14(23): 7635 - 7644.
[Abstract] [Full Text] [PDF]

Home page
 DevelopmentHome page
S. R. Parathath, L. A. Mainwaring, A. Fernandez-L, D. O. Campbell, and A. M. Kenney
Insulin receptor substrate 1 is an effector of sonic hedgehog mitogenic signaling in cerebellar neural precursors
Development, October 1, 2008; 135(19): 3291 - 3300.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Prevention ResearchHome page
M. Shimizu, Y. Shirakami, H. Sakai, S. Adachi, K. Hata, Y. Hirose, H. Tsurumi, T. Tanaka, and H. Moriwaki
(-)-Epigallocatechin Gallate Suppresses Azoxymethane-Induced Colonic Premalignant Lesions in Male C57BL/KsJ-db/db Mice
Cancer Prevention Research, September 1, 2008; 1(4): 298 - 304.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
A. Giustina, G. Mazziotti, and E. Canalis
Growth Hormone, Insulin-Like Growth Factors, and the Skeleton
Endocr. Rev., August 1, 2008; 29(5): 535 - 559.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
P. E. Dube, K. J. Rowland, and P. L. Brubaker
Glucagon-Like Peptide-2 Activates -Catenin Signaling in the Mouse Intestinal Crypt: Role of Insulin-Like Growth Factor-I
Endocrinology, January 1, 2008; 149(1): 291 - 301.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
N. M. Ramocki, H. R. Wilkins, S. T. Magness, J. G. Simmons, B. P. Scull, G. H. Lee, K. K. McNaughton, and P. K. Lund
Insulin Receptor Substrate-1 Deficiency Promotes Apoptosis in the Putative Intestinal Crypt Stem Cell Region, Limits Apcmin/+ Tumors, and Regulates Sox9
Endocrinology, January 1, 2008; 149(1): 261 - 267.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Pathol.Home page
D. Sisci, C. Morelli, C. Garofalo, F. Romeo, L. Morabito, F. Casaburi, E. Middea, S. Cascio, E. Brunelli, S. Ando, et al.
Expression of nuclear insulin receptor substrate 1 in breast cancer
J. Clin. Pathol., June 1, 2007; 60(6): 633 - 641.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
O. Dalmizrak, A. Wu, J. Chen, H. Sun, F. E. Utama, D. Zambelli, T. H. Tran, H. Rui, and R. Baserga
Insulin Receptor Substrate-1 Regulates the Transformed Phenotype of BT-20 Human Mammary Cancer Cells
Cancer Res., March 1, 2007; 67(5): 2124 - 2130.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
R. K. Dearth, X. Cui, H.-J. Kim, I. Kuiatse, N. A. Lawrence, X. Zhang, J. Divisova, O. L. Britton, S. Mohsin, D. C. Allred, et al.
Mammary Tumorigenesis and Metastasis Caused by Overexpression of Insulin Receptor Substrate 1 (IRS-1) or IRS-2
Mol. Cell. Biol., December 15, 2006; 26(24): 9302 - 9314.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
V. Rider, K. Isuzugawa, M. Twarog, S. Jones, B. Cameron, K. Imakawa, and J. Fang
Progesterone initiates Wnt-{beta}-catenin signaling but estradiol is required for nuclear activation and synchronous proliferation of rat uterine stromal cells
J. Endocrinol., December 1, 2006; 191(3): 537 - 548.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
R. Natrajan, J. S. Reis-Filho, S. E. Little, B. Messahel, M.-A. Brundler, J. S. Dome, P. E. Grundy, G. M. Vujanic, K. Pritchard-Jones, and C. Jones
Blastemal Expression of Type I Insulin-Like Growth Factor Receptor in Wilms' Tumors Is Driven by Increased Copy Number and Correlates with Relapse
Cancer Res., December 1, 2006; 66(23): 11148 - 11155.
[Abstract] [Full Text] [PDF]

Home page
 Genes Dev.Home page
K. Willert and K. A. Jones
Wnt signaling: is the party in the nucleus?
Genes & Dev., June 1, 2006; 20(11): 1394 - 1404.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/33/29912    most recent
M504516200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, J.
Right arrow Articles by Baserga, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, J.
Right arrow Articles by Baserga, R.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement