Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M501473200 on July 1, 2005

J. Biol. Chem., Vol. 280, Issue 35, 31027-31035, September 2, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/35/31027    most recent
M501473200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, J.-H.
Right arrow Articles by Freedman, N. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, J.-H.
Right arrow Articles by Freedman, N. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The Platelet-derived Growth Factor Receptor-{beta} Phosphorylates and Activates G Protein-coupled Receptor Kinase-2

A MECHANISM FOR FEEDBACK INHIBITION*

Jiao-Hui Wu, Robi Goswami{ddagger}, Luke K. Kim§, William E. Miller, Karsten Peppel, and Neil J. Freedman||

From the Department of Medicine (Cardiology), Duke University Medical Center, Durham, North Carolina 27710

Received for publication, February 8, 2005 , and in revised form, June 30, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
G protein-coupled receptor kinase-2 (GRK2) serine-phosphorylates the platelet-derived growth factor receptor-{beta} (PDGFR{beta}), and thereby diminishes signaling by the receptor. Because activation of GRK2 may involve phosphorylation of its N-terminal tyrosines by c-Src, we tested whether the PDGFR{beta} itself could tyrosine-phosphorylate and activate GRK2. To do so, we used wild type (WT) and Y857F mutant PDGFR{beta}s in HEK cells, which lack endogenous PDGFRs. The Y857F PDGFR{beta} autophosphorylates normally but does not phosphorylate exogenous substrates. Although PDGF-stimulated Y857F and WT PDGFR{beta}s activated c-Src equivalently, the WT PDGFR{beta} tyrosine-phosphorylated GKR2 60-fold more than the Y857F PDGFR{beta} in intact cells. With purified GRK2 and either WT or Y857F PDGFR{beta}s immunoprecipitated from HEK cells, GRK2 tyrosyl phosphorylation was PDGF-dependent and required the WT PDGFR{beta}, even though the WT and Y857F PDGFR{beta}s autophosphorylated equivalently. This PDGFR{beta}-mediated GRK2 tyrosyl phosphorylation enhanced GRK2 activity: GRK2-mediated seryl phosphorylation of the PDGFR{beta} was 9-fold greater for the WT than for the Y857F in response to PDGF, but equivalent when GRK2 was activated by sequential stimulation of {beta}2-adrenergic and PDGF-{beta} receptors. Furthermore, both PDGFR{beta}-mediated GRK2 tyrosyl phosphorylation and GRK2-mediated PDGFR{beta} seryl phosphorylation were reduced ~50% in intact cells by mutation to phenylalanine of three tyrosines in the N-terminal domain of GRK2. We conclude that the activated PDGFR{beta} itself phosphorylates GRK2 tyrosyl residues and thereby activates GRK2, which then serine-phosphorylates and desensitizes the PDGFR{beta}.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
As a receptor protein-tyrosine kinase, the platelet-derived growth factor receptor-{beta} (PDGFR{beta})1 triggers cellular proliferation, migration, and survival (1) but also contributes to atherosclerosis (2-4) and malignant neoplasia (5, 6). Agonist-induced dimerization of the PDGFR{beta} enables receptor activation consequent to autophosphorylation (7), followed by recruitment to the PDGFR{beta} of various signaling proteins, and tyrosyl phosphorylation of PDGFR{beta} substrates (1). In order for the PDGFR{beta} to phosphorylate these "exogenous" substrates, however, the PDGFR{beta} must be autophosphorylated on Tyr857, located in the PDGFR{beta} kinase activation loop (8).

Regulatory constraints on PDGFR{beta} signaling include tyrosyl dephosphorylation (9, 10), degradation and down-regulation of cellular PDGFR{beta}s (11, 12), and agonist-induced phosphorylation of the PDGFR{beta} on serine residues (13-15). In fibroblasts, the preponderance of this PDGFR{beta} seryl phosphorylation appears to be mediated by GRK2 (13), a ubiquitous allosteric kinase that also phosphorylates activated G protein-coupled (heptahelical) receptors and thereby initiates their desensitization (16). We have demonstrated GRK2-mediated PDGFR{beta} seryl phosphorylation with purified kinase preparations (14), as well as by comparing PDGFR{beta} seryl phosphorylation in GRK2-null, cognate WT, and GRK2 "add-back" fibroblasts (13). GRK2-mediated PDGFR{beta} phosphorylation diminishes PDGFR{beta} tyrosyl phosphorylation, PDGFR{beta}-evoked phosphoinositide hydrolysis and phosphoinositide 3-kinase activation, but not ERK activation (13). This GRK2-mediated PDGFR{beta} desensitization appears to involve dissociation of the PDGFR{beta} from the Na+/H+ exchanger regulatory factor, a PDZ domain-containing protein that potentiates PDGFR{beta} dimerization (13, 17). GRK2-mediated PDGFR{beta} desensitization may also involve enhancement of PDGFR{beta} ubiquitination (14).

How the PDGFR{beta} activates GRK2 has yet to be elucidated. Allosteric activation of purified GRK2 by agonist-activated heptahelical receptors has been demonstrated repeatedly (18-22), with a variety of purified receptors. Like many heptahelical receptors, the PDGFR{beta} activates G{alpha}i in smooth muscle cells (14), and thus might be expected to serve as an allosteric activator of GRK2, as well. Activation of heterotrimeric Gi by the PDGFR{beta} also liberates G{beta}{gamma} subunits, which recruit GRK2 to heptahelical receptor substrates (16) and which may enhance GRK2 catalytic activity (23). Another important mechanism for GRK2 activation involves tyrosyl phosphorylation of GRK2 in its N-terminal domain by c-Src (24-26). Src-mediated phosphorylation of GRK2 has been shown to increase GRK2 catalytic activity in vitro (24), and inhibition of c-Src in intact cells appears to attenuate GRK2-dependent (27) desensitization of the {beta}2-adrenergic receptor (26). In this work, we sought to determine whether the PDGFR{beta} could tyrosyl-phosphorylate and thereby activate GRK2.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Plasmid Constructs—Plasmids encoding the N-terminal FLAGTM-tagged human PDGFR{beta} (14), N-terminal hemagglutinin-tagged human {beta}2-adrenergic receptor (28), bovine GRK2, and bovine GRK5 (all in pcDNA I (Invitrogen)) (22), and hemagglutinin-tagged constitutively active c-Src (29) have been described. The plasmid encoding FLAGTM-tagged murine VASP was obtained from Dr. Michael D. Uhler (30).

Bovine GRK2 mutant constructs were made by cassette PCR. For the Y13F mutant, the 5'-oligonucleotide comprised nucleotides 85-153 of the native sequence: 5'-cgcggggatatcaccatggcggacctggaggcggtgctggccgacgtgagcttcctgatggcgatggagaagagcaaggccacg-3' (the EcoRV site is underlined; the Y13F mutation is boldface). For the Y86F/Y92F mutations, the 5'-oligonucleotide comprised nucleotides 275-388 of the native sequence: 5'-gggcgcggtacctgcttttccgagacttctgcctgaagcacctggaggaggccaagcccttggtagagttcttcgaggagatcaagaaattcgagaagcttgagacagaggaggagcgcc-3' (the KpnI site is underlined; Y86F and Y92F mutations are in boldface). For both constructs, the 3' primer comprised nucleotides 579-559 of the native GRK2 sequence. Bovine GRK2 was subcloned into pcDNA3.1 (Invitrogen), and the PCR fragments were subcloned into this construct after EcoRV/KpnI digestion (Y13F GRK2) or KpnI/BspE1 digestion (Y86F/Y92F GRK2). To generate the Y13/86/92F triple site mutant GRK2, the EcoRV/KpnI fragment of Y13F GRK2 was subcloned into the Y86F/Y92F GRK2/pCDNA3.1 construct.

To create the Y857F PDGFR{beta} mutant, we used cassette PCR with a 5'-oligonucleotide comprising nucleotides 2899-2953 of the native sequence: 5'-gggcgcctcgagacatcatgcgggactcgaatttcatctccaaaggcagcacctttttgcc-3' (the XhoI site is underlined; the Y857F mutation is in boldface). The 3' primer comprised nucleotides 3302-3281 of the native PDGFR{beta} sequence. The PCR fragment was ligated into the PDGFR{beta}/pcDNAI construct after XhoI digestion. Fidelity of mutagenesis for all constructs was verified by dideoxy sequencing. For stable transfections (see below), both WT and Y857F PDGFR{beta} constructs were excised with HindIII/XbaI, Klenow-blunted, and subcloned into EcoRV-cut pcDNA3.1. The Y740F/Y751F PDGFR{beta} was a gift from Dr. Andrius Kazlauskas (31). We subcloned the BspE1/BspH1 fragment (encompassing the Y740F/Y751F mutations) into our FLAG-tagged PDGFR{beta}/pcDNAI construct.

Small Interfering RNA—Double-stranded siRNAs targeting human GRK2 or no known human sequence were chemically synthesized with 19-nucleotide duplex RNA and 2-nucleotide 3'-dTdT overhangs (Dharmacon Research, Lafayette, CO), as described (32).

Cell Culture and Transfection—Human embryonic kidney 293 cells were cultured and transfected as described (22). For each transfection, cell surface PDGFR{beta} or {beta}2-adrenergic receptor expression was measured by immunofluorescence and flow cytometry, as described before (33), and transfection efficiency typically ranged from 35 to 50%. Assays were performed 2 days after transfection. Target expression levels for GRK2 was 40-fold higher than endogenous levels in 293 cells, assessed by immunoblotting serially diluted cell extracts. Transfected 293 cell lines co-transfected with various plasmids typically demonstrated receptor expression levels within 30% of that measured in empty vector co-transfected control cells. Cell lines with receptor expression levels outside this range were not used.

For transfection with siRNA, early passage 293 cells at 30-40% confluency were transfected with 1.0 µg of PDGFR{beta}/pcDNA I and 20 µg of the indicated siRNA by using the GeneSilencer Transfection reagent (Gene Therapy Systems, San Diego, CA) as described (32). After 48 h, cells were divided into plates for IP, IB, cell surface immunofluorescence/flow cytometry, and phosphoinositide hydrolysis. All assays were performed at least 3 days after siRNA transfection. Cells were serum-starved overnight before stimulation.

To create 293 cells stably expressing the PDGFR{beta} WT or Y857F mutant, we transfected with pcDNA3.1-based constructs and selected clones resistant to Geneticin (0.5 mg/ml). WT and Y857F PDGFR{beta} expression was assessed by cell surface immunofluorescence for the N-terminal PDGFR{beta} FLAGTM epitope (33), and comparisons were made among clones (n = 3 of each) with equivalent PDGFR{beta} expression.

Immunoprecipitations—To assess PDGFR{beta}-mediated tyrosyl phosphorylation of GRK2 as well as GRK2-mediated seryl phosphorylation of the PDGFR{beta}, cells were serum-starved overnight, exposed to vehicle- or agonist-containing medium for the indicated times, and subjected to IP as described previously for the FLAGTM-tagged PDGFR{beta} (14). In select experiments, 293 cells were exposed for 16 h (37 °C) to serum-free medium containing 100 ng of pertussis toxin (List Biological Laboratories, Inc.) per milliliter, prior to PDGF stimulation. The PDGFR{beta} constructs and GRK2 constructs were immunoprecipitated from parallel aliquots of cell lysates. For GRK2 IP we used 10 µg of pY20 (for phosphotyrosine, BD Transduction Laboratories) or 5 µg of C5/1 (which recognizes a C-terminal epitope in GRK2 (34)), and 10 µl of protein G-agarose beads (Sigma). These conditions represented IgG and protein G excess: doubling the IP IgG and protein G-agarose quantities did not increase the amount of GRK2 immunoprecipitated.

Immunoblotting—Cell surface PDGFR{beta} expression levels and/or cell lysate protein concentrations were used to load equivalent amounts of receptor or cell protein per lane for SDS-PAGE, and immunoblotting was performed as described before (14). In addition to IgGs used previously (14, 33), we also used the following: rabbit polyclonal anti-GRK2, anti-c-Src, and anti-phospho-VASP from Santa Cruz Biotechnology; mouse anti-activated Src (phospho-Tyr416) from Calbiochem. Because anti-phosphotyrosine and anti-phosphoserine IgGs fail to desorb from PDGFR{beta} bands (13), these IgGs were used in sequential immunoblotting only after blotting for the PDGFR{beta} was performed. Chemiluminescence signals for phosphotyrosine or phosphoserine were normalized to cognate signals for either the PDGFR{beta} or GRK2, and relative band intensities were then compared among bands on the same nitrocellulose blot.

Cellular PKA Activity Assays—HEK cells were transfected with plasmids encoding PDGFR constructs, the {beta}2-adrenergic receptor (28), and VASP (6, 1.2, and 0.1 µg of plasmid/per 100-mm dish, respectively). Cells were stimulated at 37 °C with 50 µM forskolin or 10 µM (-)isoproterenol for 10 or 5 min, respectively, as described (22), and then lysed in 1 x SDS sample buffer. Cell extracts were immunoblotted for phospho-VASP and actin; band intensities for phospho-VASP were normalized to cognate band intensities for actin.

Immune Complex Kinase Assays—Bovine GRK2 was produced in Sf9 cells by recombinant baculovirus-mediated expression and purified as described (14). Kinase assays with immunoprecipitated PDGFR{beta} constructs were performed exactly as described (14), but with only non-radiolabeled ATP. Although PDGFR{beta} constructs were immunoprecipitated with M2-agarose beads (Sigma), hemagglutinin-tagged constitutively active Src was immunoprecipitated with 12CA5 and protein G-agarose (22). For experiments with the c-Src-selective inhibitor PP2 (Calbiochem), immune complexes were preincubated with the indicated PP2 concentration for 10 min (37 °C) before the addition of GRK2 and ATP. At the conclusion of kinase assays, 1 ml of solubilization buffer containing 5 mM EDTA was added to each tube. While GRK2 was immunoprecipitated from the supernatant with C5/1, the PDGFR{beta} constructs were desorbed from the washed M2-agarose beads.

Phosphorylation of GRK2 in Intact Cells—To detect the tyrosyl phosphorylation of endogenous GRK2 in intact cells, we inhibited cellular protein tyrosyl phosphatases with pervanadate, which was prepared by incubating 5 mM sodium ortho-vanadate in the presence of 50 mM H2O2 (10 min, room temperature) and then quenching excess H2O2 by adding 0.1 volume of catalase (Sigma, 200 µg/ml, 4-8 units/µg). The resulting pervanadate solution was added to cells at 50 µM (final), 5 min before the addition of PDGF. No pervanadate was used in experiments with cells overexpressing GRK2. Cells were solubilized and subjected to GRK2 and PDGFR{beta} IP as described above.

Phosphoinositide Hydrolysis—siRNA-transfected cells were labeled overnight with 1 µCi of [3H]inositol/ml in serum-free medium, stimulated with PDGF-BB or fluoroaluminate, and processed to obtain total inositol phosphates as described (13). Cellular inositol phosphates were normalized to the [3H]inositol taken up by the cells, to obtain "percent conversion," as described (33).

Data Analysis—Independent means were compared with the Student's t test, curves were compared with two-way analysis of variance, and two-sided p values were calculated with PrismTM software (Graph-Pad, Inc.). Data are presented as mean ± S.D. in the text, and mean ± S.E. in the figures.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
The PDGFR{beta} Phosphorylates Purified GRK2 on Tyrosyl Residues—To determine whether the PDGFR{beta} can phosphorylate GRK2, we first used purified GRK2 along with PDGFR{beta}s immunoprecipitated from transfected HEK cells, which lack endogenous PDGFRs (14). Because these immune complex kinase assays used non-denaturing conditions for PDGFR{beta} IP, potential tyrosyl phosphorylation of GRK2 could be effected not only by the PDGFR{beta} but also by other tyrosine kinases that could co-immunoprecipitate with the PDGFR{beta}, like c-Src. To control for this possibility, we used a Y857F PDGFR{beta} mutant, which autophosphorylates normally but fails to phosphorylate exogenous substrates (8). Whereas the WT PDGFR{beta} tyrosine-phosphorylated GRK2 in a PDGF-dependent manner, the Y857F PDGFR{beta} failed to do so, even when we used much more Y857F than WT PDGFR{beta} (Fig. 1). Despite this remarkable difference between WT and Y857F PDGFR{beta}s with regard to GRK2 phosphorylation, both the WT and Y857F PDGFR{beta}s autophosphorylated equivalently (Fig. 1). Thus, the WT PDGFR{beta}, and not a co-immunoprecipitating kinase, appeared to tyrosine-phosphorylate GRK2.



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 1.
The PDGFR{beta} phosphorylates purified GRK2 on tyrosyl residues. HEK 293 cells, which lack endogenous PDGFRs (14), were transfected with plasmids encoding N-terminal epitope-tagged constructs of the WT or Y857F PDGFR{beta}, then exposed to medium containing vehicle or 2 nM PDGF-BB for 10 min at 37 °C, solubilized, and subjected to PDGFR{beta} IP. Immunoprecipitated PDGFR{beta}s were used to perform immune complex kinase assays with 200 nM purified bovine GRK2. After 45 min (35 °C), PDGFR{beta} immune complexes were pelleted, and the supernatant was subjected to GRK2 IP. PDGFR{beta} and GRK2 immune complexes were resolved by separate SDS-PAGE procedures, followed by immunoblotting. A, the immunoblot (IB) of the GRK2 IP was probed first for phosphotyrosine (pY), and then for GRK2. The PDGFR{beta} IB was probed sequentially for total PDGFR{beta}, and then pY. B, PDGFR{beta} and GRK2 tyrosyl phosphorylation data (mean ± S.E.) from three independent experiments is summarized. Phosphotyrosine band densities in lanes from agonist-stimulated cells were divided by cognate GRK2 and PDGFR{beta} band densities, and these quotients were normalized to those obtained from cells expressing the WT PDGFR{beta}, to obtain "percent of control." Compared with the cognate value from the WT PDGFR{beta}: *, p < 0.01.

 
A growing body of evidence suggests that c-Src can phosphorylate GRK2 on tyrosyl residues, and thereby increase GRK2 activity (24, 26). Data regarding the ability of the Y857F PDGFR{beta} to activate c-Src are lacking, even though the Y857F PDGFR{beta} is equivalent to the WT PDGFR{beta} with regard to autophosphorylation and association with phospholipase C{gamma}, RasGAP, and p85 (8). Because the PDGFR{beta} activates c-Src through the SH2 domain-containing tyrosine phosphatase Shp2 (35), and because the autophosphorylated Y857F and WT PDGFR{beta}s should bind Shp2 equivalently (8), we expected that both PDGFR{beta} constructs would activate Src equivalently. To test this expectation, we stably expressed WT and Y857F PDGFR{beta} constructs at equivalent levels in 293 cells and found that PDGF did indeed activate c-Src via the two PDGFR{beta} constructs indistinguishably (Fig. 2). Consequently, differences between the WT and Y857F PDGFR{beta}s with regard to tyrosyl phosphorylation of GRK2 cannot be attributed to differences in Src activation.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 2.
WT and Y857F PDGFR{beta}s activate Src equivalently. HEK cells stably expressing equivalent levels of the WT or Y857F PDGFR{beta} constructs were stimulated (or not) with 2 nM PDGF-BB (5 min, 37 °C), washed, and solubilized in SDS sample buffer; aliquots were subjected to SDS-PAGE and immunoblotting. A, replicate blots were probed with either IgG specific for activated c-Src (phosphorylated at Tyr416 (pY416), top blot), or IgG specific for c-Src (bottom blot). B, band densities for activated c-Src were divided by cognate band densities for total c-Src, and the resulting quotients were normalized to those obtained with agonist-stimulated cells expressing the WT PDGFR{beta}, to obtain "percent of control." Data are plotted as the mean ± S.E. from three independent experiments, using three independent pairs of cell lines expressing equivalent levels of WT and Y857F PDGFR{beta}s. Compared with unstimulated cells: *, p < 0.05.

 
To corroborate further our inferences that GRK2 is tyrosine-phosphorylated primarily by the PDGFR{beta}, and not c-Src, in our PDGFR{beta} assays (Fig. 1), we used purified GRK2 in immune complex kinase assays with the WT PDGFR{beta} or constitutively active (CA-) c-Src. To distinguish PDGFR{beta}-from CA-Src-mediated GRK2 tyrosyl phosphorylation, we used the Src-selective tyrosine kinase inhibitor PP2, which is known to inhibit the PDGFR{beta} tyrosine kinase activity at higher concentrations (36). Although CA-Src and the PDGFR{beta} effected equivalent tyrosyl phosphorylation of purified GRK2, the CA-Src-mediated phosphorylation of GRK2 was ~50-fold more sensitive to PP2 than was that of the PDGFR{beta}, both in purified protein preparations (Fig. 3) and in PDGF-stimulated, intact cells (data not shown). Thus, differential sensitivity to PP2 distinguishes Src-from PDGFR{beta}-mediated tyrosyl phosphorylation of GRK2, and supports the conclusion that Src contributes little, if at all, to GRK2 tyrosyl phosphorylation observed in the PDGFR{beta} immune complex kinase assay or in PDGF-stimulated intact cells.



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 3.
Tyrosyl phosphorylation of purified GRK2 by the PDGFR{beta} and c-Src: differential sensitivity to PP2. HEK-293 cells were transfected with the FLAGTM-tagged PDGFR{beta} or a hemagglutinin-tagged, constitutively active c-Src (CA-Src) mutant (Y527F). Cells were exposed (or not) to 2 nM PDGF-BB for 5 min (37 °C), solubilized, and then subjected to IP for PDGFR{beta} or CA-Src. Immune complex kinase assays were performed as in Fig. 1. However, before the addition of GRK2 and ATP, immune complexes were preincubated with the indicated concentration of the c-Src-selective inhibitor PP2 (10 min, 37 °C). A, after the phosphorylation reaction, immune complexes were pelleted, supernatant GRK2 was resolved by SDS-PAGE, and immunoblotting was performed, successively, for phosphotyrosine (pY) and then (after membrane stripping) for GRK2. B, quantitation: phosphotyrosine band intensity was divided by the cognate band intensity for GRK2, and these quotients were normalized to those obtained in the absence of PP2 to obtain "percent of control." Results are plotted as the means ± S.E. of two independent experiments performed in duplicate. For the comparison of CA-Src with PDGFR{beta} curves: p < 0.05.

 
PDGFR{beta}-mediated Phosphorylation of GRK2 Enhances GRK2 Activity—GRK2 tyrosyl phosphorylation by c-Src has been shown to increase the kinase activity of GRK2 on purified substrates (26). To determine whether PDGFR{beta}-mediated phosphorylation of GRK2 affects GRK2 activity in intact cells, we compared GRK2 activity in cells expressing either the WT or the Y857F PDGFR{beta} construct (Fig. 4). Expression levels of the Y857F and WT PDGFR{beta}s were equivalent, and PDGF-evoked tyrosyl phosphorylation of the receptors was also equivalent. However, endogenous cellular GRK2 was tyrosine-phosphorylated by only the WT, and not the Y857F PDGFR{beta}. This PDGFR{beta}-mediated GRK2 tyrosyl phosphorylation correlated with PDGF-promoted seryl phosphorylation of the PDGFR{beta}: while the Y857F PDGFR{beta} demonstrated neither tyrosyl phosphorylation of GRK2 nor seryl phosphorylation of the PDGFR{beta} mutant, the WT PDGFR{beta} demonstrated both. If this PDGF-induced seryl phosphorylation of the PDGFR{beta} could be attributed to GRK2, it would provide evidence that PDGFR{beta}-mediated phosphorylation of GRK2 activates GRK2.

To address this issue, we reduced endogenous 293 cell GRK2 expression by >90%, using siRNA (Fig. 5A). This GRK2 knockdown diminished PDGF-induced seryl phosphorylation of the PDGFR{beta} by 54 ± 7% (p < 0.01, Fig. 5, A and B). Concomitantly, GRK2 knockdown enhanced PDGF-induced phosphoinositide hydrolysis by 36 ± 5% (p < 0.05, Fig. 5C). Thus, endogenous GRK2 mediates most of the PDGF-induced seryl phosphorylation of the PDGFR{beta} in 293 cells, and this phosphorylation correlates with desensitization of PDGFR{beta}-evoked phosphoinositide hydrolysis.



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 4.
PDGFR{beta}-mediated tyrosyl phosphorylation of GRK2 correlates with PDGFR{beta} seryl phosphorylation. A, HEK cells expressing equivalent cell surface levels of either the WT or Y857F PDGFR{beta}s were treated with 50 µM pervanadate for 5 min, then stimulated (or not) with 2 nM PDGF for 5 min at 37 °C, and then solubilized. Parallel aliquots of these cell lysates were subjected to IP for either PDGFR{beta}s or GRK2, followed by SDS-PAGE and IB. The GRK2 blot was probed first for phosphotyrosine (pTyr), and then for GRK2. The PDGFR{beta} blot was probed sequentially for total PDGFR{beta} (bottom), phosphoserine (pSer), and then pTyr. Results are from a single experiment, representative of three performed.

 
To corroborate these findings, we pursued additional approaches for correlating GRK2 activation with PDGFR{beta} seryl phosphorylation. First, we activated endogenous cellular GRK2 through stimulation of the {beta}2-adrenergic receptor, rather than through the PDGFR{beta}, and assessed subsequent agonist-promoted seryl phosphorylation of the PDGFR{beta}. (GRK2 rapidly undergoes tyrosyl phosphorylation after {beta}2-adrenergic receptor stimulation (26).) After this {beta}2-adrenergic receptor-initiated pre-activation of GRK2, we could observe agonist-dependent Y857F PDGFR{beta} seryl phosphorylation that was 80 ± 30% of that obtained with the WT PDGFR{beta} (Fig. 6). Could this {beta}2-adrenergic receptor-facilitated, PDGF-promoted seryl phosphorylation of the Y857F PDGFR{beta} be mediated by the Ser/Thr kinase PKA, which is also activated by the {beta}2-adrenergic receptor (reviewed in Ref. 16)? To exclude this possibility, we used forskolin to stimulate directly cellular adenylyl cyclase and consequent PKA activity, without activating GRKs (22). Although it induced more cellular PKA activity than the {beta}2-adrenergic receptor (judged by phosphorylation of VASP (37) in cell lysates), this forskolin stimulation failed to effect detectable seryl phosphorylation of either PDGF-stimulated PDGFR{beta} construct (data not shown). Thus, {beta}2-adrenergic receptor-mediated activation of a GRK, rather than PKA, appeared to facilitate PDGF-promoted seryl phosphorylation of the Y857F PDGFR{beta}. Importantly, in the absence of GRK2 pre-activation, seryl phosphorylation of the Y857F PDGFR{beta} was not detectable (Fig. 4 and data not shown). Consequently, seryl phosphorylation of the Y857F as well as the WT PDGFR{beta} correlated with GRK2 activation by tyrosyl phosphorylation.

Further correlation of GRK2 tyrosyl phosphorylation with GRK2 activity derived from comparing cells expressing endogenous and high levels of GRK2. With this comparison, we can operationally define GRK2 activity as the excess PDGFR{beta} seryl phosphorylation observed in cells overexpressing GRK2: 3.9 ± 0.6-fold more than that observed in cells expressing only endogenous GRK2 (Fig. 7). This excess GRK2 catalytic activity also clearly correlated with the extent of GRK2 tyrosyl phosphorylation by the PDGFR{beta}. In cells expressing the Y857F PDGFR{beta}, tyrosyl phosphorylation of overexpressed GRK2 was only 7 ± 2% of that seen in cells expressing equivalent levels of the WT PDGFR{beta} (Fig. 7) (and this degree of tyrosyl phosphorylation in intact cells could have been mediated by c-Src (Fig. 2) (26). Correspondingly, the extent of Y857F PDGFR{beta} seryl phosphorylation was only 11 ± 4% as much as that observed with the WT PDGFR{beta}. Thus, in a setting wherein we can identify the serine kinase activity on the PDGFR{beta} to be that of GRK2 (to an extent even greater than that seen with endogenous GRK2 in Fig. 5), there is again a direct correlation between GRK2 tyrosyl phosphorylation and PDGFR{beta} seryl phosphorylation.



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 5.
Physiologically expressed GRK2 serine-phosphorylates and desensitizes the PDGFR{beta}. A, HEK cells were co-transfected with plasmids encoding the WT PDGFR{beta} and either control or GRK2 siRNA. (Untransfected cells are designated "-"). After exposure to medium containing vehicle or 2 nM PDGF-BB for 5 min (37 °C), cells were solubilized and cell lysates were subjected to PDGFR{beta} IP and subsequent IB. PDGFR{beta} blots were probed sequentially for PDGFR{beta} and then phosphoserine (pSer). B, phosphoserine band intensities were divided by cognate PDGFR{beta} band intensities; these ratios were normalized to those obtained from control siRNA-treated cells that were stimulated with PDGF, to obtain "percent of control." Results are the means ± S.E. from five independent experiments. Compared with control siRNA-treated cells: *, p < 0.05. C, cells equivalent to those used in panel A were labeled with [3H]inositol and then exposed (37 °C) to vehicle (basal),2nM PDGF-BB (20 min), or fluoroaluminate (30 min), as indicated. Total inositol phosphates were isolated by anion exchange chromatography; inositol phosphate counts from stimulated cells were divided by counts from cognate unstimulated cells to obtain "fold/basal." Basal counts from control- and GRK2-siRNA-treated cells were 2.8 ± 0.5 and 5.5 ± 0.1 (% conversion units), respectively. Compared with control siRNA-treated cells: *, p < 0.05 (paired analysis).

 



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 6.
Pre-activation of GRK2 by the {beta}2-adrenergic receptor facilitates GRK2-mediated seryl phosphorylation of the PDGFR{beta}. HEK 293 cells were transfected to express equivalent cell surface levels of either the WT or Y857F PDGFR{beta}s, along with a hemagglutinin-tagged {beta}2-adrenergic receptor construct. Cells were stimulated with 10 µM (-)isoproterenol (ISO) for 5 min, and then medium containing vehicle or 2 nM PDGF ([final]) was added (10 min, 37 °C). Next, the cells were solubilized and subjected to PDGFR{beta} IP, and aliquots of the IP were processed for parallel SDS-PAGE and IB. Parallel blots were probed for either pSer or PDGFR{beta}. Results from this single experiment are representative of three performed. In cells not stimulated with ISO, the Y857F PDGFR{beta} did not undergo PDGF-induced seryl-phosphorylation (just as in Fig. 4, data not shown).

 
To estimate the fraction of GRK2 molecules that are tyrosyl-phosphorylated consequent to PDGFR{beta} activation, we repeated experiments described in Fig. 7, immunoprecipitated equal aliquots of cell lysates for either phosphotyrosine or GRK2, and immunoblotted for GRK2 (as in Fig. 7). In this manner, we found that 10 ± 4% of total cellular GRK2 underwent PDGFFR{beta}-mediated tyrosyl phosphorylation (n = 3 independent experiments, data not shown). Of course, the (cell-specific) extent of GRK2 tyrosyl phosphorylation undoubtedly relates to the relative expression levels of both the PDGFR{beta} and GRK2.

PDGFR{beta} Tyrosine Kinase Activity Correlates with GRK2 Degradation—Another measure of GRK2 activation involves GRK2 degradation. Agonist-induced tyrosyl phosphorylation of GRK2 has been correlated not only with enhanced GRK2 activity (24) but also with enhanced proteolysis of GRK2 (25), and GRK2 down-regulation (38). To test whether this paradigm applies to PDGFR{beta}-mediated tyrosyl phosphorylation and activation of GRK2, we measured the effect on endogenous GRK2 levels of persistent PDGF stimulation, and compared results among cells stably expressing either the WT or Y857 PDGFR{beta} constructs (Fig. 8). Although steady-state GRK2 levels declined only 11% in PDGF-stimulated cells expressing the Y857F PDGFR{beta}, they declined 46% in cells expressing the WT PDGFR{beta}. Because activation of Src by the Y857F and WT PDGFR{beta}s is equivalent (Fig. 2), these data support the notion that GRK2 down-regulation consequent to PDGFR{beta} activation depends more upon PDGFR{beta}-mediated than upon Src-mediated GRK2 tyrosyl phosphorylation.

Recruitment of GRK2 to the PDGFR{beta} Requires Neither G{beta}{gamma} Subunits nor PI3K—Previous studies have demonstrated that G{beta}{gamma} subunits are important for the translocation of cytosolic GRK2 to its (plasma membrane) heptahelical receptor substrates (16). Like many heptahelical receptors, the PDGFR{beta} itself activates heterotrimeric Gi in smooth muscle cell membranes (14). To test whether Gi{beta}{gamma} subunits could play a role in the recruitment of GRK2 to the PDGFR{beta}, we prevented the dissociation of Gi into constituent {alpha} and {beta}{gamma} subunits by treating cells with pertussis toxin prior to PDGF stimulation. We used ERK activation to demonstrate the efficacy and specificity of this pertussis toxin treatment (39): ERK activation by lysophosphatidic acid was abolished (Fig. 9A), but equivalent ERK activation by EGF was unaffected (data not shown). Under these conditions, pertussis toxin failed to alter PDGF-induced PDGFR{beta} seryl phosphorylation (Fig. 9A). In concert with our GRK2 knock-down studies (Fig. 5), these data demonstrate that {beta}{gamma} subunits of neither Gi nor Go are necessary for GRK2-mediated activity on the PDGFR{beta}.



View larger version (35K):
[in this window]
[in a new window]
  		FIG. 7.
PDGFR{beta}-mediated tyrosyl phosphorylation of GRK2 enhances GRK2 activity. HEK cells were co-transfected with plasmids encoding the WT or Y857F PDGFR{beta} constructs, and either GRK2 ("High GRK2 Level") or no protein (vector, "Native GRK2 Level," "N"). Cells were exposed to medium containing vehicle or 2 nM PDGF for 10 min (37 °C), and then solubilized. Cell lysates were processed for IP and IB as in Fig. 4. Top panel, the PDGFR{beta} blot was probed sequentially for the PDGFR{beta}, phosphoserine (pSer), and then phosphotyrosine (pTyr); the GRK2 blot was probed sequentially for pTyr and then GRK2. Shown are results from a single experiment, representative of three performed. Bottom panel, phosphoserine band densities were divided by cognate PDGFR{beta} band densities, and these ratios were normalized to those obtained from agonist-stimulated cells expressing WT PDGFR{beta}s and native GRK2 levels, to obtain "percent of control." Results are the means ± S.E. from three independent experiments. Compared with cognate values from cells expressing native GRK2 levels: *, p < 0.01.

 
Another mechanism by which GRK2 could translocate to the plasma membrane may involve PI3K. When the p85/p110-{alpha} PI3K heterodimer associates with the autophosphorylated PDGFR{beta} via the p85 SH2 domain (1), it could plausibly co-recruit GRK2 by virtue of the GRK2/p110-{alpha} interaction (40). To test this possibility, we compared PDGF-induced seryl phosphorylation of the WT and the Y740F/Y751F PDGFR{beta}, which lacks both phosphorylatable tyrosyl residues required for the PI3K p85 subunit recruitment (31). Despite its inability to recruit PI3K, the Y740F/Y751F PDGFR{beta} underwent PDGF-induced seryl phosphorylation to at least the same extent as the WT PDGFR{beta} (Fig. 9B). Together with our GRK2 knockdown data (Fig. 5), these data suggest that recruitment of GRK2 to the PDGFR{beta} does not require PI3K.

GRK2 Tyrosyl Phosphorylation Is Required for Full GRK2 Activity—For correlating GRK2 tyrosyl phosphorylation with GRK2 activity, we have thus far compared results obtained with the Y857F and WT PDGFR{beta}s. To complement this approach, we created Tyr-to-Phe GRK2 mutants to reduce GRK2 tyrosyl phosphorylation mediated by the WT PDGFR{beta}. Src-mediated phosphorylation of GRK2 has been shown to occur on tyrosyl residues 13, 86, and 92 (25). To test the hypothesis that the PDGFR{beta} phosphorylates the same GRK2 tyrosyl residues as c-Src, we made Tyr-to-Phe mutations at each of these three sites and compared tyrosyl phosphorylation of this "3YF" GRK2 mutant with that of WT GRK2. In cells, overexpressed c-Src was activated by stimulation of the {beta}2-adrenergic receptor (25), and the resulting tyrosyl phosphorylation of GRK2 was at least as much as that mediated by the WT PDGFR{beta} (Fig. 10). As expected from previous studies (25), the 3YF GRK2 mutations essentially eliminated GRK2 tyrosyl phosphorylation effected by c-Src. However, these mutations reduced by only 49% the GRK2 tyrosyl phosphorylation effected by the PDGFR{beta} (Fig. 10). Thus, GRK2 sites for PDGFR{beta}-mediated tyrosyl phosphorylation appear to overlap with and also extend beyond those sites phosphorylated by c-Src.



View larger version (24K):
[in this window]
[in a new window]
  		FIG. 8.
PDGFR{beta}-induced GRK2 down-regulation diminishes when the PDGFR{beta} cannot phosphorylate exogenous substrates. HEK cells stably expressing equivalent levels of either the WT or Y857F mutant PDGFR{beta} were exposed to medium lacking (unstimulated) or containing 2 nM PDGF-BB for the indicated times, and then lysed. 20 µg of cell protein was subjected to SDS-PAGE and serial immunoblotting for endogenous GRK2 and actin (as a loading control). GRK2 band densities were normalized to cognate actin band densities, and these ratios were normalized to those obtained for unstimulated WT cells to obtain "percent of control." Shown are results (mean ± S.E.) from three independent experiments (top panel), and representative immunoblots from two time points of a single experiment (bottom panel). For the comparison of WT with Y857F curves: p < 0.02.

 
Because PDGFR{beta}-mediated tyrosyl phosphorylation of the 3YF GRK2 mutant is reduced, we would expect that its activity on the PDGFR{beta} in intact cells would also be reduced. To test this expectation, we overexpressed WT or 3YF GRK2 in cells expressing the WT PDGFR{beta}, so that we could again define the portion of PDGFR{beta} seryl phosphorylation that represents GRK2 activity (as in Fig. 7). In this system, reduction of PDGFR{beta}-mediated GRK2 tyrosyl phosphorylation by the 3YF mutations reduced GRK2-mediated PDGFR{beta} seryl phosphorylation in intact cells by 50 ± 10% (p < 0.05, Fig. 11). (It is important to note that the 3YF GRK2 mutant has catalytic activity equivalent to WT GRK2 when it is used in purified protein systems (25).) Thus, whether altered by mutagenesis of the PDGFR{beta} or GRK2 itself, the degree of PDGFR{beta}-mediated GRK2 tyrosyl phosphorylation correlated with GRK2 activity, which is assessed as agonist-promoted seryl phosphorylation of the PDGFR{beta}.



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 9.
GRK2-mediated seryl phosphorylation of the PDGFR{beta} does not require Gi{beta}{gamma} subunits or PI3K. HEK cells were transfected with the WT (A and B) or the Y740F/Y751F mutant PDGFR{beta} (Y40/51F, panel B) at equivalent levels. A, cells were treated with pertussis toxin (PTX) (100 ng/ml) or vehicle ("-") in serum-free medium for 16 h, stimulated with PDGF-BB, solubilized, and subjected to PDGFR{beta} IP, IB, and analysis as in Fig. 7. PDGFR{beta} seryl phosphorylation in PTX-treated cells was 102 ± 6% of that seen in control cells (n = 3). Parallel aliquots of cells were stimulated (or not) with 10 µM LPA for 5 min at 37 °C, and then solubilized in SDS sample buffer and subjected to IB for phospho-ERK1/2 (A, lower panel). Blots were stripped and re-probed for actin. Shown are results from a single experiment, representative of three performed. B, cells were stimulated with PDGF-BB, solubilized, and subjected to PDGFR{beta} IP, IB, and analysis as in Fig. 7. Shown are results from a single experiment, representative of three performed.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
The model for GRK2-mediated PDGFR{beta} regulation acquires novel dimensions in light of this series of experiments. Upon PDGF-mediated cross-linking, the PDGFR{beta} phosphorylates GRK2 on tyrosyl residues and thereby activates GRK2-mediated phosphorylation of the PDGFR{beta} on seryl residues: an event that reduces PDGFR{beta} signaling (13, 14, 41, 42). Thus, by activating GRK2, PDGFR{beta} catalytic activity engages a previously unappreciated negative feedback loop. Support for this model emerges from several convergent lines of evidence in this study. Whether in purified protein preparations or in intact cells, the unique properties of the Y857F PDGFR{beta} mutant allowed us to identify GRK2 as a novel substrate for the PDGFR{beta}, and to distinguish PDGFR{beta}-from c-Src-mediated GRK2 tyrosyl phosphorylation. Furthermore, both PDGFR{beta} and GRK2 mutants furnished evidence in intact cells that PDGFR{beta}-mediated phosphorylation actually activates GRK2, by providing a direct correlation between PDGFR{beta}-mediated tyrosyl phosphorylation of GRK2 and GRK2-mediated seryl phosphorylation of the PDGFR{beta}.

This scheme for phosphorylation and activation of GRK2 by a receptor protein-tyrosine kinase bears striking resemblance to a scheme proposed for activation of GRK2 by heptahelical receptors and the non-receptor tyrosine kinase c-Src (26). For heptahelical receptors, however, the sequence of phosphorylation events and their intracellular consequences remain unclear. After agonist activation, heptahelical receptors are rapidly phosphorylated on Ser and Thr residues by GRKs (including GRK2), and these GRK-phosphorylated receptors subsequently bind to {beta}-arrestin isoforms (16). {beta}-Arrestin1 can associate with Src and thereby convey active Src into a complex containing activated receptors (43). Src could plausibly phosphorylate GRK2 within these complexes and thereby increase GRK2 catalytic activity (as demonstrated with purified proteins (24)), presumably on other nearby receptor substrates. In addition, Src may be recruited directly to heptahelical receptors containing appropriate Src SH2 domain target sequences and, subsequently, phosphorylate and activate GRK2 (26). However, although various perturbations of cellular Src activity have been shown to affect intact cell signaling evoked through the {beta}2-adrenergic receptor (26), Src-mediated GRK2 phosphorylation has not been shown to enhance GRK2-mediated phosphorylation of receptor substrates within intact cells. In contrast, we have shown that the PDGFR{beta} not only tyrosine-phosphorylates GRK2 but also serves as a GRK2 substrate. As a result, seryl phosphorylation of the PDGFR{beta} itself demonstrated in our study that GRK2 tyrosyl phosphorylation augments GRK2 activity on cellular receptor substrates, reflected by both PDGFR{beta} seryl phosphorylation and desensitization.



View larger version (44K):
[in this window]
[in a new window]
  		FIG. 10.
The PDGFR{beta} phosphorylates GRK2 tyrosyl residues within the GRK2 N-terminal domain. HEK cells were transfected with plasmids encoding WT GRK2 or the Y13/86/92F mutant GRK2 ("3YF"), along with either the PDGFR{beta}, both the {beta}2-adrenergic receptor ({beta}2AR) and c-Src, or empty vector ("-"). Cells were exposed to medium containing vehicle, 2 nM PDGF (PDGFR{beta} cells and vector cells), or 10 µM (-)isoproterenol ({beta}2-adrenergic receptor/Src cells) for 10 min (37 °C), and then solubilized. GRK2 was immunoprecipitated from lysates and subjected to SDS-PAGE and IB. Immunoblots were probed sequentially for phosphotyrosine (pY) and then GRK2. Shown in the top panel are the results of a single experiment, representative of three performed. The pY band densities were divided by cognate band densities for GRK2, and these ratios were normalized to those obtained for WT GRK2 immunoprecipitated from PDGF-stimulated cells expressing the PDGFR{beta} ("percent of control"). Plotted (bottom panel) are results (mean ± S.E.) from three independent experiments. For the comparison of 3YF with WT GRK2: *, p < 0.01.

 



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 11.
GRK2 activity is reduced by mutations that diminish GRK2 tyrosyl phosphorylation. HEK cells were co-transfected with plasmids encoding the WT PDGFR{beta} and either WT or Y13/86/92F mutant GRK2 ("3YF"), or left untransfected ("-"). After exposure to medium containing vehicle or 2 nM PDGF-BB for 10 min (37 °C), cells were solubilized and cell lysate aliquots were subjected to parallel IP for either PDGFR{beta} or GRK2, and subsequent immunoblotting. PDGFR{beta} blots were probed sequentially for PDGFR{beta} and then phosphoserine (pSer); GRK2 blots were probed sequentially for phosphotyrosine (pTyr) and GRK2. The immunoblots shown (upper panel) are from one experiment, representative of three performed. Band intensities for pSer and pTyr were divided by cognate band densities for the PDGFR{beta} or GRK2 (WT or 3YF), and these ratios were normalized to those obtained with cells expressing the PDGFR{beta} with WT GRK2, to obtain "percent of control." These values from three independent experiments are plotted (mean ± S.E.) in the lower panel. Compared with cells expressing WT GRK2: *, p < 0.03.

 
The molecular mechanisms by which PDGFR{beta}-mediated phosphorylation augments GRK2 activity remain obscure. Phosphorylation of GRK2 in its N-terminal domain could affect inhibitory intramolecular interactions within GRK2 itself (23). Indeed, this hypothesis is supported by the ability of purified GRK2 to phosphorylate partially purified, activated PDGFR{beta}s (14), even in the absence of the phospholipids or G{beta}{gamma} subunits required to activate GRK2-mediated phosphorylation of purified heptahelical receptors (44, 45). Congruent with this hypothesis, too, is the observation that GRK2 phosphorylation by Src can activate GRK2 catalytic activity in partially purified protein preparations (24). (Extrapolation from Src to the PDGFR{beta} is likely warranted here, because Src phosphorylates a subset of the GRK2 tyrosyl residues phosphorylated by the PDGFR{beta} (Fig. 7).) Alternatively, subcellular localization of the PDGFR{beta} and GRK2 may also provide a clue: the PDGFR{beta} localizes in caveolae after it is activated (46), and, like GRK2 (47), binds to caveolins (48). Like PDGFR autophosphorylation (48), GRK2 kinase activity is inhibited by caveolin-1 and -3 (47). Could tyrosyl phosphorylation of GRK2 on residues 13, 86, and 92 (Fig. 7) inhibit binding of caveolin-1 and -3 to their target GRK2 N-terminal subdomain comprising residues 63-70 (47)? If so, PDGFR{beta}-mediated GRK2 tyrosyl phosphorylation would relieve caveolin-mediated inhibition of GRK2. In such a scenario, GRK2-mediated desensitization of the PDGFR{beta} would augment putative PDGFR{beta} desensitization mediated by caveolin-1 and -3 (48). Such a scheme could also help to explain why only ~10% of GRK2 appears to be tyrosyl-phosphorylated by the PDGFR{beta}, and why G{beta}{gamma} subunits and PI3K are not necessary to recruit GRK2 to the PDGFFR{beta}: perhaps only GRK2 localized to caveolae is subject to PDGFR{beta}-mediated tyrosyl phosphorylation and activation. This proposal is summarized in Fig. 12.



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 12.
Proposed scheme for PDGFR{beta}-mediated activation of GRK2 and consequent PDGFR{beta} desensitization. A, dimerized by PDGF-BB and autophosphorylated, the PDGFR{beta} is depicted in a caveola (in which it resides (54) or to which it has migrated after stimulation (46)). Bound to (and inhibited by) caveolin-1 or -3 (47), GRK2 is co-localized to the caveola. The activated PDGFR{beta} phosphorylates GRK2 tyrosyl residues residing in the N-terminal domain (and possibly the C-terminal domain residues 553 or 651). B, activated by both tyrosyl phosphorylation and perhaps allosteric mechanisms involving the active conformation of the PDGFR{beta}, GRK2 dissociates from caveolin and phosphorylates the PDGFR{beta} on seryl residues (including Ser1104) (13), resulting in dissociation of the Na+/H+ exchanger regulatory factor from the PDGFR{beta}, and desensitization of downstream signaling through phospholipase C{gamma}-1 and PI3K (but not ERK) (13). Activated molecules are indicated by an asterisk and by shading; pS, phospho-serine; pY, phospho-tyrosine.

