JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M414600200 on June 13, 2005

J. Biol. Chem., Vol. 280, Issue 33, 29929-29936, August 19, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/33/29929    most recent
M414600200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, F. Y.-I.
Right arrow Articles by Lee, H.-J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, F. Y.-I.
Right arrow Articles by Lee, H.-J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

µ-Calpain Regulates Receptor Activator of NF-{kappa}B Ligand (RANKL)-supported Osteoclastogenesis via NF-{kappa}B Activation in RAW 264.7 Cells*

Francis Young-In Lee{ddagger}, Dae-Won Kim{ddagger}, Jaime A. Karmin{ddagger}, Daewha Hong{ddagger}, Seong-Sil Chang{ddagger}, Motoyuki Fujisawa{ddagger}, Hiroshi Takayanagi§, Louis U. Bigliani{ddagger}, Theodore A. Blaine{ddagger}, and Hahn-Jun Lee{ddagger}

From the {ddagger}Center for Orthopaedic Research, Department of Orthopaedic Surgery, College of Physicians and Surgeons, Columbia University, New York, New York 10032 and the §Department of Cellular Physiological Chemistry, Graduate School, Tokyo Medical and Dental University and COE Program for Frontier Research on Molecular Destruction and Reconstruction of Tooth and Bone, Yushima 1-5-45, Bunkyo-ku, Tokyo 113-8549, Japan

Received for publication, December 27, 2004 , and in revised form, May 5, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To clarify the role of calpain in the receptor activator of NF-{kappa}B ligand (RANKL)-supported osteoclastogenesis, RANKL-induced calpain activation was examined by using murine RAW 264.7 cells and bone marrow-derived monocyte/macrophage progenitors. We found that calpain activity increased in response to RANKL in both cell types based on {alpha}-spectrinolysis and that µ-calpain, rather than m-calpain, was activated during RANKL-supported osteoclastogenesis in RAW 264.7 cells. Overexpression of µ-calpain clearly augmented RANKL-supported osteoclastogenesis in RAW 264.7 cells, thereby implicating its pivotal role in this process. Cell-permeable calpain inhibitors, including calpastatin and calpeptin, were sufficient to suppress RANKL-supported osteoclastogenesis based on decreased expression of the osteoclastogenic marker, matrix metalloproteinase 9, and the generation of tartrate-resistant acid phosphatase-positive multinucleated cells in both cell types. Calpain inhibitors suppressed NF-{kappa}B activation via inhibition of the cleavage of inhibitor of NF-{kappa}B(I{kappa}B{alpha})in RAW 264.7 cells. Taken together, our findings suggest that µ-calpain is essential to the regulation of RANKL-supported osteoclastogenesis via NF-{kappa}B activation.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bone is a specialized organ that provides invaluable benefits such as support, locomotion, bone marrow, electrolytes, and protection of internal organs. Bone remodels in a constant manner throughout the life span, and its homeostasis is delicately maintained via bone resorption by osteoclasts and bone formation by osteoblasts (1, 2). Hence, the balancing of these two processes is a necessary prerequisite to the maintenance of normal bone condition. On the other hand, unbalanced bone homeostasis may lead to severe bone defects, such as osteoporosis or osteopetrosis.

Osteoclasts are multinucleated cells, derived from hematopoietic myeloid precursors of monocyte/macrophage lineage, which express the receptor activator of NF-{kappa}B (RANK).1 These cells are tightly regulated by systemic or local factors, such as RANKL, which is generated by osteoblasts and bone marrow stromal cells in response to various stimuli, including vitamin D3, parathyroid hormone, TNF-{alpha}, thyroid hormone, lipopolysaccaride, IL-1, IL-11, histamine, fibroblast growth factor-2, insulin-like growth factor-1, and CpGpDNA (3-9).

Interaction between RANKL and RANK initiates various signaling pathways by recruiting TNF receptor-associated factors 1-3, 5, and 6. TNF receptor-associated factor plays a key role in mediating various extracellular signals that lead to osteoclastogenesis and eventually bone resorption (10, 11). Previous studies have shown that knock-out mice devoid of either the RANKL gene or its receptor RANK gene show severe osteopetrosis, thereby highlighting their importance in osteoclastogenesis (12, 13).

It has been suggested that calpain, a calcium-dependent intracellular cysteine protease, plays a major role in various cellular processes in mammals, such as signal transduction, cell growth, differentiation and fusion, apoptosis, necrosis, etc. (14). Calpain is composed of a superfamily with 14 known members and can be divided into ubiquitous and tissue-specific isozymes in mammals (15). Structurally, ubiquitous µ- and m-calpains are heterodimers with an identical small subunit (30K) and different large subunits (80K) sharing 55-65% similarity (16).

Calpain executes limited proteolysis of its own substrates and is considered a modulator of various intracellular signaling pathways (14, 15). For instance, calpain is known to degrade I{kappa}B{alpha}, c-Jun, and c-Fos in vitro, all of which are essential molecular players in osteoclastogenesis (17-19). Therefore, calpain may play a master role in the regulation of osteoclastogenesis through limited proteolysis of these molecules.

Uncontrolled calpain activity resulting from altered calcium homeostasis often leads to irreversible damage to cells, as exemplified in myocardial infarction, stroke, and brain ischemia (20-23). Therefore, it is tightly regulated by an endogenous inhibitor, calpastatin (24). Although it has been suggested that the calpain-calpastatin system is involved in pre-osteoblastic proliferation and differentiation (25), its function in the regulation of RANKL-supported osteoclastogenesis remains unclear. To date, it has been only weakly suggested to play a part in implant particle-induced osteoclastogenesis (26).

Clarifying the role of calpain in RANKL-supported osteoclastogenesis may shed light on the development of a novel therapeutic intervention(s) that can arrest bone resorption. In the present study, the role of calpain in the regulation of RANKL-supported osteoclastogenesis was therefore examined by using a murine RAW 264.7 cellular system and/or bone marrow-derived macrophage/monocyte progenitors capable of differentiating into multinucleated osteoclasts in the presence of RANKL and/or M-CSF. Here we report that µ-calpain regulates RANKL-supported osteoclastogenesis. It should be noted that this is the first report to demonstrate the role of calpain in the regulation of RANKL/RANK signaling.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—Murine macrophage-like RAW 264.7 cells were purchased from the American Type Culture Collection (ATCC) (Manassas, VA). RAW 264.7 cells were maintained in Dulbecco's modified Eagle's medium, also purchased from the ATCC, containing sodium bicarbonate (1.5 g/liter), L-glutamine (4 mM), glucose (4.5 g/liter), penicillin (100 units/ml), streptomycin (0.1 mg/ml), and 10% fetal bovine serum (FBS) (Invitrogen). Bone marrow monocyte/macrophage (BMMs) lineage progenitors were collected from the femur and tibia of 4-5-week-old C57BL/6J mice and cultured in {alpha}-minimum Eagle's medium supplemented with L-glutamine (4 mM), penicillin (100 units/ml), streptomycin (0.1 mg/ml), murine M-CSF (10 ng/ml) (R & D Systems, Minneapolis, MN), and 20% heat-inactivated FBS (Invitrogen). Cells were cultured in 6-well plates and incubated at 37 °C in a humidified atmosphere of 5% CO2. Culture media were changed every other day.

In Vitro Osteoclastogenesis—RAW 264.7 cells were cultured in 6-well plates for 7 days in a medium containing RANKL (20 ng/ml) (R & D Systems). RANKL (20 ng/ml) was also added to BMMs (2 x 105) cultured in 6-well plates with {alpha}-minimum Eagle's medium containing M-CSF (10 ng/ml). To determine whether calpain is involved in RANKL-supported osteoclastogenesis, media containing cell-permeable calpain inhibitors, including calpastatin peptide (1 µM) and calpeptin (5 µM) (Calbiochem), were added to each well in the presence of RANKL and/or M-CSF. On day 7, TRAP staining was performed to evaluate TRAP(+)-multinucleated osteoclast formation. Protein was also extracted to compare the expression of osteoclastogenic markers on immunoblotting as described later. For statistical evaluation, each experiment was repeated four times independently.

Plasmids and Transfection—Human full-length µ-calpain cDNA in pSRD (1.5 µg) and human calpain small subunit cDNA in pcDNA3.1 (1.5 µg) (kindly provided by Dr. Hiroyuki Sorimachi, University of Tokyo, Japan) were co-transfected into RAW 264.7 cells (5 x 105)in the presence or absence of RANKL using Superfect (Qiagen, Valencia, CA). To examine whether calpain augments RANKL-supported osteoclastogenesis, RAW 264.7 cells were pre-cultured with media containing RANKL (20 ng/ml) for 2 days. On day 3, each cDNA was transfected to evaluate augmentation of osteoclastogenesis by calpain. Four days after transfection, cells were stained to evaluate TRAP(+)-multinucleated osteoclast formation. To compare the expression of other osteoclastogenic markers, protein was extracted. For statistical evaluation, each experiment was repeated six times independently.

Mouse TRAP Enzyme-linked Immunosorbent Assay—The amount and activity of tartrate-resistant acid phosphatase form 5b (TRAP5b) in the conditioned media were analyzed with a mouse TRAP assay kit (SBA Sciences, Turku, Finland) according to the manufacturer's instructions. Briefly, 100 µl of standard TRAP and conditioned medium were added to each well pre-coated with monoclonal antibody against mouse TRAP5b. Then 25 µl of releasing agent was added to each well and incubated for 1 h at room temperature on a horizontal orbital microplate shaker at 950 rpm. Each well was washed three times with 300 µl of 1x washing buffer. After washing, 100 µl of substrate solution was added to each well, mixed thoroughly, and incubated for 2 h at 37 °C. Finally, 25 µl of stop solution was added to each well, and the absorbance was measured at 405 nm. For statistical evaluation, each experiment was repeated four times independently.

TRAP Staining—After 7 days of culturing, RANKL and/or M-CSF-treated RAW 264.7 cells and/or BMMs were fixed with a solution containing acetone and citrate for 30 s and washed twice with double distilled water. TRAP staining was performed with a kit purchased from Sigma according to the manufacturer's instructions. TRAP(+) cells with four or more nuclei were scored as multinucleated osteoclasts under light microscopy. For statistical evaluation, cell counting was done using four different fields of view and was repeated four times.

TRAP Promoter Assay—The reporter plasmid, pTRAP-Luc, containing a 1.85-kb KpnI-BglII fragment of the mouse TRAP promoter (kindly provided by Dr. Hiroshi Takayanagi, Tokyo Medical and Dental University, Tokyo, Japan) was transfected into RAW 264.7 cells using Superfect (Qiagen). Three hours after transfection, RANKL and/or calpain inhibitors were added to the cells. Luciferase activity was examined 24 h after treatment by using a luciferase activity assay kit (Promega, Madison, WI). For statistical evaluation, each experiment was repeated four times independently.

Immunoblotting—RAW 264.7 cells and BMMs treated with RANKL and/or M-CSF in conjunction with calpain inhibitors were harvested at 1,200 x g and suspended with 100 µl of lysis buffer containing Tris/Cl, pH 7.4 (10 mM), NaCl (150 mM), 1% Triton X-100, 0.25% Nonidet P-40, and EDTA (2 mM) and supplemented with a protease inhibitor mixture tablet (Roche Diagnostics). Cells were then incubated on ice for 30 min. After centrifugation at 15, 000 x g for 15 min at 4 °C, supernatants were collected, and the amount of protein was quantified. Equal amounts of protein were mixed with 2x SDS sample buffer and directly subjected to electrophoresis on a 4-20% BisTris glycine gel (Invitrogen). Separated proteins were transferred to a polyvinylidene difluoride membrane (Bio-Rad) and incubated with the following antibodies: cathepsin K (Calbiochem), {alpha}(II)-spectrin (Biomol, Plymouth Meeting, PA), {alpha}-actin (Sigma), µ- and m-calpains (Triple Point Biologics Inc., Forest Grove, OR), I{kappa}B{alpha} (C21) (Santa Cruz Biotechnology), and MMP9 (Sigma).

In Vitro I{kappa}B{alpha} Cleavage—Murine RAW 264.7 cells (9 x 104) cultured in a 6-well plate with Dulbecco's modified Eagle's medium containing 10% FBS were treated with recombinant RANKL (20 ng/ml) (R & D Systems) in a time-dependent manner to confirm that RANKL-induces I{kappa}B{alpha} cleavage. Cell-permeable calpain inhibitors, including calpeptin (5 µM) and ALLM (1 µM), were added to the media in the presence of RANKL to verify that calpain inhibition decreases RANKL-induced I{kappa}B{alpha} cleavage. The cells were also subjected to a proteasome inhibitor, MG132 (1 µM). Each cell was then divided into cytoplasmic and nuclear fractions using a nuclear extract kit (Active Motif, Carlsbad, CA) according to the manufacturer's instructions. The cytoplasmic fractions were subjected to immunoblot for detection of decreased I{kappa}B{alpha}. Each band was quantified using NIH Image. For statistical evaluation, each experiment was repeated four times independently.

Calpain Activity Assay—Murine RAW 264.7 cells (9 x 104) were cultured in media containing RANKL (0, 5, 20, and 50 ng/ml) (R & D Systems) in a 6-well plate. The media were changed every other day. On day 7, conditioned media were examined for TRAP activity. At the same time, the cytoplasmic fractions were used to measure calpain activity with a calpain activity assay kit (Biovision, Mountain View, CA) according to the manufacturer's instructions. Cells were harvested at 1,200 x g and lysed with extraction buffer provided by the manufacturer. Cell lysates were centrifuged at 12,000 x g at 4 °C for 10 min, and the supernatants were collected. After quantification of protein in the supernatant, 50 µg of protein was used for the calpain activity assay with Ac-LLY-AFC, a fluorescent calpain substrate. Recombinant human m-calpain and calpastatin were used for positive and negative controls, respectively. The samples were read in a fluorometer equipped with 400-nm excitation and 505-nm emission filters. For statistical evaluation, each experiment was repeated four times.

Pathway Profiling SEAP Assay—A MercuryTM pathway profiling system (BD Biosciences) was used to confirm signaling pathways affected by calpastatin in murine RAW 264.7 cells. 1 µg of each reporter plasmid (TAL-SEAP (negative control), pSEAP2 (positive control), and pNF-{kappa}B-SEAP) was transfected into the cells (9 x 104) by using Superfect (Qiagen). Transfection efficiency for each plasmid was calibrated with the positive control. After transfection, media containing 10% serum were changed to media containing 0.5% serum in order to minimize any background. Twelve hours later, 1 µM of calpastatin peptide (Calbiochem) was added to the cells in the presence of RANKL (20 ng/ml) (R & D Systems). Twenty four hours after treatment with calpastatin peptide, conditioned media were subjected to a SEAP assay using a Great EscAPe SEAP chemiluminescence detection kit (BD Biosciences) according to the manufacturer's instructions. For statistical evaluation, each experiment was repeated three times independently.

Real Time RT-PCR—Total RNA was isolated from RAW 264.7 cells treated with RANKL by using an RNeasy mini kit (Qiagen) according to the manufacturer's instructions. Single-stranded cDNA was synthesized with 0.2 µg of total RNA using an Omniscript reverse transcription kit (Qiagen) with oligo(dT)20 (Invitrogen). Real time RT-PCR for each target was performed with Light Cycler Fast Start DNA Master SYBR Green I (Roche Diagnostics) using a Smart Cycler® system (Cepheid, Sunnyvale, CA). Primers were designed on the basis of mouse GAPDH (GenBankTM accession number NM_001001303), m-calpain (GenBankTM accession number NM_009794 [GenBank] ), and µ-calpain (Gen-BankTM accession number NM_007600 [GenBank] ) as follows: 1) 5'-GAPDH, AGAACATCATCCCTGCATCC; 2) 3'-GAPDH, AGTTGCTGTTGAAGTCGC; 3) 5'-µCAPN, GCATGAGTGCCTATGAGATGAG; 4) 3'-µCAPN, AGAATGGAAGAACAAAGGCAA; 5) 5'-mCAPN, AACGCCAAGACATCAAGTC; and 6) 3'-mCAPN, TCAAAGTCGATGATTAGCTCG.

Statistical Analyses—Statistical analyses were performed with the Statistical Package for the Social Sciences (SPSS) software (version 10) (SPSS, Chicago, IL). Differences between treated and control groups were analyzed with the t test or the Scheffe test in a one-way analysis of variance, and a p value of less than 0.01 was considered significant. Data are expressed as mean ± S.D. unless otherwise indicated.



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 1.
RANKL induces an increase in the cleavage of {alpha}(II)-spectrin. RANKL (50 or 100 ng/ml) treatment for 5 or 7 days induced an increase in cleavage of {alpha}(II)-spectrin in RAW 264.7 cells (A) or BMM progenitors (B). {alpha}(II)-spectrin cleavage in the presence of RANKL decreased with calpastatin (2 µM/ml) in RAW 264.7 cells (A) or BMMs (B), which suggested that calpain activation in response to RANKL is inhibited. Arrows denote full-length (FL) and breakdown product (BP) of {alpha}(II)-spectrin. Black triangle indicates GAPDH (loading control). No TMT, no treatment; RL, RANKL; CPST, calpastatin.

 



View larger version (53K):
[in this window]
[in a new window]
  		FIG. 2.
RANKL induces an increase in both calpain and TRAP activities in RAW 264.7 cells. A-1, RANKL treatment (0, 5, 20, and 50 ng/ml) for 7 days increased both calpain and TRAP activities in a dose-dependent manner. Each of the samples shown A-2 was used for calpain and TRAP activity assays. TRAP and calpain activities were indicated as units/liter (units/liter) and relative fluorescence unit (RFU)/mg of protein, respectively. Results are expressed as the mean ± S.D. of four independent experiments. A-2, RANKL treatment for 7 days induced the generation of fully differentiated osteoclasts. B-1, RANKL decreased immature µ-calpain judging from immunoblot with specific antibody capable of detecting its extreme N-terminal region. In contrast, m-calpain did not show such changes in response to RANKL. {alpha}-Actin was used for a loading control. B-2, real time RT-PCR showed that levels of µ- and m-calpain mRNA were unchanged in response to RANKL.

