HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 280, Issue 37, 32493-32498, September 16, 2005

This Article Abstract Full Text (PDF) All Versions of this Article: 280/37/32493    most recent M505070200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Pelz, A. Articles by Götz, F. Search for Related Content PubMed PubMed Citation Articles by Pelz, A. Articles by Götz, F. Social Bookmarking                      What's this?

Structure and Biosynthesis of Staphyloxanthin from Staphylococcus aureus^*

Alexandra Pelz, Karsten-Peter Wieland, Karsten Putzbach, Petra Hentschel, Klaus Albert, and Friedrich Götz1

From the Department of Microbial Genetics and the Institute of Organic Chemistry, University of Tuebingen, D-72076 Tuebingen, Germany

Received for publication, May 9, 2005 , and in revised form, July 11, 2005.

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Most Staphylococcus aureus strains produce the orange carotenoid staphyloxanthin. The staphyloxanthin biosynthesis genes are organized in an operon, crtOPQMN, with a ^B-dependent promoter upstream of crtO and a termination region downstream of crtN. The functions of the five encoded enzymes were predicted on the basis of their sequence similarity to known enzymes and by product analysis of gene deletion mutants. The first step in staphyloxanthin biosynthesis is the head-to-head condensation of two molecules of farnesyl diphosphate to form dehydrosqualene (4,4'-diapophytoene), catalyzed by the dehydrosqualene synthase CrtM. The dehydrosqualene desaturase CrtN dehydrogenates dehydrosqualene to form the yellow, main intermediate 4,4'-diaponeurosporene. CrtP, very likely a mixed function oxidase, oxidizes the terminal methyl group of 4,4'-diaponeurosporene to form 4,4'-diaponeurosporenic acid. CrtQ, a glycosyltransferase, esterifies glucose at the C₁'' position with the carboxyl group of 4,4'-diaponeurosporenic acid to yield glycosyl 4,4'-diaponeurosporenoate; this compound was the major product in the clone expressing crtPQMN. In the final step, the acyltransferase CrtO esterifies glucose at the C₆'' position with the carboxyl group of 12-methyltetradecanoic acid to yield staphyloxanthin. Staphyloxanthin overexpressed in Staphylococcus carnosus (pTX-crtOPQMN) and purified was analyzed by high pressure liquid chromatography-mass spectroscopy and NMR spectroscopy. Staphyloxanthin was identified as -D-glucopyranosyl 1-O-(4,4'-diaponeurosporen-4-oate)-6-O-(12-methyltetradecanoate).

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The species epithet of Staphylococcus aureus reflects the color of its colonies (L. aureus: golden) and distinguish this species from Staphylococcus epidermidis (formerly Staphylococcus albus) (1). The orange pigmentation of S. aureus had been used as a species character until colorless strains were observed (2). The pigment name staphyloxanthin was first mentioned by Marshall and Rodwell (33). In pioneering work, Marshall and Wilmoth (3) isolated the pigments from S. aureus and chemically analyzed 17 intermediary products, identifying them as triterpenoid carotenoids possessing a C₃₀ chain instead of the C₄₀ carotenoid structure found in most other organisms (4). The main pigment, staphyl oxanthin, was identified as -D-glucopyranosyl 1-O-(4,4'-diaponeurosporen-4-oate)-6-O-(12-methyltetradecanoate), in which glucose is esterified with both a triterpenoid carotenoid carboxylic acid and a C₁₅ fatty acid.

In previous work, we cloned the genes for staphyloxanthin biosynthesis from S. aureus and analyzed the function of two enzymes involved in the pathway (5). The biosynthesis of the pigment starts with the head-to-head condensation of two farnesyl diphosphate molecules, catalyzed by the dehydrosqualene synthase CrtM, to yield 4,4'-diapophytoene (dehydrosqualene). Dehydrosqualene desaturase, CrtN, catalyzes the formation of the first deep yellow-colored carotenoid intermediate product, 4,4'-diaponeurosporene, which is formed via successive dehydrogenation reactions (5).

Here, we analyzed the complete staphyloxanthin biosynthesis operon crtOPQMN. We postulated the function of the encoded proteins based on product analysis of crt mutants and sequence similarity comparisons. Staphyloxanthin was purified, and its structure was determined by NMR spectroscopy.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Growth Media, DNA Manipulations, and Transformation—Standard procedures for DNA manipulations, plasmid DNA isolation, transformation of Escherichia coli, and preparation of liquid media and agar plates for bacterial growth were followed. Plasmid DNA was introduced into Staphylococcus carnosus strain TM300 and S. aureus strain Newman by protoplast transformation (6). S. carnosus and S. aureus were grown in tryptic soy broth medium (Invitrogen) or LB medium (1% tryptone, 0.5% yeast extract, and 0.5% NaCl). The plasmid vectors pCA44 (7, 8) and the xylose-inducible pTX15 (9, 10) were used; for induction in the latter case, xylose was added to the medium to a final concentration of 0.5%. PCR was carried out with Vent® polymerase (New England Biolabs) or Expand^TM Long Template PCR System (Roche Applied Science). The staphyloxanthin biosynthesis genes upstream of crtM were sequenced via primer walking using a LI-COR DNA sequencer Long Reader 4200 (Lincoln Corporation, Lincoln, NE). Sequences were analyzed using MacDNASIS Pro software (Hitachi Software Engineering, San Bruno, CA).

Primers used for PCR, primer extension, and PCR-digoxigenin labeling. The following primers were used to amplify the crt genes: 1-N/R, TTTGGATCCTTGCTTCTGCAGGTCATCCGG; L3SstI, TTTGAGCTCTTGTATAACGCCCATCAAGGTACG; crtP/R, TTTGGATCCAGATTAACGCAGTTACTACGC; crtQ/R, TTTGGATCCTTATCGTTCTAATCGTGGTGC; MN/R, TTTGGATCCTTCTGCATCGAAGGGTCGGCC; and NN/R, TTTGGATCCTTCTTGGACGAAGTTGAGACAGGC. The following primers were used to amplify the 515-bp crt promoter fragment: PR, TTGGATCCTTGTGACTACAACTGCAGCGCC; and PL, TTTGAGCTCTTCACTCTCAATCATACTGAC. For the PCR-digoxigenin labeling, the following primers were used: crtM/R2, TTTGGATCCTTAACAAACGCATCGTTATGG; crtM/L2, TTTGAGCTCTTCATGAAACAACTTTGCC; IK 15, ATGGTCATCTTGTTGCCCC; and IK 16, GAATACAGATGCACAGG. The nucleotides underlined in the primers indicate a BamHI or SstI restriction site.

Growth Conditions and Pigment Extraction—Staphyloxanthin and intermediate carotenoids were isolated from recombinant S. carnosus clones. Cells were grown at 37 °C for 24 h in 0.5 liters of tryptic soy broth supplemented with 0.5% xylose. Cultures were centrifuged, and the cell pellets were either used immediately or stored at -70 °C; at this temperature, the carotenoids were stable for several months. Pigments were extracted by resuspending the cell pellet in 10 ml of ethanol and incubating for 20 min at 40 °C. After centrifugation, the supernatant containing the pigments was concentrated to small volumes in vacuo and then extracted with ethyl acetate/1.7 M aqueous NaCl (1:1, v/v). The colored ethyl acetate extract was dried with anhydrous Na₂SO₄, and the solvent was removed in vacuo (crude extract). The residue was dissolved in ethyl acetate and subjected to silica gel 60 (1.5–4.0 µm, Merck) column chromatography. The colored fractions were eluted with ethyl acetate, and the individual fractions were evaporated to dryness. Because of the light sensitivity of the pigments, all further purification steps were carried out in the dark.

Thin-layer Chromatography (TLC) and Spectral Analysis—Pigment crude extracts were separated on RP-18 F_254S plates (Merck) with methanol-acetonitrile (1:1, v/v). The pigment bands were scratched off the preparative TLC plates and dissolved in ethyl acetate, and the absorption spectra were recorded (Uvikon 940, Kontron).

HPLC—Carotenoid extracts were analyzed by HPLC² on an HP1100 HPLC system (Agilent Technologies, Waldbronn, Germany) with a 250 x 4.6 mm ProntoSil C30 stainless steel column (particle size 3 µm, average pore diameter 200 Å; Bischoff, Leonberg, Germany) and UV light detection at 450 nm. The compounds (50-µl injection sample) were separated with an acetone/water gradient (0 min, 90% acetone; 0–20 min, linear gradient to 100% acetone; 21–30 min, 100% acetone) at a flow rate of 1 ml/min.

HPLC-MS—Mass spectroscopy was performed on a Brucker Esquire 3000plus ion-trap mass spectrometer (Bruker Daltonik, Bremen, Germany) equipped with an atmospheric pressure chemical ionization ion source. The mass spectra were recorded in the positive ion mode in the mass range from m/z 300 to 1000. The voltage of the corona needle was optimized, resulting in a current of 4–8 µA. Nitrogen was the drying and carrier gas (300 °C). The temperature of the ionization chamber was set to 300 °C.

GC-MS—The GC-MS measurements were performed on a HP 6890/5970 GC-MS system. For the sugar verification, 0.6 N HCl in methanol (200 µl) and 50 µl of methylacetate was added to the compound. The solution was stored for 16 h at 70 °C. Then dichloromethane was added, and the solvent was removed under a nitrogen stream at room temperature. 30 µl of absolute pyridine and bis(trimethylsilyl)trifluoracetamide was added and heated for one h at 60 °C. The GC separation was performed on a DB-5 column. To verify the result, the measurement was repeated with an added glucose standard.

NMR Spectroscopy—The structure of staphyloxanthin was determined on a computer-controlled Bruker 700 MHz UltraShield Spectrometer (magnetic field strength 16.44 Tesla, proton resonance 700.13 MHz) at Bruker Biospin AG (Faellanden, Switzerland) using preparative amounts purified from S. carnosus (pTXcrtOPQMN). A ¹H{¹³C/¹⁵N} cryoprobe with a Z gradient (700 MHz, 5 mm TXI H-C/N; Bruker Biospin AG) was used. The data were analyzed with XWINNMR 3.0 software (Bruker Daltonik) in our laboratory. All resonances for the structure elucidation of staphyloxanthin were unambiguously assigned; the results from one-dimensional ¹H and ¹³C NMR spectra and from two-dimensional NMR spectra (¹H,¹H-COSY, TOCSY, HSQC, HMBC, NOESY, ROESY) were combined.

View larger version (23K): [in this window] [in a new window]   FIGURE 1. crt operon and its expression in S. carnosus. A, organization of the crt genes in the S. aureus Newman genome (sequence accession X97985 [GenBank] , submitted in 1996). The same organization is also found in the published genome of S. aureus N315: crtO (SA2352), crtP (SA2351), crtQ (SA2350), crtM (SA2349), and crtN (SA2348). B, construction of truncated crt expression plasmids. C, colonies of S. carnosus wild-type (left) and S. carnosus (pTXcrtOPQMN) expressing staphyloxanthin (right).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The function of two biosynthesis genes had been analyzed earlier; crtM encodes dehydrosqualene synthase, and crtN encodes dehydrosqualene desaturase (5). In the current study, the nucleotide sequence revealed an operon composed of five genes (Fig. 1A). Following our previous nomenclature of crtM and crtN, we named the upstream genes crtO, crtP, and crtQ (operon crtOPQMN). We cloned the crt genes in the xylose-inducible expression vector pTX15 by deleting stepwise gene by gene from the 5'-end (Fig. 1B). Staphyloxanthin expression studies showed that all five genes are necessary for staphyloxanthin biosynthesis. The nucleotide sequences of the staphyloxanthin biosynthesis genes of S. aureus strain Newman and S. aureus N315 (11) are almost identical. When expression of crtOPQMN was induced in S. carnosus, colonies were strongly orange pigmented (Fig. 1C).

A functional sigB operon is necessary for the synthesis of staphyloxanthin in S. aureus (12). The identification in the current study of a ^B-dependent promoter upstream of crtO explains this requirement. In earlier studies, we were uncertain whether the open reading frame orf1 lying upstream of the sigB promoter region is involved in staphyloxanthin biosynthesis. Here we showed that this gene is not involved in staphyloxanthin biosynthesis because its deletion had no effect on staphyloxanthin production. Furthermore, the predicted protein product of orf1 shows sequence similarity to the staphylococcal secretory antigen (13).

In the published S. aureus genome sequences, the crtOPQNM genes are highly conserved, have the same gene organization, and appear to be located at the same genomic site. Data base searches with CrtOPQ proteins revealed only for the CrtP and CrtQ hints as to their function.

CrtO (20.3 kDa) has no sequence similarities to any other carotenoid biosynthesis proteins known. The highest sequence similarity (identity: 34%; similarity: 59%) is with a protein from Oceanobacillus iheyensis HTE831, an alkaliphilic and extremely halotolerant Bacillus-related species isolated from deep sea sediment (14). We propose that CrtO is an acyltransferase that catalyzes the last step in staphyloxanthin biosynthesis, namely the acetylation of glucosyl-4,4'-diaponeurosporenoate.

View larger version (22K): [in this window] [in a new window]   FIGURE 2. Analysis of the major product of S. carnosus (pTXcrtPQMN). A, HPLC-UV analysis revealed glycosyl-4,4'-diaponeurosporenoate (absorption maxima, 460 and 483 nm) as a major peak and 4,4'-diaponeurosporenoate (absorption maxima, 455 and 483 nm) as a minor peak. B, mass analysis of glycosyl-4,4'-diaponeurosporenoate yielded the unglycosylated form because of the instability of the glycosidic bond to ionization. Note, glucose was separately verified by GC-MS.

View larger version (17K): [in this window] [in a new window]   FIGURE 3. HPLC analysis. A, HPLC-UV analysis of a crude extract of S. carnosus (pTXcrtOPQMN) separated on a C30 column. B, HPLC-UV analysis of purified staphyloxanthin used for NMR analysis. C, Absorption spectrum of purified staphyloxanthin. Note the peaks at 463 and 490 nm.

CrtQ (42.5 kDa) shows sequence similarities to galactosyltransferase and glycosyltransferase of Prochlorococcus marinus (identity, 26%; similarity, 44%) (19) and Chlorobium tepidum (identity, 25%; similarity, 43%) (20) and to glycosyltransferases involved in cell wall biogenesis in Magnetospirillum magnetotacticum (identity, 26%; similarity, 42%) (accession number: NZ_AAAP01002898). The highest similarity was again found with a hypothetical conserved protein of O. iheyensis HTE831 (identity, 36%; similarity, 57%) (14). Interestingly, CrtQ also has similarity to the processive glycosyltransferase IcaA of S. aureus (identity: 23%; similarity: 41%) and S. epidermidis (identity: 22%; similarity: 41%) (21–23). Five strictly conserved amino acids are involved in the catalytic function of processive glycosyltransferases. In a ,,-glycosyltransferase model, the catalytic amino acids are organized in two domains. Domain D1 contains one amino acid, and domain D2 contains four amino acids (24). Non-processive glycosyltransferases (transferases that transfer only one monosaccharide) have only the one conserved amino acid in domain D1. The alignment of the CrtQ and processive glycosyltransferase IcaA sequences shows that CrtQ has only the conserved amino acid in domain D1; no sequence similarities to the strictly conserved amino acids of domain D2 were detected. Therefore, CrtQ appears to be a member of the non-processive glycosyltransferase family and very likely catalyzes the glycosylation of 4,4'-diaponeurosporenoate. To investigate the function of carotenoid biosynthesis genes and the metabolic products, subsets of the crt genes were cloned into the xylose-inducible expression vector pTX15 (25) behind the xylA promoter, creating plasmids pTX-orf1OPQMN, pTXcrtOPQMN, pTX-crtPQMN, pTXcrtQMN, pTXcrtMN, and pTXcrtM (Fig. 1B).

View larger version (19K): [in this window] [in a new window]   FIGURE 4. NMR structure and mass analysis. A, structure of staphyloxanthin elucidated from NMR spectroscopy analysis; the fragments obtained after ionization and the corresponding masses are indicated. B, NMR mass spectra. Identified compounds, ionizations, and masses are indicated.

Our data indicate that the oxidation of the terminal methyl side group of 4,4'-diaponeurosporene to 4,4'-diaponeurosporenoate is the next biosynthetic step and that this reaction is catalyzed by CrtP. CrtP is therefore a diaponeurosporene oxidase that converts 4,4'-diaponeurosporene very likely via an aldehyde, 4,4'-diaponeurosporenal (26) to the carboxylic acid carotenoid, 4,4'-diaponeurosporenoate.