 
Although the PDGFR{beta} phosphorylates GRK2 on the same tyrosyl residues phosphorylated by c-Src (Fig. 10), only approximately half of the total PDGFR{beta}-mediated tyrosyl phosphorylation of GRK2 occurs on these residues. The primary structure of GRK2 lacks truly optimal target sequences for the PDGFR{beta} kinase, as identified by peptide library technologies (49). However, the GRK2 tyrosyl residues identified as Src and PDGFR{beta} targets (13, 86, and 92) do fall within acidic sequences (50) that could be presumptively identified (25) by extrapolating from data generated in vitro (49). Three additional GRK2 tyrosyl residues (112, 553, and 651) also reside in somewhat acidic subdomains of the GRK2 N- and C-terminal domains (51). Therefore, these residues may constitute the remaining PDGFR{beta} target sites for phosphorylation in GRK2. It is conceivable that tyrosyl phosphorylation of GRK2 in either the N- or C-terminal domains could disrupt proposed intramolecular inhibitory interactions that tonically constrain GRK2 activity (23). However, the potential functional consequences of PDGFR{beta}-mediated phosphorylation of GRK2 at these sites are yet to be determined.

PDGFR{beta}-mediated phosphorylation of GRK2 triggers GRK2-mediated phosphorylation and consequent desensitization of the PDGFR{beta} (13, 14, 41, 42), but other signal transduction engaged by the PDGFR{beta} may also modulate GRK2 activity. Activation of protein kinase C or Src (1) can increase GRK2 catalytic activity (16, 24, 26), independently from allosteric GRK2 activation effected by the agonist-activated receptor. In contrast, PDGFR{beta}-evoked activation of ERKs can diminish GRK2 catalytic activity (52) and enhance its degradation (53). Thus, the net desensitizing effect of GRK2 on the PDGFR{beta} (13, 14) likely results from the integration of multiple influences emanating from the PDGFR{beta} itself.

PDGFR{beta}-mediated tyrosyl phosphorylation of GRK2 represents a novel mechanism for intracellular GRK2 activation, and may well explain the ability of GRK2 to phosphorylate the PDGFR{beta} in purified protein preparations (14). Our findings prompt the speculation that the PDGFR{beta} could phosphorylate and activate other members of the GRK family of Ser/Thr kinases, which also bind to and are inhibited by caveolins (47). Indeed, it remains to be established whether PDGFR{beta}-mediated phosphorylation affects multiple GRKs, or whether multiple GRKs can phosphorylate and desensitize the PDGFR{beta}.


   FOOTNOTES
 
* This work was supported, in part, by National Institutes of Health Grants HL63288 and HL77185 (to N. J. F.) and HL64744 (to K. P.) and by an American Heart Association grant-in-aid (to N. J. F.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} Supported by a Glenn/American Federation for Aging Research Student Scholarship. Back

§ Supported by a Eugene Stead Medical Student Scholarship. Back

Present address: Dept. of Molecular Genetics, University of Cincinnati, Cincinnati, OH 45267. Back

|| To whom correspondence should be addressed: Duke University Medical Center, Box 3187, Durham, NC 27710. Tel.: 919-684-6873; Fax: 919-684-6870; E-mail: neil.freedman{at}duke.edu.

1 The abbreviations used are: PDGFR{beta}, platelet-derived growth factor receptor-{beta}; GRK2, G protein-coupled receptor kinase-2; WT, wild type; ERK, extracellular signal-regulated kinase; VASP, vasodilator- and A kinase-stimulated phosphoprotein; siRNA, small interfering RNA; PKA, cAMP-dependent protein kinase; HEK, human embryonic kidney; IP, immunoprecipitation or immunoprecipitate; IB, immunoblot or immunoblotting; PI3K, phosphoinositide 3-kinase. Back