 

   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
{alpha}(II)-Spectrinolysis Suggested Calpain Activation in Response to RANKL—Although it has been suggested that calpain is activated by TNF-{alpha}, the role of calpain in the regulation of RANKL-supported osteoclastogenesis is not well understood. Therefore, calpain activation in response to RANKL was examined based on {alpha}(II)-spectrinolysis in a murine macrophage RAW 264.7 cellular system. By using this method, calpain activation can be readily detected by the proteolysis of full-length {alpha}(II)-spectrin (240 kDa), a well known calpain substrate, to its breakdown product (150 kDa). As shown in Fig. 1A, the continuous addition of RANKL to RAW 264.7 cells for 7 days increased the amount of {alpha}(II)) spectrin breakdown product, suggesting that calpain was activated in response to RANKL. In contrast, the cell-permeable calpastatin peptide decreased the level of {alpha}(II)) spectrin breakdown product, suggesting that calpastatin suppresses RANKL-induced calpain activation in RAW 264.7 cells.



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 3.
Calpain inhibitor decreases RANKL-supported osteoclastogenesis in RAW 264.7 cells. A-1, calpain inhibitors, including calpastatin (1 µM) and calpeptin (5 µM), were sufficient to suppress the generation of TRAP(+)-multinucleated cells in murine RAW 264.7 cells. Images of both TRAP(+)-mononuclear and multinucleated cells were obtained after 7 days of treatment (original magnification, x100). The representative pictures were chosen for comparison. Each arrow indicates a TRAP(+)-multinucleated cell. A-2, TRAP(+)-multinucleated cells were counted under a microscope, and cells with four or more nuclei with TRAP(+) staining were counted as TRAP(+)-multinucleated cells. Count was performed with four different fields for each sample. Results are expressed as the mean ± S.D. of four independent experiments. **, significantly different between calpain inhibitor-treated and -untreated samples; p < 0.01. B, calpain inhibitors in the presence of RANKL suppressed the expression of the osteoclastogenic marker, MMP9. No TMT, no treatment; RL, RANKL; CPT, calpeptin; CPST, calpastatin. Black triangles indicate MMP9 and {alpha}-actin (loading control). C, activation of the TRAP promoter by RANKL was inhibited by calpain inhibitors, including calpastatin, calpeptin, and ALLM. Results are expressed as the mean ± S.D. of four independent experiments. **, significantly different between calpain inhibitor-treated and -untreated samples; p < 0.01.

 
To confirm whether RANKL-induced calpain activation also occurs in normal pre-osteoclasts, RANKL was added to cultured BMM progenitors, which were obtained from C57BL/6J mice, for 5 days in the presence of M-CSF. As shown in Fig. 1B, the amount of {alpha}(II)) spectrin breakdown product (150 kDa) increased, suggesting that calpain activation in response to RANKL indeed occurs in normal pre-osteoclasts. Calpastatin peptide also decreased the level of {alpha}(II)) spectrin breakdown product, suggesting that calpastatin suppresses RANKL-induced calpain activation in normal pre-osteoclasts.

Calpain Activity Increased in a RANKL-dependent Manner in RAW 264.7 Cells—To examine further calpain activation in response to RANKL, calpain activity was assayed with synthetic Ac-LLY-AFC, a fluorescent calpain substrate, using RAW 264.7 cell lysates treated with RANKL. Various concentrations of RANKL (0, 5, 20, and 50 ng/ml) were added to the cells every other day and were allowed to incubate for 7 days to generate fully differentiated, multinucleated osteoclasts as shown in Fig. 2A-2.

The temporal correlation between osteoclastogenic markers and increased endogenous calpain activity in response to RANKL provided an important clue that calpain is involved in the regulation of RANKL-supported osteoclastogenesis. Therefore, we examined changes in calpain and TRAP activities by using supernatants and media from RANKL-treated and -untreated RAW 264.7 cells.

As shown in Fig. 2A-1, calpain and TRAP activities simultaneously increased in a RANKL-dependent manner. These results suggested that calpain is critically involved in RANKL-supported osteoclastogenesis. Although additional factors may exist, RANKL-induced calpain activation is likely the result of a transient increase in the level of cytoplasmic Ca2+ due to the activation of phospholipase C and the subsequent release of Ca2+ from intracellular stores (27).

RANKL-activated µ-Calpain in RAW 264.7 Cells—The N-terminal ends of µ- and m-calpain are autoproteolyzed when activated by an increase in calcium concentration (14). In order to confirm which calpain species is/are activated in response to RANKL, changes in the amount of their latent forms were examined by using immunoblot. The antibodies used in this experiment recognized only the N-terminal ends of each species, thus the N-terminal processed form (resulting from activation) was not identified. Examination of changes in the amount of latent form represents a reliable parameter by which to analyze calpain activation in response to RANKL.



View larger version (53K):
[in this window]
[in a new window]
  		FIG. 4.
Calpain inhibitor decreases RANKL-supported osteoclastogenesis in BMM cells. A-1, calpain inhibitors, including calpastatin (1 µM) and calpeptin (5 µM), were sufficient to suppress the generation of TRAP(+)-multinucleated cells in normal pre-osteoclast using murine bone marrow-derived macrophages/monocytes. Images of both TRAP(+)-mononuclear and multinucleated cells were obtained after 7 days of treatment (original magnification, x100). Representative pictures were chosen for comparison. Each arrow indicates a TRAP(+)-multinucleated cell. A-2, re-sults are expressed as the mean ± S.D. of four independent experiments. **, significantly different between calpain inhibitor-treated and -untreated samples (No TMT, no treatment); p < 0.01. B, calpain inhibitors in the presence of RANKL suppressed the expression of the osteoclastogenic marker, MMP9. Black triangles indicate MMP9 and GAPDH (loading control). RL, RANKL; CPT, calpeptin; CPST, calpastatin.

 
As shown in Fig. 2B-1, RANKL treatment activated µ-calpain in a dose-dependent manner and thus decreased the amount of its latent full-length form. Because this change could have been the result of a decreased amount of µ-calpain mRNA, we checked its mRNA level upon RANKL treatment. As shown in Fig. 2B-2, we detected neither an increase nor a decrease at the mRNA level. Therefore, we concluded that this decrease in latent full-length form was indeed a consequence of µ-calpain activation. These data provide compelling evidence that µ-calpain is activated by RANKL in RAW 264.7 cells. It is also important to note that no significant changes in the level of full-length m-calpain or m-calpain mRNA were revealed as indicated in Fig. 2, B-1 and -2.

Calpain Inhibitors Suppressed RANKL-supported Osteoclastogenesis in RAW 264.7 Cells—To investigate further the calpain involvement in RANKL-supported osteoclastogenesis, calpain inhibitors were added to RAW 264.7 cells in the presence of RANKL. TRAP staining clearly demonstrated that both cell-permeable calpastatin peptide, an endogenous calpain inhibitor, and calpeptin sufficiently suppressed the generation of TRAP(+)-multinucleated cells (Fig. 3, A-1 and -2). Immunoblot analyses revealed a decrease in the level of osteoclastogenic markers, including cathepsin K (data not shown) and MMP9 compared with control cells that were not treated with calpain inhibitors (Fig. 3B).

In addition, we verified that calpain inhibitors suppress TRAP promoter activity judging from a pTRAP-luciferase assay system that measures changes in luciferase activity. As shown in Fig. 3C, RANKL treatment resulted in the activation of the TRAP promoter in RAW 264.7 cells, which was in turn arrested by calpain inhibitors.

Calpain Inhibitors Suppressed RANKL-supported Osteoclastogenesis in Normal Pre-osteoclasts—We then confirmed that our findings in RAW 264.7 cells also occur in normal pre-osteoclasts using bone marrow-derived monocyte/macrophage progenitors. As shown in Fig. 4, A-1 and -2, cell-permeable calpastatin peptide and calpeptin suppressed the generation of TRAP(+)-multinucleated cells when bone marrow-derived monocyte/macrophage progenitors were cultured with RANKL and M-CSF. Immunoblot analyses revealed a decrease in the level of osteoclastogenic marker MMP9 compared with control cells without calpain inhibitors (Fig. 4B). Therefore, we were able to verify that calpain regulation of RANKL-supported osteoclastogenesis is not unique to RAW 264.7 cells but that it also occurs in normal pre-osteoclasts. Taken together, our data indicated that calpain plays a pivotal role in the regulation of RANKL-supported osteoclastogenesis.

µ-Calpain Augmented RANKL-supported Osteoclastogenesis in RAW 264.7 Cells—Once we had identified that µ-calpain was activated in response to RANKL, we focused on the role of µ-calpain in RANKL-supported osteoclastogenesis. To verify whether µ-calpain enhances RANKL-supported osteoclastogenesis, µ-calpain was transfected into RAW 264.7 cells treated with RANKL (20 ng/ml) for 2 days prior to transfection. Changes in the number of TRAP(+)-multinucleated cells and the expression of osteoclastogenic markers, such as cathepsin K and MMP9, were used as parameters to evaluate µ-calpain enhancement in RANKL-supported osteoclastogenesis. In addition, µ-calpain was co-transfected with the calpain small subunit (30K) into RAW 264.7 cells (9 x 104).



View larger version (42K):
[in this window]
[in a new window]
  		FIG. 5.
µ-Calpain augments RANKL-supported osteoclastogenesis in RAW 264.7 cells. A-1, µ-calpain and 30K (calpain small subunit) were co-transfected into RAW 264.7 cells in the presence of RANKL (20 ng/ml). Controls included the cells with RANKL treatment alone and with an empty vector transfected in the presence of RANKL. Images of both TRAP(+)-mononuclear and multinucleated cells were obtained after 7 days of treatment (original magnification, x100). Arrows denote TRAP(+)-multinucleated cells. A-2, TRAP(+)-multinucleated cells were counted under a microscope, and cells with four or more nuclei with TRAP(+) staining were counted as TRAP(+)-multinucleated cells. Count was performed with four different fields for each sample. µ-Calpain overexpression increased the number of TRAP(+)-multinucleated cells. Results are expressed as the mean ± S.D. of four independent experiments. **, significantly different between µ-calpain overexpressed samples and nontransfected or mock-transfected samples; p < 0.01. B, TRAP promoter activity was synergistically increased upon co-transfection with the reporter plasmid and µ-calpain in the presence of RANKL (R). Results are expressed as the mean ± S.D. of four independent experiments; **, p < 0.01. C, expression of other osteoclastogenic markers, including cathepsin K and MMP9, increased with µ-calpain overexpression in the presence of RANKL.

 
Co-expression of µ-calpain and 30K clearly augmented the generation of TRAP(+)-multinucleated cells in the presence of RANKL as shown in Fig. 5, A-1 and -2. Overexpression of µ-calpain was identified using immunoblotting (data not shown). With a pTRAP-luciferase assay system, we also confirmed that ectopic µ-calpain overexpression in conjunction with RANKL treatment enhances TRAP promoter activity, synergistically (Fig. 5B). Immunoblot analyses revealed an increase in the level of osteoclastogenic markers, including cathepsin K and MMP9, compared with control samples (Fig. 5C). Taken together, our findings showed that µ-calpain plays an important role in the regulation of RANKL-supported osteoclastogenesis in RAW 264.7 cells.

Calpain Regulated NF-{kappa}B Activation in RAW 264.7 Cells—By using a MercuryTM pathway profiling system (BD Biosciences), we investigated the signal transduction pathway(s) in which calpain is involved in RAW 264.7 cells. This reporter system allows for the analysis of the effects of genes or reagents upon key signal transduction pathways by measuring changes in secreted alkaline phosphatase (SEAP) in the medium.

As it has been suggested that NF-{kappa}B plays a critical role in the regulation of osteoclastogenesis, the vector harboring cis-acting NF-{kappa}B binding sequences upstream of the promoter region was transfected into RAW 264.7 cells. The cells were then treated with calpastatin in the presence of RANKL (20 ng/ml). As shown in Fig. 6A, RANKL induced NF-{kappa}B activation in these cells. This activation, in turn, was inhibited by calpastatin, suggesting a blockade of the activation of the NF-{kappa}B pathway. Therefore, these data suggest that a calpain-calpastatin system regulates RANKL-induced NF-{kappa}B activation in RAW 264.7 cells.



View larger version (27K):
[in this window]
[in a new window]
  		FIG. 6.
Calpain inhibitors suppress RANKL-induced NF-{kappa}B activation in RAW 264.7 cells. A, using an NF-{kappa}B-SEAP plasmid, suppression of RANKL (RL)-induced NF-{kappa}B activation by calpastatin (CPST) was examined. RANKL-induced NF-{kappa}B activation was suppressed with calpastatin. Results are expressed as the mean ± S.D. of three independent experiments; **, p < 0.01. B, RANKL induced cytoplasmic I{kappa}B{alpha} degradation, and its level returned to an almost normal level after 60 min. Each band was quantified with densitometer. Results are expressed as the mean ± S.D. of four independent experiments; **, p < 0.01. C, RANKL-induced cytoplasmic I{kappa}B{alpha} degradation was inhibited by calpeptin (5 µM). MG132 (5 µM) was used for a positive control. {alpha}-Actin was used for a loading control. Results are expressed as the mean ± S.D. of four independent experiments; **, p < 0.01.

 



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 7.
Schematic diagram of RANKL-induced NF-{kappa}B activation by µ-calpain. RANKL induces µ-calpain activation. Activated µ-calpain proteolyzes cytoplasmic I{kappa}B{alpha}, thereby causing it to dissociate from the NF-{kappa}B complex. Eventually, sequestered cytoplasmic NF-{kappa}B translocates into the nucleus and activates transcription of those genes involved in osteoclastogenesis.

 
Calpain Inhibitors Decreased RANKL-induced I{kappa}B{alpha} Degradation in RAW 264.7 Cells—To gain insight into the mechanism underlying RANKL-induced NF-{kappa}B activation, we examined RANKL-induced I{kappa}B{alpha} degradation, as well as the effect of calpain inhibitors on this process by using immunoblot. As shown in Fig. 6B, RANKL induced I{kappa}B{alpha} degradation after treatment with RANKL (20 ng/ml). Cytoplasmic I{kappa}B{alpha} decreased with RANKL treatment but recovered to its normal level after 60 min. Most interestingly, this finding is consistent with data reported previously (27). Because I{kappa}B{alpha} degradation was most prominent within 20 min, we treated the cells with calpain inhibitors for this amount of time in the presence of RANKL (20 ng/ml). As shown in Fig. 6C, calpeptin and ALLM (data not shown) suppressed RANKL-induced cytoplasmic I{kappa}B{alpha} degradation.

Because a ubiquitin-proteasome pathway is considered to be a canonical pathway for I{kappa}B{alpha} degradation, we compared the effects of calpain and proteasome inhibitors on I{kappa}B{alpha} degradation. Suppression of cytoplasmic I{kappa}B{alpha} degradation by calpain inhibitors was more potent than that of MG132, a well known proteasome inhibitor. Collectively, our results suggested that RANKL-induced NF-{kappa}B activation was caused by calpain via limited proteolysis of I{kappa}B{alpha}.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Ligand-induced proteolysis is an efficient method of signaling capable of relaying extracellular signals to nuclei in order to regulate genes involved in inflammation, development, and cholesterol de novo synthesis in mammals (28). This mechanism is thought to have evolved for maintenance of cell viability.

Murine RAW 264.7 cells are widely used for the study of osteoclastogenesis because of their ability to differentiate into mature osteoclasts in the presence of RANKL. RANKL is known to activate the NF-{kappa}B transcription complex in pre-osteoclasts, as well as in mature osteoclasts (29). One study showed that RANKL acts through phospholipase C to release Ca2+ from intracellular stores, thereby accelerating nuclear translocation of NF-{kappa}B (30). This study also suggested that mediators involved in calcium signaling pathways play an intermediary role connecting signals from RANK of extracellular space to transcription factors, such as NF-{kappa}B of the nucleus. We showed in the present study that one such mediator may be calpain, as it is involved in various signal transduction pathways via limited proteolysis of its effectors in a calcium-dependent manner.

Calpain can be considered a signal-mediating protease because of its ability to proteolyze various effectors involved in many signal transduction pathways in response to extracellular stimuli. For instance, it has been suggested that m-calpain is activated in response to cytokine tumor necrosis factor-{alpha} (TNF-{alpha}), thereby inducing NF-{kappa}B activation via proteolysis of the inhibitor of NF-{kappa}B (I{kappa}B{alpha}) (31). In the present study, we investigated the mechanism by which calpain regulates RANKL-supported osteoclastogenesis. Our data demonstrated that RANKL-mediated calpain activation occurs not only in murine RAW 264.7 cells but also in normal pre-osteoclasts.

Activation of calpain by RANKL correlates well with changes in specific osteoclastogenic markers, such as cathepsin K, TRAP5b, MMP9, and the formation of TRAP(+)-multinucleated osteoclasts. In addition, the suppression effect of calpain inhibitors on the generation of multinucleated osteoclasts in both RAW 264.7 cells and normal pre-osteoclasts supports the notion that calpain plays a key role in RANKL-supported osteoclastogenesis.

Specifically, we found that µ-calpain modulates RANKL-induced osteoclastogenesis in RAW 264.7 cells. µ-Calpain overexpression resulted in an increase in RANKL-supported osteoclastogenesis in murine RAW 264.7 cells. Although µ-calpain and m-calpain share similar structure, their calcium requirements for activation are significantly different. µ-Calpain is active when the calcium concentration is between 2 and 75 µM, whereas m-calpain is active at calcium concentrations between 0.2 and 1 mM in vitro (32). Therefore, our finding that RANKL activates µ-calpain is consistent with the results of the study by Komarova et al. (30). In their study, RANKL induced an elevation in cytoplasmic calcium concentration to 220 nM more than that of basal level. Because calpain exists as an inactive form in the cytoplasm and is activated by the elevation of cytoplasmic calcium concentration and/or phospholipid, the role of µ-calpain discussed in the present study fits well with the proposed model of RANKL-supported osteoclastogenesis as indicated in Fig. 7.

However, it is also possible that RANKL-dependent calpain activation does not result solely from cytoplasmic calcium elevation in response to RANKL. For example, an unidentified adaptor molecule(s) triggered by RANKL may transfer µ-calpain to the plasma membrane where phospholipids exist. This idea will be the focus of future studies.

Although I{kappa}B{alpha} degradation, one of the prerequisites for NF-{kappa}B activation, is performed by a canonical ubiquitin-proteasome pathway, µ- and m-calpains are also known to regulate the NF-{kappa}B pathway via limited proteolysis of the inhibitor of NF-{kappa}B (I{kappa}B{alpha}) containing a PEST sequence at its C-terminal region (31, 33). The report (34) that accumulation of I{kappa}B{alpha} in both the cytoplasm and nucleus of limb girdle muscular dystrophy type 2A patients resulted from the failure of calpain 3-dependent I{kappa}B{alpha} proteolysis supports the importance of calpain in the regulation of the NF-{kappa}B pathway.

Moreover, the calpain-calpastatin system appears to modulate RANKL-supported osteoclastogenesis via regulation of the NF-{kappa}B pathway. Further studies are necessary to determine whether µ-calpain, once activated in response to RANKL, regulates other crucial molecular players involved in osteoclastogenesis, such as the members of the calcineurin-NFAT axis.

Pharmacologic intervention that blocks NF-{kappa}B activation recently provided a new avenue for the treatment of pathologic osteoclastogenesis. A cell-permeable inhibitor of the I{kappa}B-kinase complex has been shown to inhibit RANKL-supported osteoclastogenesis both in vivo and in vitro (35). However, potent calpain inhibitors and/or selective down-regulation of calpain species using RNA interference in a bone-specific manner may be a more effective therapeutic intervention for the suppression of pathologic osteoclastogenesis. Because RANKL-induced calpain activation may occur upstream of the RANKL/RANK axis, a direct calpain inhibition would likely be more efficient than any other methods that target downstream effectors involved in osteoclastogenesis.


   FOOTNOTES
 
* This work was supported by research grants from the Department of Orthopaedic Surgery and Women at Risk, Columbia University (to H.-J. L.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

To whom correspondence should be addressed: Center for Orthopaedic Research, Dept. of Orthopaedic Surgery, College of Physicians and Surgeons, Columbia University, 630 West 168th St., BB14-1411, New York, NY 10032. Tel.: 212-305-6446; Fax: 212-305-2741; E-mail: hl2004{at}columbia.edu.

1 The abbreviations used are: RANK, receptor activator of NF-{kappa}B; RANKL, receptor activator of NF-{kappa}B ligand; BMMs, bone marrow-derived monocyte/macrophages; TRAP, tartrate-resistant acid phosphatase; TNF, tumor necrosis factor; IL, interleukin; FBS, fetal bovine serum; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol; SEAP, secreted alkaline phosphatase; MMP, matrix metalloproteinase; M-CSF, macrophage colony-stimulating factor; RT, reverse transcription; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. Back


   ACKNOWLEDGMENTS
 
We thank Dr. Hiroyuki Sorimachi for the generous gifts of calpain cDNA. We thank Dr. William Kim for providing mouse bone marrows.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Teitelbaum, S. L., and Ross, F. P. (2003) Nat. Rev. Genet. 4, 638-649[CrossRef][Medline] [Order article via Infotrieve]
  2. Teitelbaum, S. L., and Ross, F. P. (2000) Science 289, 1504-1508[Abstract/Free Full Text]
  3. Lee, S. K., and Lorenzo, J. A. (1999) Endocrinology 140, 3552-3561[Abstract/Free Full Text]
  4. Hofbauer, L. C., Lacey, D. L., Dunstan, C. R., Spelsberg, T. C., Riggs, B. L., and Khosla, S. (1999) Bone 25, 255-259[Medline] [Order article via Infotrieve]
  5. Li, X., Pilbeam, C. C., Pan, L., Breyer, R. M., and Raisz, L. G. (2002) Bone 30, 567-573[Medline] [Order article via Infotrieve]
  6. Chung, H., Kang, Y. S., Hwang, C. S., Moon, I. K., Yim, C. H., Choi, K. H., Han, K. O., Jang, H. C., Yoon, H. K., and Han, I. K. (2001) J. Korean Med. Sci. 16, 769-773[Medline] [Order article via Infotrieve]
  7. Deyama, Y., Kikuiri, T., Ohnishi, G., Feng, Y., Takeyama, S., Hatta, M., Yoshimura, Y., and Suzuki, K. (2002) Biochem. Biophys. Res. Commun. 298, 240-246[CrossRef][Medline] [Order article via Infotrieve]
  8. Chikazu, D., Katagiri, M., Ogasawara, T., Ogata, N., Shimoaka, T., Takato, T., Nakamura, K., and Kawaguchi, H. (2001) J. Bone Miner. Res. 16, 2074-2081[CrossRef][Medline] [Order article via Infotrieve]
  9. Rubin, J., Ackert-Bicknell, C. L., Zhu, L., Fan, X., Murphy, T. C., Nanes, M. S., Marcus, R., Holloway, L., Beamer, W. G., and Rosen, C. J. (2002) J. Clin. Endocrinol. Metab. 87, 4273-4279[Abstract/Free Full Text]
  10. Wong, B. R., Josien, R., Lee, S. Y., Vologodskaia, M., Steinman, R. M., and Choi, Y. (1998) J. Biol. Chem. 273, 28355-28359[Abstract/Free Full Text]
  11. Armstrong, A. P., Tometsko, M. E., Glaccum, M., Sutherland, C. L., Cosman, D., and Dougall, W. C. (2002) J. Biol. Chem. 277, 44347-44356[Abstract/Free Full Text]
  12. Kong, Y. Y., Yoshida, H., Sarosi, I., Tan, H. L., Timms, E., Capparelli, C., Morony, S., Oliveira-dos-Santos, A. J., Van, G., Itie, A., Khoo, W., Wake-ham, A., Dunstan, C. R., Lacey, D. L., Mak, T. W., Boyle, W. J., and Penninger, J. M. (1999) Nature 397, 315-323[CrossRef][Medline] [Order article via Infotrieve]
  13. Li, J., Sarosi, I., Yan, X. Q., Morony, S., Capparelli, C., Tan, H. L., McCabe, S., Elliott, R., Scully, S., Van, G., Kaufman, S., Juan, S. C., Sun, Y., Tarpley, J., Martin, L., Christensen, K., McCabe, J., Kostenuik, P., Hsu, H., Fletcher, F., Dunstan, C. R., Lacey, D. L., and Boyle, W. J. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 1566-1571[Abstract/Free Full Text]
  14. Goll, D. E., Thompson, V. F., Li, H., Wei, W., and Cong, J. (2003) Physiol. Rev. 83, 731-801[Abstract/Free Full Text]
  15. Huang, Y., and Wang, K. K. (2001) Trends Mol. Med. 78, 355-362
  16. Sorimachi, H., and Suzuki, K. (2001) J. Biochem. (Tokyo) 129, 653-664[Abstract/Free Full Text]
  17. Milligan, S. A., Owens, M. W., and Grisham, M. B. (1996) Arch. Biochem. Biophys. 335, 388-395[CrossRef][Medline] [Order article via Infotrieve]
  18. Pariat, M., Salvat, C., Bebien, M., Brockly, F., Altieri, E., Carillo, S., Jariel-Encontre, I., and Piechaczyk, M. (2000) Biochem. J. 345, 129-138
  19. Jariel-Encontre, I., Salvat, C., Steff, A. M., Pariat, M., Acquaviva, C., Furstoss, O., and Piechaczyk, M. (1997) Mol. Biol. Rep. 24, 51-56[CrossRef][Medline] [Order article via Infotrieve]
  20. Wang, K. K. (2000) Trends Neurosci. 23, 20-26[CrossRef][Medline] [Order article via Infotrieve]
  21. Kunimatsu, M., Tada, T., Narita, Y., Ozaki, Y., Liu, Z. Q., Shearer, T. R., and Sasaki, M. (1999) Cardiovasc. Pathol. 8, 7-15[CrossRef][Medline] [Order article via Infotrieve]
  22. Vanderklish, P. W., and Bahr, B. A. (2000) Int. J. Exp. Pathol. 81, 323-339[CrossRef][Medline] [Order article via Infotrieve]
  23. Rami, A. (2003) Neurobiol. Dis. 13, 75-88[CrossRef][Medline] [Order article via Infotrieve]
  24. Wendt, A., Thompson, V. F., and Goll, D. E. (2004) Biol. Chem. 385, 465-472[CrossRef][Medline] [Order article via Infotrieve]
  25. Murray, S. S., Grisanti, M. S., Bentley, G. V., Kahn, A. J., Urist, M. R., and Murray, E. J. (1997) Exp. Cell Res. 233, 297-309[CrossRef][Medline] [Order article via Infotrieve]
  26. Clohisy, J. C., Hirayama, T., Frazier, E., Han, S. K., and Abu-Amer, Y. (2004) J. Orthop. Res. 22, 13-20[CrossRef][Medline] [Order article via Infotrieve]
  27. Bharti, A. C., Takada, Y., and Aggarwal, B. B. (2004) J. Immunol. 172, 5940-5947[Abstract/Free Full Text]
  28. Landman, N., and Kim, T. W. (2004) Cytokine Growth Factor Rev. 15, 337-351[CrossRef][Medline] [Order article via Infotrieve]
  29. Wei, S., Teitelbaum, S. L., Wang, M. W., and Ross, F. P. (2001) Endocrinology 142, 1290-1295[Abstract/Free Full Text]
  30. Komarova, S. V., Pilkington, M. F., Weidema, A. F., Dixon, S. J., and Sims, S. M. (2003) J. Biol. Chem. 278, 8286-8293[Abstract/Free Full Text]
  31. Han, Y., Weinman, S., Boldogh, I., Walker, R. K., and Brasier, A. R. (1999) J. Biol. Chem. 274, 787-794[Abstract/Free Full Text]
  32. Suzuki, K., Hata, S., Kawabata, Y., and Sorimachi, H. (2004) Diabetes 53, 12-18[CrossRef]
  33. Shumway, S. D., Maki, M., and Miyamoto, S. (1999) J. Biol. Chem. 274, 30874-30881[Abstract/Free Full Text]
  34. Baghdiguian, S., Martin, M., Richard, I., Pons, F., Astier, C., Bourg, N., Hay, R., Chemaly, R., Halaby, G., Loiselet, J., Anderson, L. V. B., Lopez De Munain, A., Fardeau, M., Mangeat, P., Beckmann, J. S., and Lefranc, G. (1999) Nat. Med. 5, 503-511[CrossRef][Medline] [Order article via Infotrieve]
  35. Jimi, E., Aoki, K., Saito, H., D'Acquisito, F., May, M. J., Nakamura, I., Sudo, T., Kojima, T., Okamoto, F., Fukushima, H., Okabe, K., Ohya, K., and Ghosh, S. (2004) Nat. Med. 10, 617-624[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Cell Sci.Home page
B. B. Yaroslavskiy, A. C. Sharrow, A. Wells, L. J. Robinson, and H. C. Blair
Necessity of inositol (1,4,5)-trisphosphate receptor 1 and {micro}-calpain in NO-induced osteoclast motility
J. Cell Sci., August 15, 2007; 120(16): 2884 - 2894.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Marzia, R. Chiusaroli, L. Neff, N.-Y. Kim, A. H. Chishti, R. Baron, and W. C. Horne
Calpain Is Required for Normal Osteoclast Function and Is Down-regulated by Calcitonin
J. Biol. Chem., April 7, 2006; 281(14): 9745 - 9754.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/33/29929    most recent
M414600200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, F. Y.-I.
Right arrow