The next proposed step, the glycosylation of 4,4'-diaponeurosporenoate to form glycosyl-4,4'-diaponeurosporenoate, is very likely catalyzed by CrtQ, which shows sequence similarity to glycosyltransferases. Indeed, we found that S. carnosus (pTXcrtPQMN) produced as a major product glycosyl-4,4'-diaponeurosporenoate (absorption maxima: 460 and 483 nm) and to a minor extent 4,4'-diaponeurosporenoate (absorption maxima: 401, 422, and 444 nm) (Fig. 2A). To prove that the major peak represents glycosyl-4,4'-diaponeurosporenoate the corresponding carotenoid was purified and subjected to both MS and sugar analysis. The MS analysis yielded a mass of 433.1 that corresponds to 4,4'-diaponeurosporenoate [M+H]⁺ (Fig. 2B). The reason why we did not see the glycosylated form was because of the high instability of the glycosidic bond to ionization. Therefore, we verified the sugar by GC-MS. The purified carotenoid was subjected to acid hydrolysis as described in Materials and Methods, and by GC separation glucose could be unambiguously identified. These results clearly indicate that CrtQ is the glycosyltransferase.

The last step in the pathway is the esterification of the glycosyl residue with a fatty acid. Only in clones containing pTXcrtOPQMN, which carries all five crt genes, was staphyloxanthin produced. Although CrtO shows no sequence similarity to known enzymes, it must catalyze the last step in staphyloxanthin biosynthesis, namely the acylation of glycosyl-4,4'-diaponeurosporenoate. Structure analysis indicates that it is a glycosyl-C₆''-O-acyltransferase.

NMR Structure of Staphyloxanthin—The main carotenoid in the crude extract of S. carnosus (pTXcrtOPQMN) was staphyloxanthin, as shown in the HPLC profile (Fig. 3A). The carotenoid was purified further by silica gel chromatography, followed by preparative HPLC, yielding a final compound with a high degree of purity (Fig. 3B) and an absorption spectrum with peaks at 463 and 490 nm, characteristic for staphyloxanthin (Fig. 3C). The NMR spectrum identified staphyloxanthin as a -D-glucopyranosyl 1-O-(4,4'-diaponeurosporen-4-oate)-6-O-(12-methyltetradecanoate). The central core of the structure is glucose-esterified at position C₁'' with the carotenoid 4,4'-diaponeurosporenic acid and at position C₆'' with the C₁₅ fatty acid 12-methyltetradecanoic acid (Fig. 4A). Our NMR structure of staphyloxanthin essentially confirmed the structure determined earlier in an excellent study by Marshall and Wilmoth (3) mainly by chemical methods. The only difference found is the configuration of glucose. In nature, D-sugars in glycosides are normally -glycosidically linked, whereas l-sugars are -glycosidically linked. Moss (27) proposed -D-glucose as the glycoside of staphyloxanthin. Here we show that the core is a -D-glucopyranose.

Characteristic fragments in the mass spectrum were obtained after ionization (Fig. 4B). The C₁'' glycosidic binding appears to be quite unstable to ionization because the peak at m/z 433.1 (4,4'-diaponeurosporenoate [M+H]⁺) is much higher than the peak at m/z 819.3 (staphyloxanthin [M+H]⁺). The mass spectrum also revealed peaks for staphyloxanthin [M+H-H₂O]⁺ (m/z 801.2) and 4,4'-diaponeurosporenaldehyde [M] (m/z 415.1). A summary of some characteristics of the identified carotenoids in the various S. carnosus (pTX-) clones is shown in TABLE ONE.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

View larger version (26K): [in this window] [in a new window]   FIGURE 5. Proposed staphyloxanthin biosynthesis pathway.

In the various S. aureus genomes sequenced, seven identified genes are involved in the mevalonate pathway, based on sequence similarities and biochemical studies (30). The following reactions have been proposed: 1) condensation of two molecules of acetyl-CoA to form aceto-acetyl-CoA, catalyzed by acetyl-CoA acetyltransferases; acetyl-CoA acetyltransferase homologues (SA0223) are present in various staphylococcal genomes; 2) Claisen condensation of acetyl-CoA with aceto-acetyl-CoA to yield HMG-CoA, catalyzed by HMG-CoA synthase; the crystal structure and catalytic mechanism of the S. aureus HMG-CoA synthase (encoded by mvaS) have been investigated (30); 3) reduction of HMG-CoA to mevalonate, catalyzed by HMG-CoA reductase (encoded by mvaA) with NADPH as cofactor; HMG-CoA reductase is the best characterized enzyme of the mevalonate pathway in both eukaryotes and prokaryotes (29), and crystal structures have been solved for both human and bacterial HMG-CoA reductase; the eukaryotic HMG-CoA reductase is the target of the statin class of cholesterol-lowering agents; 4) Phosphorylation of mevalonate with ATP to form mevalonate-5-phosphate and then in a second reaction mevalonate diphosphate, catalyzed by mevalonate kinase; mevalonate kinase from S. aureus (mvaK1) has been characterized recently (31); 5) decarboxylation of mevalonate diphosphate to isopentenyl diphosphate, catalyzed by mevalonate-diphosphate decarboxylase (encoded by mvaD); 6) isomerization of isopentenyl diphosphate to produce dimethylallyl diphosphate in the presence of both FMN and NADPH, catalyzed by a type II isopentenyl-diphosphate isomerase (encoded by fni); this type II enzyme was first described by Kaneda et al. (32); and 7) condensation of isopentenyl diphosphate and geranyl diphosphate to form farnesyl diphosphate, catalyzed by farnesyl-PP synthase (encoded by ispA).

The mevalonate pathway used in humans is extended to synthesize lanosterol and finally cholesterol. In bacteria, end products include the lipid carrier undecaprenol, which is involved in cell wall biosynthesis, menaquinones and ubiquinones, which are involved in electron transport, and carotenoids, e.g. staphyloxanthin.

Staphyloxanthin is a typical secondary metabolite. It is not necessary for the growth and reproduction of S. aureus but might serve a role in survival in infected hosts and in combating the immune system.

	FOOTNOTES

 
The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EBI Data Bank with accession number(s) X97985 [GenBank] .

^* This work was supported by grants from the Deutsche Forschungsgemeinschaft: FOR 449/1, the Graduate College 685, BMBF Kompetenznetz PathoGenoMik (031U213B), the DFG-Forschergruppe (G0 371/5-3/4), and the graduate college "infection biology" (IIIGK-GRK 685/2-04). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ To whom correspondence should be addressed: Dept. of Microbial Genetics, University of Tuebingen, Waldhauser Str. 70/8, D-72076 Tuebingen, Germany. Tel.: 49-7071-2974636; Fax: 49-7071-2975937; E-mail: friedrich.goetz{at}uni-tuebingen.de.

² The abbreviations used are: HPLC, high pressure liquid chromatography; MS, mass spectroscopy; GC, gas chromatography; HMG, 3-hydroxy-3-methylglutaryl.

	ACKNOWLEDGMENTS

 
We thank Mulugeta Nega for technical assistance in fermentation and purification of staphyloxanthin and G. Winkelmann and M. Valdebenito for help in preparative HPLC.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Götz, F., Bannerman, T., and Schleifer, K. H. (2004) in The Procaryotes (Dworkin, M., ed) http://141.150.157.117:8080/prokWIP/chaphtm/356/COMPLETE.htm, Springer-Verlag, New York
2. Pinner, M., and Voldrich, M. (1932) J. Infect. Dis. 50, 185-202
3. Marshall, J. H., and Wilmoth, G. J. (1981) J. Bacteriol. 147, 900-913[Abstract/Free Full Text]
4. Armstrong, G. A. (1997) Annu. Rev. Microbiol. 51, 629-659[CrossRef][Medline] [Order article via Infotrieve]
5. Wieland, B., Feil, C., Gloria-Maercker, E., Thumm, G., Lechner, M., Bravo, J. M., Poralla, K., and Götz, F. (1994) J. Bacteriol. 176, 7719-7726[Abstract/Free Full Text]
6. Götz, F., and Schumacher, B. (1987) FEMS Microbiol. Lett. 40, 285-288[CrossRef]
7. Kreutz, B., and Götz, F. (1984) Gene (Amst.) 31, 301-304[Medline] [Order article via Infotrieve]
8. Rosenstein, R., Peschel, A., Wieland, B., and Götz, F. (1992) J. Bacteriol. 174, 3676-3683[Abstract/Free Full Text]
9. Peschel, A., Augustin, J., Kupke, T., Stevanovic, S., and Götz, F. (1993) Mol. Microbiol. 9, 31-39[Medline] [Order article via Infotrieve]
10. Wieland, K. P., Wieland, B., and Götz, F. (1995) Gene (Amst.) 158, 91-96[CrossRef][Medline] [Order article via Infotrieve]
11. Kuroda, M., Ohta, T., Uchiyama, I., Baba, T., Yuzawa, H., Kobayashi, I., Cui, L., Oguchi, A., Aoki, K., Nagai, Y., Lian, J., Ito, T., Kanamori, M., Matsumaru, H., Maruyama, A., Murakami, H., Hosoyama, A., Mizutani-Ui, Y., Takahashi, N. K., Sawano, T., Inoue, R., Kaito, C., Sekimizu, K., Hirakawa, H., Kuhara, S., Goto, S., Yabuzaki, J., Kanehisa, M., Yamashita, A., Oshima, K., Furuya, K., Yoshino, C., Shiba, T., Hattori, M., Ogasawara, N., Hayashi, H., and Hiramatsu, K. (2001) Lancet 357, 1225-1240[CrossRef][Medline] [Order article via Infotrieve]
12. Kullik, I., Giachino, P., and Fuchs, T. (1998) J. Bacteriol. 180, 4814-4820[Abstract/Free Full Text]
13. Lang, S., Livesley, M. A., Lambert, P. A., Littler, W. A., and Elliott, T. S. (2000) FEMS Immunol. Med. Microbiol. 29, 213-220[CrossRef][Medline] [Order article via Infotrieve]
14. Takami, H., Takaki, Y., and Uchiyama, I. (2002) Nucleic Acids Res. 30, 3927-3935[Abstract/Free Full Text]
15. Takaichi, S., Inoue, K., Akaike, M., Kobayashi, M., Oh-oka, H., and Madigan, M. T. (1997) Arch. Microbiol. 168, 277-281[CrossRef][Medline] [Order article via Infotrieve]
16. Botella, J. A., Murillo, F. J., and Ruiz-Vazquez, R. (1995) Eur. J. Biochem. 233, 238-248[Medline] [Order article via Infotrieve]
17. Armstrong, G. A., Alberti, M., and Hearst, J. E. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 9975-9979[Abstract/Free Full Text]
18. Schumann, G., Nurnberger, H., Sandmann, G., and Krugel, H. (1996) Mol. Gen. Genet. 252, 658-666[Medline] [Order article via Infotrieve]
19. Rocap, G., Larimer, F. W., Lamerdin, J., Malfatti, S., Chain, P., Ahlgren, N. A., Arellano, A., Coleman, M., Hauser, L., Hess, W. R., Johnson, Z. I., Land, M., Lindell, D., Post, A. F., Regala, W., Shah, M., Shaw, S. L., Steglich, C., Sullivan, M. B., Ting, C. S., Tolonen, A., Webb, E. A., Zinser, E. R., and Chisholm, S. W. (2003) Nature 424, 1042-1047[CrossRef][Medline] [Order article via Infotrieve]
20. Eisen, J. A., Nelson, K. E., Paulsen, I. T., Heidelberg, J. F., Wu, M., Dodson, R. J., Deboy, R., Gwinn, M. L., Nelson, W. C., Haft, D. H., Hickey, E. K., Peterson, J. D., Durkin, A. S., Kolonay, J. L., Yang, F., Holt, I., Umayam, L. A., Mason, T., Brenner, M., Shea, T. P., Parksey, D., Nierman, W. C., Feldblyum, T. V., Hansen, C. L., Craven, M. B., Radune, D., Vamathevan, J., Khouri, H., White, O., Gruber, T. M., Ketchum, K. A., Venter, J. C., Tettelin, H., Bryant, D. A., and Fraser, C. M. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 9509-9514[Abstract/Free Full Text]
21. Cramton, S. E., Gerke, C., Schnell, N. F., Nichols, W. W., and Götz, F. (1999) Infect. Immun. 67, 5427-5433[Abstract/Free Full Text]
22. Gerke, C., Kraft, A., Süssmuth, R., Schweitzer, O., and Götz, F. (1998) J. Biol. Chem. 273, 18586-18593[Abstract/Free Full Text]
23. Heilmann, C., Schweitzer, O., Gerke, C., Vanittanakom, N., Mack, D., and Götz, F. (1996) Mol. Microbiol. 20, 1083-1091[Medline] [Order article via Infotrieve]
24. Saxena, I. M., Brown, R. M., Jr., Fevre, M., Geremia, R. A., and Henrissat, B. (1995) J. Bacteriol. 177, 1419-1424[Free Full Text]
25. Peschel, A., Ottenwälder, B., and Götz, F. (1996) FEMS Microbiol. Lett. 137, 279-284[CrossRef][Medline] [Order article via Infotrieve]
26. Marshall, J. H., and Wilmoth, G. J. (1981) J. Bacteriol. 147, 914-919[Abstract/Free Full Text]
27. Moss, G. P. (1979) Pure Appl. Chem. 51, 507-514
28. Wilding, E. I., Brown, J. R., Bryant, A. P., Chalker, A. F., Holmes, D. J., Ingraham, K. A., Iordanescu, S., So, C. Y., Rosenberg, M., and Gwynn, M. N. (2000) J. Bacteriol. 182, 4319-4327[Abstract/Free Full Text]
29. Wilding, E. I., Kim, D. Y., Bryant, A. P., Gwynn, M. N., Lunsford, R. D., McDevitt, D., Myers, J. E., Jr., Rosenberg, M., Sylvester, D., Stauffacher, C. V., and Rodwell, V. W. (2000) J. Bacteriol. 182, 5147-5152[Abstract/Free Full Text]
30. Campobasso, N., Patel, M., Wilding, I. E., Kallender, H., Rosenberg, M., and Gwynn, M. N. (2004) J. Biol. Chem. 279, 44883-44888[Abstract/Free Full Text]
31. Voynova, N. E., Rios, S. E., and Miziorko, H. M. (2004) J. Bacteriol. 186, 61-67[Abstract/Free Full Text]
32. Kaneda, K., Kuzuyama, T., Takagi, M., Hayakawa, Y., and Seto, H. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 932-937[Abstract/Free Full Text]
33. Marshall, J. H., and Rodwell, E. S. (1972) 3rd International Symposium on Carotenoids Other Than Vitamin A, September 4–7, 1972, pp. 56-57, International Union of Pure and Applied Chemisry, Cluj, Romania

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				R. Rosenstein, C. Nerz, L. Biswas, A. Resch, G. Raddatz, S. C. Schuster, and F. Gotz Genome Analysis of the Meat Starter Culture Bacterium Staphylococcus carnosus TM300 Appl. Envir. Microbiol., February 1, 2009; 75(3): 811 - 822. [Abstract] [Full Text] [PDF]

				A. Muthaiyan, J. A. Silverman, R. K. Jayaswal, and B. J. Wilkinson Transcriptional Profiling Reveals that Daptomycin Induces the Staphylococcus aureus Cell Wall Stress Stimulon and Genes Responsive to Membrane Depolarization Antimicrob. Agents Chemother., March 1, 2008; 52(3): 980 - 990. [Abstract] [Full Text] [PDF]

				B. Gourion, A. Francez-Charlot, and J. A. Vorholt PhyR Is Involved in the General Stress Response of Methylobacterium extorquens AM1 J. Bacteriol., February 1, 2008; 190(3): 1027 - 1035. [Abstract] [Full Text] [PDF]

				M. Kuroda, S. Nagasaki, and T. Ohta Sesquiterpene farnesol inhibits recycling of the C55 lipid carrier of the murein monomer precursor contributing to increased susceptibility to {beta}-lactams in methicillin-resistant Staphylococcus aureus J. Antimicrob. Chemother., March 1, 2007; 59(3): 425 - 432. [Abstract] [Full Text] [PDF]

				J. A. Maresca and D. A. Bryant Two Genes Encoding New Carotenoid-Modifying Enzymes in the Green Sulfur Bacterium Chlorobium tepidum. J. Bacteriol., September 1, 2006; 188(17): 6217 - 6223. [Abstract] [Full Text] [PDF]

				A. Clauditz, A. Resch, K.-P. Wieland, A. Peschel, and F. Gotz Staphyloxanthin Plays a Role in the Fitness of Staphylococcus aureus and Its Ability To Cope with Oxidative Stress. Infect. Immun., August 1, 2006; 74(8): 4950 - 4953. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 280/37/32493    most recent M505070200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Pelz, A. Articles by Götz, F. Search for Related Content PubMed PubMed Citation Articles by Pelz, A. Articles by Götz, F. Social Bookmarking                      What's this?