   ACKNOWLEDGMENTS
 
We are grateful to Daryl Capel for purifying GRK2, and to Dr. Sudha K. Shenoy for helpful discussions.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Heldin, C. H., Ostman, A., and Ronnstrand, L. (1998) Biochim. Biophys. Acta 1378, F79-F113[Medline] [Order article via Infotrieve]
  2. Sano, H., Sudo, T., Yokode, M., Murayama, T., Kataoka, H., Takakura, N., Nishikawa, S., Nishikawa, S. I., and Kita, T. (2001) Circulation 103, 2955-2960[Abstract/Free Full Text]
  3. Ross, R. (1999) N. Engl. J. Med. 340, 115-126[Free Full Text]
  4. Boucher, P., Gotthardt, M., Li, W. P., Anderson, R. G., and Herz, J. (2003) Science 300, 329-332[Abstract/Free Full Text]
  5. George, D. (2001) Semin. Oncol. 28, 27-33[Medline] [Order article via Infotrieve]
  6. Bergers, G., Song, S., Meyer-Morse, N., Bergsland, E., and Hanahan, D. (2003) J. Clin. Invest. 111, 1287-1295[CrossRef][Medline] [Order article via Infotrieve]
  7. Hubbard, S. R., and Till, J. H. (2000) Annu. Rev. Biochem. 69, 373-398[CrossRef][Medline] [Order article via Infotrieve]
  8. Baxter, R. M., Secrist, J. P., Vaillancourt, R. R., and Kazlauskas, A. (1998) J. Biol. Chem. 273, 17050-17055[Abstract/Free Full Text]
  9. Klinghoffer, R. A., and Kazlauskas, A. (1995) J. Biol. Chem. 270, 22208-22217[Abstract/Free Full Text]
  10. Chiarugi, P., Cirri, P., Raugei, G., Camici, G., Dolfi, F., Berti, A., and Ramponi, G. (1995) FEBS Lett. 372, 49-53[CrossRef][Medline] [Order article via Infotrieve]
  11. Sorkin, A., Westermark, B., Heldin, C. H., and Claesson-Welsh, L. (1991) J. Cell Biol. 112, 469-478[Abstract/Free Full Text]
  12. Mori, S., Heldin, C. H., and Claesson-Welsh, L. (1992) J. Biol. Chem. 267, 6429-6434[Abstract/Free Full Text]
  13. Hildreth, K. L., Wu, J. H., Barak, L. S., Exum, S. T., Kim, L. K., Peppel, K., and Freedman, N. J. (2004) J. Biol. Chem. 279, 41775-41782[Abstract/Free Full Text]
  14. Freedman, N. J., Kim, L. K., Murray, J. P., Exum, S. T., Brian, L., Wu, J. H., and Peppel, K. (2002) J. Biol. Chem. 277, 48261-48269[Abstract/Free Full Text]
  15. Bioukar, E. B., Marricco, N. C., Zuo, D., and Larose, L. (1999) J. Biol. Chem. 274, 21457-21463[Abstract/Free Full Text]
  16. Pitcher, J. A., Freedman, N. J., and Lefkowitz, R. J. (1998) Annu. Rev. Biochem. 67, 653-692[CrossRef][Medline] [Order article via Infotrieve]
  17. Maudsley, S., Zamah, A. M., Rahman, N., Blitzer, J. T., Luttrell, L. M., Lefkowitz, R. J., and Hall, R. A. (2000) Mol. Cell Biol. 20, 8352-8363[Abstract/Free Full Text]
  18. Benovic, J. L., Strasser, R. H., Caron, M. G., and Lefkowitz, R. J. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 2797-2801[Abstract/Free Full Text]
  19. Benovic, J. L., Mayor, F., Jr., Somers, R. L., Caron, M. G., and Lefkowitz, R. J. (1986) Nature 321, 869-872[CrossRef][Medline] [Order article via Infotrieve]
  20. Benovic, J. L., Regan, J. W., Matsui, H., Mayor, F., Jr., Cotecchia, S., Leeb-Lundberg, L. M., Caron, M. G., and Lefkowitz, R. J. (1987) J. Biol. Chem. 262, 17251-17253[Abstract/Free Full Text]
  21. Richardson, R. M., Kim, C., Benovic, J. L., and Hosey, M. M. (1993) J. Biol. Chem. 268, 13650-13656[Abstract/Free Full Text]
  22. Freedman, N. J., Liggett, S. B., Drachman, D. E., Pei, G., Caron, M. G., and Lefkowitz, R. J. (1995) J. Biol. Chem. 270, 17953-17961[Abstract/Free Full Text]
  23. Sarnago, S., Roca, R., de Blasi, A., Valencia, A., Mayor, F., Jr., and Murga, C. (2003) Mol. Pharmacol. 64, 629-639[Abstract/Free Full Text]
  24. Sarnago, S., Elorza, A., and Mayor, F., Jr. (1999) J. Biol. Chem. 274, 34411-34416[Abstract/Free Full Text]
  25. Penela, P., Elorza, A., Sarnago, S., and Mayor, F., Jr. (2001) EMBO J. 20, 5129-5138[CrossRef][Medline] [Order article via Infotrieve]
  26. Fan, G., Shumay, E., Malbon, C. C., and Wang, H. (2001) J. Biol. Chem. 276, 13240-13247[Abstract/Free Full Text]
  27. Shih, M., and Malbon, C. C. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 12193-12197[Abstract/Free Full Text]
  28. Barak, L. S., Tiberi, M., Freedman, N. J., Kwatra, M. M., Lefkowitz, R. J., and Caron, M. G. (1994) J. Biol. Chem. 269, 2790-2795[Abstract/Free Full Text]
  29. Miller, W. E., Maudsley, S., Ahn, S., Khan, K. D., Luttrell, L. M., and Lefkowitz, R. J. (2000) J. Biol. Chem. 275, 11312-11319[Abstract/Free Full Text]
  30. Collins, S. P., and Uhler, M. D. (1999) J. Biol. Chem. 274, 8391-8404[Abstract/Free Full Text]
  31. Kashishian, A., Kazlauskas, A., and Cooper, J. A. (1992) EMBO J. 11, 1373-1382[Medline] [Order article via Infotrieve]
  32. Ren, X. R., Reiter, E., Ahn, S., Kim, J., Chen, W., and Lefkowitz, R. J. (2005) Proc. Natl. Acad. Sci. U. S. A. 102, 1448-1453[Abstract/Free Full Text]
  33. Freedman, N. J., Ament, A. S., Oppermann, M., Stoffel, R. H., Exum, S. T., and Lefkowitz, R. J. (1997) J. Biol. Chem. 272, 17734-17743[Abstract/Free Full Text]
  34. Oppermann, M., Diverse-Pierluissi, M., Drazner, M. H., Dyer, S. L., Freedman, N. J., Peppel, K. C., and Lefkowitz, R. J. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 7649-7654[Abstract/Free Full Text]
  35. Walter, A. O., Peng, Z. Y., and Cartwright, C. A. (1999) Oncogene 18, 1911-1920[CrossRef][Medline] [Order article via Infotrieve]
  36. Oak, J. N., Lavine, N., and Van Tol, H. H. (2001) Mol. Pharmacol. 60, 92-103[Abstract/Free Full Text]
  37. Butt, E., Abel, K., Krieger, M., Palm, D., Hoppe, V., Hoppe, J., and Walter, U. (1994) J. Biol. Chem. 269, 14509-14517[Abstract/Free Full Text]
  38. Penela, P., Ruiz-Gomez, A., Castano, J. G., and Mayor, F., Jr. (1998) J. Biol. Chem. 273, 35238-35244[Abstract/Free Full Text]
  39. Luttrell, L. M., van Biesen, T., Hawes, B. E., Koch, W. J., Touhara, K., and Lefkowitz, R. J. (1995) J. Biol. Chem. 270, 16495-16498[Abstract/Free Full Text]
  40. Naga Prasad, S. V., Barak, L. S., Rapacciuolo, A., Caron, M. G., and Rockman, H. A. (2001) J. Biol. Chem. 276, 18953-18959[Abstract/Free Full Text]
  41. Peppel, K., Jacobson, A., Huang, X., Murray, J. P., Oppermann, M., and Freedman, N. J. (2000) Circulation 102, 793-799[Abstract/Free Full Text]
  42. Peppel, K., Zhang, L., Huynh, T. T., Huang, X., Jacobson, A., Brian, L., Exum, S. T., Hagen, P. O., and Freedman, N. J. (2002) J. Mol. Cell Cardiol. 34, 1399-1409[CrossRef][Medline] [Order article via Infotrieve]
  43. Luttrell, L. M., Ferguson, S. S. G., Daaka, Y., Miller, W. E., Maudsley, S., Della Rocca, G. J., Lin, F. T., Kawakatsu, H., Owada, K., Luttrell, D. K., Caron, M. G., and Lefkowitz, R. J. (1999) Science 283, 655-661[Abstract/Free Full Text]
  44. Pitcher, J. A., Touhara, K., Payne, E. S., and Lefkowitz, R. J. (1995) J. Biol. Chem. 270, 11707-11710[Abstract/Free Full Text]
  45. Onorato, J. J., Gillis, M. E., Liu, Y., Benovic, J. L., and Ruoho, A. E. (1995) J. Biol. Chem. 270, 21346-21353[Abstract/Free Full Text]
  46. Matveev, S. V., and Smart, E. J. (2002) Am. J. Physiol. 282, C935-C946
  47. Carman, C. V., Lisanti, M. P., and Benovic, J. L. (1999) J. Biol. Chem. 274, 8858-8864[Abstract/Free Full Text]
  48. Yamamoto, M., Toya, Y., Jensen, R. A., and Ishikawa, Y. (1999) Exp. Cell Res. 247, 380-388[CrossRef][Medline] [Order article via Infotrieve]
  49. Zhou, S., Carraway, K. L., Eck, M. J., Harrison, S. C., Feldman, R. A., Mohammadi, M., Schlessinger, J., Hubbard, S. R., Smith, D. P., Eng, C., Lorenzo, M. J., Ponder, B. A. J., Mayer, B. J., and Cantley, L. C. (1995) Nature 373, 536-539[CrossRef][Medline] [Order article via Infotrieve]
  50. Benovic, J. L., DeBlasi, A., Stone, W. C., Caron, M. G., and Lefkowitz, R. J. (1989) Science 246, 235-240[Abstract/Free Full Text]
  51. Inglese, J., Freedman, N. J., Koch, W. J., and Lefkowitz, R. J. (1993) J. Biol. Chem. 268, 23735-23738[Free Full Text]
  52. Pitcher, J. A., Tesmer, J. J., Freeman, J. L., Capel, W. D., Stone, W. C., and Lefkowitz, R. J. (1999) J. Biol. Chem. 274, 34531-34534[Abstract/Free Full Text]
  53. Elorza, A., Penela, P., Sarnago, S., and Mayor, F., Jr. (2003) J. Biol. Chem. 278, 29164-29173[Abstract/Free Full Text]
  54. Liu, P., Ying, Y., Ko, Y. G., and Anderson, R. G. (1996) J. Biol. Chem. 271, 10299-10303[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Pharmacol.Home page
X. Cai, J.-H. Wu, S. T. Exum, M. Oppermann, R. T. Premont, S. K. Shenoy, and N. J. Freedman
Reciprocal Regulation of the Platelet-Derived Growth Factor Receptor-{beta} and G Protein-Coupled Receptor Kinase 5 by Cross-Phosphorylation: Effects on Catalysis
Mol. Pharmacol., March 1, 2009; 75(3): 626 - 636.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
Y. Chen, H. Long, Z. Wu, X. Jiang, and L. Ma
EGF Transregulates Opioid Receptors through EGFR-mediated GRK2 Phosphorylation and Activation
Mol. Biol. Cell, July 1, 2008; 19(7): 2973 - 2983.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J.-H. Wu, R. Goswami, X. Cai, S. T. Exum, X. Huang, L. Zhang, L. Brian, R. T. Premont, K. Peppel, and N. J. Freedman
Regulation of the Platelet-derived Growth Factor Receptor-beta by G Protein-coupled Receptor Kinase-5 in Vascular Smooth Muscle Cells Involves the Phosphatase Shp2
J. Biol. Chem., December 8, 2006; 281(49): 37758 - 37772.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/35/31027    most recent
M501473200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, J.-H.
Right arrow Articles by Freedman, N. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, J.-H.
Right arrow Articles by Freedman, N. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement