Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M501964200 on July 28, 2005

J. Biol. Chem., Vol. 280, Issue 38, 32662-32668, September 23, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
280/38/32662    most recent
M501964200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oltean, S.
Right arrow Articles by Banerjee, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oltean, S.
Right arrow Articles by Banerjee, R.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A B12-responsive Internal Ribosome Entry Site (IRES) Element in Human Methionine Synthase*{boxs}

Sebastian Oltean and Ruma Banerjee1

From the Department of Biochemistry, University of Nebraska, Lincoln, Nebraska 68588-0664

Received for publication, February 22, 2005 , and in revised form, July 27, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Regulation of homocysteine, a sulfur-containing amino acid that is a risk factor for cardiovascular diseases, is poorly understood. Methionine synthase (MS) is a key enzyme that clears intracellular homocysteine, and its activity is induced by its cofactor, vitamin B12, at a translational level. In this study, we demonstrate that translation of MS, which has a long and highly structured 5'-untranslated region, is initiated from an internal ribosome entry site (IRES), which is modulated by B12. The minimal IRES element spans 71 bases immediately upstream of the initiation codon. Electrophoretic mobility shift analysis reveals the presence of a B12 -dependent protein-RNA complex and suggests the possibility that B12-dependent increase of IRES efficiency is mediated via a protein. Modulation of the IRES-dependent translation of an essential gene by the cofactor of the encoded enzyme represents a novel example of a gene-nutrient interaction.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The important interplay between genes and nutrients modulates a number of physiological and pathophysiological processes (1). The influence of nutrients on DNA stability, repair, methylation, and gene expression is well studied (2). Elevated levels of homocysteine, a metabolic product of an essential nutrient, methionine, is correlated with an increased risk for cardiovascular diseases (3), neural tube defects (4), and Alzheimer's disease (5). Intracellular clearance of homocysteine is controlled by the activity of three enzymes that are found at a vitamin-rich metabolic junction. These include the B6-dependent cystathionine {beta}-synthase, B12- and folate-dependent methionine synthase (MS)2 and betaine homocysteine methyl transferase. Of these, only MS is ubiquitous and remethylates homocysteine to methionine. Mutations in MS result in hereditary hyperhomocysteinemia (6, 7). The rich B-vitamin dependence of homocysteine metabolism has stimulated studies on the benefits of multivitamin treatment in lowering plasma homocysteine (8–11).

The activity of MS in cells cultured in normal medium is enhanced by supplementation with vitamin B12, an observation that was first reported over 30 years ago (12). This regulation is exerted at the translational level and involves a B12 responsive element located at the 3'-end of the MS 5'-UTR (13). B12 supplementation shifts the equilibrium of MS mRNA from the translationally inactive ribonucleoprotein pool to the active polysomal pool and thereby increases the level of MS.

The MS 5'-UTR is 394 bases in length and is predicted to be highly structured, which raises questions about how it can be efficiently translated. Translation initiation of most eukaryotic genes commences with recruitment of the initiation complex to the 5'-m7G cap structure of the mRNA. The initiation complex then scans the leader region until the initiator AUG codon is located. Leader-burdened mRNAs in eukaryotes can employ alternative mechanisms for translation initiation, i.e. ribosomal shunting or an internal ribosome entry site (IRES) element (14). Whereas there is little information on the mechanism of ribosome shunting, IRES elements are capable of recruiting ribosomal subunits in the vicinity of the initiation codon, thus bypassing the canonical cap-recognition and scanning route. Cellular IRES activities can be modulated in response to amino acid availability, hypothermia, or during apoptosis and development and afford a route for translation initiation under conditions where global cap-dependent initiation is inhibited (14–16).

In this study, we have investigated whether the human MS mRNA is translated through an internal initiation mechanism. We demonstrate that the MS mRNA harbors an IRES element in its leader region, and its boundaries overlap with those of the previously described B12 response element. The IRES element is located immediately upstream of the initiator AUG, and its activity is modulated by vitamin B12. B12 does not appear to bind directly to the MS 5'-UTR and supports a model in which the cofactor regulates the IRES element via an auxiliary protein.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—Eagle's MEM (minimum essential medium), OHCbl, AdoCbl, MeCbl, and CNCbl were purchased from Sigma. Fetal bovine serum was from HyClone. Cell lines were purchased from American Type Culture Collection. Radiolabeled [{gamma}-32P]ATP (5000 mCi/mmol) was purchased from Amersham Biosciences. HeLa S100 cell extracts were purchased from Paragon.

Cell Culture Conditions—Cells were grown in Eagle's MEM supplemented with 10% fetal bovine serum and incubated at 37 °C, 5% CO2. B12 derived from fetal bovine serum is present at a concentration of ~125 pM in this medium. For B12 induction studies, the cells were grown to 60–80% confluency, and fresh medium supplemented with 5 mg liter-1 OHCbl (3.6 µM final concentration) was added. For reporter studies (luciferase and CAT), cells were grown in 6-well 35-mm plates, harvested, and lysed according to the manufacturer's protocols (Promega).

Reporter Constructs—Plasmids pSVCAT/ICS/LUC, pSVCAT/BIP/LUC, and pSVhpCAT/BIP/LUC were kindly provided by Dr. Maria Hatzoglou (Case Western Reserve University) and were initially developed in Dr. Peter Sarnow's laboratory (Stanford University). The pSVCAT/ICS/LUC vector contains 400 nucleotides of antisense antennapedia cDNA of Drosophila melanogaster (17) in the intercistronic (ICS) region and was used as a negative control for IRES-mediated translation. The plasmid pSVCAT/BIP/LUC contains the IRES of the immunoglobulin-binding protein (17) and was used as a positive control. The plasmid pSVhpCAT/BIP/LUC contains a stable hairpin inserted in front of the first cistron. The MS 5'-UTR (394 bases) was PCR-amplified and cloned into the SalI/NcoI sites of the pSVCAT/ICS/LUC plasmid by replacing the ICS sequence to give pSVCAT/MS1–394/LUC. Using a similar procedure, the vector pSVhpCAT/MS1–394/LUC was obtained. Deletion constructs containing the last 340, 270, 220, 140, and 71 bases, of the MS 5'-UTR were generated by PCR and subcloned into the SalI/NcoI sites of the bicistronic vector (with or without the hairpin) as described above for the full-length construct. The deletion constructs containing the last 67, 64, 61, 55, 52, 47, 42, 35, and 26 bases, respectively, of the MS 5'-UTR were generated by PCR and subcloned into the SalI/BstEII sites.

Plasmid MS-pGL3-basic was constructed by cloning the MS 5'-UTR into the HindIII/NcoI sites of the pGL3-basic promoter-less vector (Promega). Mutants were generated using the QuikChange site-directed mutagenesis kit (Stratagene). The primers employed in this study are described in supplemental Table S1.

Transient Transfection and Reporter Assays—Transfections were performed using the Lipofectamine reagent (Invitrogen) for 293 cells or GeneJammer (Stratagene) for COS-1, HepG2, and NIH3T3 cells. Briefly, 1.5 µg of plasmid DNA was mixed with 10 µl of transfection reagent according to the manufacturer's specifications, and the mixture was added to 6-well plates. When needed, B12 was added to half of the plates 24 h after transfection. At the end of the incubation, reporter gene activity was determined according to the vendor's protocol (Promega).

Bicistronic RNA Northern Analysis—Analysis was performed as previously described (13). A 32P-labeled probe consisting of a DNA fragment encompassing 650 bases at the 5'-end of the luciferase gene was employed to detect the bicistronic message.

In Vitro Transcription—DNA primers containing a T7 promoter sequence were designed to amplify various fragments of the MS 5'-UTR. The PCR products were used as templates for in vitro transcription using the RiboMax kit (Promega) according to the vendor's protocol. The transcripts were resolved on a 10% polyacrylamide gel, isolated and 5' 32P-labeled as previously described (18).

In-line Probing of RNA Constructs—Labeled RNA fragments were subjected to in-line probing as previously described (18). Briefly, ~1 nM 5' 32P-labeled RNA was incubated for ~ 40 h at 25°Cin20mM MgCl2, 50 mM Tris-HCl (pH 8.3), and 100 mM KCl in the presence or absence of ligand (i.e. 200 µM B12 derivative). The reaction mixtures were resolved on a 6–15% polyacrylamide gel (depending on the length of the RNA) and analyzed using a PhosphorImager.

REMSAs—For RNA electrophoretic mobility shift assays, DNA templates were generated by PCR using the following primers: Forward: TAATACGACTCACTATAGGGAGCCAACGGCAGGCGTCAAA and Reverse: GTTGTCGAGTCTCCTCCTT. The forward primer incorporated the T7 promoter sequence. RNA probes were synthesized by in vitro transcription with T7 polymerase (Maxiscript kit, Ambion) in the presence of [{alpha}-32P]UTP. 15,000 cpm of labeled RNA was incubated with 75 µg of HeLa S100 cell extract (Paragon) in a total volume of 15 µl at room temperature for 30 min, followed by the addition of 1 µl of RNase T1 (1 unit/µl) and incubated for an additional 10 min at room temperature. Heparin was added to a final concentration of 5 mg/ml. When indicated, different forms of cobalamin were added at a final concentration of 200 µM or cell extracts were pretreated with proteinase K (100 µg/ml) before mixing with the RNA. The ribonucleoprotein complexes were electrophoresed on a 4% native acrylamide gel and visualized by autoradiography.

UV Cross-linking Experiments—RNA-protein complexes for UV cross-linking were prepared as described above. Before adding RNase T1, the samples were transferred into a 96-well dish and irradiated on ice with a 254-nm UV light source at 400,000 µJ/cm2. RNA-protein complexes were then resolved by 12% SDS-PAGE and visualized by autoradiography.

Statistical Analysis—Each experiment was repeated at least three times. Statistical analysis was performed using one-way analysis of variance (Microcal Origin software), and results were considered significant if the p value was <0.05.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
The MS 5'-UTR Contains an IRES Element—To determine whether the MS 5'-UTR is able to initiate translation internally, a series of bicistronic vectors were employed as shown in Fig. 1A. In these constructs, the first cistron (encoding CAT) is translated via a canonical cap-dependent mechanism. The second cistron (encoding LUC) is translated efficiently only if translation initiation occurs in the intercistronic region. The following vectors were tested: CAT/ICS/LUC as a negative control, CAT/BIP/LUC as a positive control (15), and CAT/MS 5'-UTR/LUC containing the MS 5'-UTR instead of the BIP sequence. To rule out the possibility that the observed IRES activity does not result from ribosomal read-through, vectors having stable hairpins preceding the first cistron were employed (Fig. 1A).

Translation of the first but not the second cistron (Fig. 1B, upper panel) is strongly inhibited by the presence of the hairpin in the CAT/MS 5'-UTR/LUC construct and in the positive control containing the BIP-IRES (Fig. 1B, lower panel). These results provide evidence that translation of the second cistron occurs by initiation in the intercistronic region and are consistent with the presence of an IRES element in the MS 5'-UTR.

As an additional control, the LUC/CAT activity was measured in 293 cells treated with rapamycin, which inhibits cap-dependent translation by promoting dephosphorylation and activation of 4E-BP1, a repressor of the cap-binding protein, 4E (19). A ~10-fold increase in LUC/CAT activity was seen in the presence of rapamycin and resulted from diminished CAT activity whereas the LUC activity was unaffected (data not shown).

A potential source of error in interpreting data for internal initiation of translation is the possible presence of a cryptic promoter in the test sequence, which would result in a monocistronic luciferase mRNA in addition to the bicistronic message. Cap-dependent translation of the monocistronic RNA would confound the results. We thus tested a luciferase reporter construct in which the SV40 promoter was replaced by the MS 5'-UTR. Only background levels of luciferase activity were detected demonstrating that the MS 5'-UTR does not exhibit promoter activity (Fig. 1C).

A second source of error that needs to be considered is the possible presence of a splice site in the MS 5'-UTR. In this case, even if a bicistronic message is produced initially, splicing could generate a smaller fragment containing the second cistron. However, Northern analysis revealed the presence of only a single message that is long enough to accommodate both cistrons, ruling out the presence of a cryptic splice site in the MS 5'-UTR (Fig. 1D).

Because optimal IRES-dependent initiation requires trans-acting factors that have a tissue-specific distribution (20), we have examined the efficiency of MS- and BIP-IRES activities in different cell lines (Fig. 1E). Efficiency of the IRES varied within a 2–5-fold range compared with the ICS-containing negative control. The pattern observed with the BIP-IRES was comparable to that reported previously in the same cell lines (20). It is interesting to note that the highest MS-IRES activity was observed in the 293 kidney cell line, in which MS activity is also reported to be highest (21).



View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 1.
MS translation is IRES-dependent. A, bicistronic constructs used to probe IRES activity. The plasmid designated as MS and BIP have the full-length MS 5'-UTR or the BIP 5'-UTR inserted between the CAT and luciferase cistrons. hp refers to the hairpin present upstream of the CAT cistron. B, MS 5'-UTR displays IRES activity in a bicistronic test. The reporter activities for plasmids containing the MS 5'-UTR (upper panel) or the BIP 5'-UTR (lower panel), which served as a positive control, were measured as described under "Experimental Procedures." C, the MS 5'-UTR does not harbor a cryptic promoter. Comparison of luciferase activity in a monocistronic reporter constructs containing an SV40 promoter or the MS 5'-UTR in place of the SV40 promoter. Luciferase levels are normalized to the CAT activity of a monocistronic plasmid that was used as a control for transfection efficiency as described under "Experimental Procedures." D, the MS 5'-UTR does not a harbor cryptic splice site. Northern blots of COS-1 cells that were transfected with the MS or BIP bicistronic plasmid constructs shown in A, indicate the presence of intact bicistronic mRNA. E, MS-IRES efficiency in different cell lines. The MS and BIP bicistronic constructs were transfected into different cell lines. Activities are reported in comparison with the background ICS activity (negative control) that is set as 100% as described under "Experimental Procedures."

 



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 2.
Deletion analysis of the MS-IRES. Progressive deletions were made from the 5'-end of MS 5'-UTR and the IRES activity was measured as described under "Experimental Procedures." Activities are reported after subtraction of the background ICS activity (negative control) and compared relative to the -394 MS 5'-UTR containing construct, which was set at 100.

 
Deletion Mapping of the IRES Element—To map the minimal sequence that is required for IRES activity, we generated a series of nested deletions from the 5'-end of the MS 5'-UTR and measured IRES activity in the resulting bicistronic constructs. Fig. 2 shows that the deletions modulate IRES activity, probably because of the inhibitory or stimulatory influences of different regions in the MS 5'-UTR. For instance, the first 54 bases of the MS 5'-UTR are inhibitory, and their deletion increases IRES activity. As the deletions progress toward the 3'-end, stimulatory regions are eliminated, as indicated by a decrease in IRES activity. However, the last 71 bases of the MS 5'-UTR retain ~80% of the IRES activity versus the full-length MS 5'-UTR.

To confirm that the 71-mer indeed harbors IRES activity, we have tested a plasmid containing the 71 bases inserted in the intercistronic region and a hairpin preceding the first cistron. When the hairpin is present, translation of the first cistron is inhibited, whereas translation of the second cistron is enhanced, consistent with retention of IRES activity in this sequence (data not shown).

MS IRES Is Modulated by B12—The boundaries of the MS-IRES element and of the B12 responsive element reporter earlier (13) overlap, and raises the obvious question as to whether or not the IRES activity is modulated by B12.AB12-dependent increase (~60%) in the translational efficiency of the bicistronic vector was observed, and the effect was clearly specific to the second cistron, which is under control of the MS-IRES element (Fig. 3). The fold increase in translation in the reporter construct is lower than the B12 effect on the endogenous gene (~3.8-fold in COS-1 cells), which could result from placement of the MS 5'-UTR in an artificial context in the bicistronic vector. A similar observation has been reported for the X-linked inhibitor of apoptosis protein, which is elevated 3.5-fold upon radiation treatment but shows a 50% increase in reporter activity when its IRES element is inserted in a bicistronic vector (16, 22). B12 had no effect on the LUC/CAT ratio in constructs containing the BIP IRES or the ICS sequence between the two reporter genes (not shown). It should be noted that the control cells are cultured in medium containing ~125 pM B12 as described under "Experimental Procedures." Thus, the effect of B12 supplementation, which activates MS (13), is correlated with IRES-dependent translation of MS in this study.



View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 3.
MS-IRES is modulated by B12. Reporter activities were measured in COS-1 cells transfected with the MS bicistronic vector (containing 394 bases of the 5'-UTR) at the indicated times following treatment with B12. (*) denotes a p value < 0.05.

 
Secondary Structure Probing of MS-IRES—Computer modeling of the 71-mer using Mfold (24) predicts the presence of a hairpin (between bases -9 and -44) with a long stem (Fig. 4A). Interestingly, this particular hairpin is retained in secondary structure models for all the deletion constructs described in Fig. 2. To test whether this hairpin exists in vivo, we probed the RNA secondary structure using the in-line probing method (18, 25), which relies on degradation of RNA at room temperature and analysis of the resulting degradation pattern (Fig. 4B). Many of the regions that are predicted to be double-stranded in the stem (e.g. bases -36 to -44) are protected from degradation. In contrast, loops are more accessible to cleavage and generate strong banding patterns in the gel (e.g. bases -34, -26 and -25). We also used this method to determine whether B12 binds directly to the MS 5'-UTR. This analysis is based on the premise that binding of a ligand to RNA can cause changes to the secondary/tertiary structure and thus influences the pattern of degradation (18).

Fig. 4B shows the degradation pattern of a transcript spanning the last 71 bases of the MS 5'-UTR in the presence or absence of B12. None of the B12 derivatives visibly altered the degradation pattern, which suggests but does not establish that B12 does not bind directly to the MS 5'-UTR. We similarly found no evidence for modulation of degradation by B12 of the full-length MS leader or of the last 140 bases of the leader (data not shown).

The degradation pattern is in generally good agreement with the predicted long hairpin secondary structure in the model for the 71-mer (Fig. 4). The stronger degradation bands are seen in the predicted loops whereas the protected regions correspond to bases in the stem. These results provide evidence for the in vivo existence of the predicted hairpin structure in the MS IRES-element.

Fine Mapping of the Minimal IRES Element—The 71-mer was employed further for fine mapping analysis to probe the essential features of a minimal IRES element. To this end, 3–5 bases were deleted consecutively, starting at the 5'-end of the 71-mer. The secondary structure model predicts that the bases -9to -44 form a long hairpin (Fig. 4A) and its role in IRES activity is confirmed by the bicistronic reporter assays (see loss of activity in deletion constructs -42, -35, and -26 in Fig. 5). The integrity of the bicistronic message was established by Northern analysis (Fig. 5B). The equal intensity of mRNA in these samples is consistent with the reporter assays reflecting changes at the translational level.



View larger version (48K):
[in this window]
[in a new window]
  		FIGURE 4.
Structure probing of the 71-mer MS-IRES element. A, predicted secondary structure of the 71-mer as analyzed by M-fold (www.bioinfo.rpi.edu/applications/mfold). The numbers indicate the base count starting at the 3'-end of the sequence. B, in-line probing of the 71-mer resolved on a polyacrylamide gel as described under "Experimental Procedures." T1-partial digestion with RNase T1 (G-specific cleavage); OH, partial digestion with NaOH; NR, no reaction.

 
The deletion analysis revealed that the sequence from -47 to -43 (CACGU) is important for IRES activity. In an Mfold analysis, both the last 47 and the last 42 bases of MS 5'-UTR form a stable hairpin with the only difference being that the main stem is 9-bp long in the 47-base hairpin and 7-bp long in the 42-base hairpin. To determine whether the primary sequence or the length of the stem was important, we mutated residues -44 and -43 and introduced complementary changes at -9 and -10 so that the 9-bp stem length was retained. The IRES activity of this mutant was 100% of the activity of the wild-type IRES (not shown). In contrast, mutating residues at the base of the stem so that pairing between residues -44 and -9 and -43 and -10 were disrupted resulted in ~50% of wild-type IRES activity (not shown). This is consistent with the length of the hairpin stem being important rather than the specific sequence at the positions that were tested. However, these results do not exclude the possibility that the mutations disrupted a tertiary interaction that modulates IRES activity. Because of the small magnitude of the B12 effect in the bicistronic construct (Fig. 3), fine mapping of the B12 effect was not pursued in this study.

A B12-responsive Protein Binds to MS 5'-UTR—Whereas the structure probing data do not rule out direct B12 binding to the MS 5'-UTR (Fig. 4), they suggest that the B12 effect may be expressed via a trans factor. To test this hypothesis, we performed electrophoretic mobility shift assays to detect proteins that bind to the MS 5'-UTR. A labeled RNA probe encompassing the last 140 nucleotides of the MS 5'-UTR, which showed the highest B12-sensitivity in a reporter gene assay (13), was incubated with cytosolic S100 extracts from HeLa cells in the presence or absence of different forms of B12 and analyzed on native PAGE. Of the four complexes that were detected, three bind to the RNA independently of B12 (Fig. 6A). The fourth complex (with the highest molecular weight) exhibits B12 specificity, binding RNA in the order of decreasing strength in the presence of OHCbl>MeCbl{approx}CNCbl. Binding was not observed in the presence of AdoCbl or in the absence of cobalamins. Preincubation of the cell extract with proteinase K prior to electrophoresis abolished complex formation confirming that binding of proteins to the RNA probe retarded its mobility (Fig. 6B). UV-cross-linking of the ribonucleoprotein complexes and separation on denaturing acrylamide gels provided an estimate of ~100 kDa for the molecular mass of the B12-responsive protein-RNA probe complex (data not shown).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Our studies reveal a novel mechanism of translational regulation of human MS that is IRES-dependent and is modulated by its cofactor, B12. The MS 5'-UTR is 394 bases long in contrast to the 5'-UTRs of most cellular mRNAs that are between 25 and 70 bases in length (26). The presence of extensive secondary structure (with a predicted {delta}G of > -50 kcal/mol) in the 5'-leader sequence is generally believed to inhibit ribosome scanning (26). Secondary structure predictions for the full-length MS 5'-UTR, estimate a {delta}G of -175 kcal/mol for melting the multiple hairpins. Structure probing experiments of the full-length MS 5'-UTR confirm that it is indeed highly structured raising the possibility that IRES-dependent initiation could be important for this leader-burdened mRNA.

Several cellular IRES elements are activated under conditions of stress (viz. amino acid starvation, irradiation, and apoptosis) during which general cap-dependent translation is inhibited (14–16, 27). IRES-dependent translation initiation confers an advantage under these conditions by bypassing general translation arrest and allowing expression of proteins essential for adaptation/survival. MS is an essential gene as revealed by the embryonic lethality of MS-null mice (28). IRES-dependent translation of MS could have evolved to maintain production of this enzyme under different environmental conditions. B12 is a relatively rare, albeit essential, vitamin with limited distribution and is absent in the plant kingdom. We have speculated previously that translational up-regulation of MS by B12 may represent an evolutionary adaptation to the presence of this nutrient (13), which leads to rapid synthesis and sequestration of the vitamin by the only known B12-utilizing enzyme in the cytoplasm, MS (29, 30). Modulation of IRES activity by B12 as uncovered by this study is novel and affords regulation of MS translation initiation by its cofactor.



View larger version (17K):
[in this window]
[in a new window]
  		FIGURE 5.
Fine mapping of the MS-IRES. A, 3–5 nucleotides were consecutively deleted from the 5'-end of the 71-mer and analyzed in the bicistronic reporter assay as a ratio of LUC/CAT activity (solid bars). The deletions did not affect mRNA expression as indicated by the uniform expression of CAT activity in all the constructs (open bars). The activity for each construct is reported after subtraction of the background ICS activity (negative control) and compared with the -394 MS 5'-UTR construct, which was set at 100. B, Northern analysis demonstrates integrity of and equal expression of the bicistronic mRNA in the deletion constructs. COS-1 cells were transfected with bicistronic plasmid constructs -71, -67, -52, -47, and -42. 24 h following transfection, half of the cells were treated with B12. Cells were harvested 24 h later, and RNA was isolated and subjected to Northern analysis using a luciferase probe as described under "Experimental Procedures" that detected a single ~3.3-kb transcript. Equal loading was established by monitoring 18 S RNA levels in each lane (not shown).

 
Recently, a novel mechanism for gene regulation in prokaryotes by vitamins and metabolites has been described, i.e. via riboswitches. The latter afford control of transcription termination and/or translation through direct binding of small ligand molecules to RNA, thereby circumventing the need for proteins (31). Ligand binding can either stabilize or melt RNA secondary structures with regulatory consequences (18, 32–34). A B12 riboswitch is present in the 5'-UTR of the Escherichia coli and Salmonella typhimurium btuB transporter (18). B12 binding inhibits ribosome recruitment thus diminishing production of the transporter when the cofactor is abundant. A phylogenetic analysis reveals that a B12 riboswitch consensus sequence is wide spread in Gram-positive and Gram-negative organisms (35). Although most riboswitches have been described in prokaryotes, recent reports reveal their presence in eukaryotes as well (36). The negative results of the structure probing analyses do not exclude the possibility that B12 binds directly to a responsive element in the MS 5'-UTR (Fig. 4). However, in combination with the observation that the MS 5'-UTR sequence is retarded by B12 only in the presence of cell extract (Fig. 6), they support mediation of the B12 effect by a protein factor.



View larger version (66K):
[in this window]
[in a new window]
  		FIGURE 6.
RNA electrophoretic mobility shift analysis of RNA-protein complexes with the MS 5'-UTR. A, a B12-responsive complex and three B12-independent complexes form on the MS IRES element. Gel mobility shift assays were performed with a 32P-labeled probe encompassing the last 140 bases of the MS 5'-UTR and S100 extracts from HeLa cells as described under "Experimental Procedures." B, the mobility shifted complexes disappear upon treatment with proteinase K (100 µg/ml (+) and 1 mg/ml (++) confirming the presence of protein-RNA complexes. Ado, -AdoCbl; CN, -CNCbl; Me, -MeCbl; OH, -OHCbl; *, artifacts derived from cassette used for autoradiography. The data are representative of three independent experiments.

 
IRES activities are modulated by a number of proteins named ITAFs (IRES trans-activating factors) such as the hnRNP I/polypyrimidine tract-binding protein (37), the La autoantigen (38) and the ribonucleoproteins C1 and C2 (39). Variation in the MS-IRES potency in different cell lines (Fig. 1E) suggests the involvement of tissue-specific expression of ITAFs interacting with the MS-IRES. Interestingly, factorless ribosome assembly on the IRES of cricket paralysis virus has been reported (40), and it was suggested that distinct pseudoknot-like structures are important for the correct positioning of the ribosome on the mRNA, bypassing the need for initiation factors.

Based on the current study, a model for regulation of MS translation is proposed (Fig. 7). According to this model, the MS IRES is translated more efficiently in the presence of B12 presumably via its interaction with an ITAF. It is potentially significant that the putative B12-dependent ITAF is insensitive toward AdoCbl, a cofactor derivative that is synthesized in the mitochondrion. In contrast, MS, which is cytoplasmic, requires MeCbl as a cofactor and can synthesize it in situ from CN- or OHCbl (41), to which the putative ITAF responds. Alkylcobalamins, viz. MeCbl and AdoCbl, are photosensitive, and it is likely that the form of the vitamin that is delivered to the cytoplasm is predominantly in the OHCbl or cob(II)alamin state.

Another example of B12-dependent gene regulation involves the B12-binding protein, CarA, which is a transcriptional regulator in Myxococcus xanthus (42, 43). CarA is a repressor of the carB operon encoding carotenoid biosynthetic functions and has a DNA binding domain that is directly fused to a B12 binding domain. Binding of B12 to CarA is proposed to release the repressor from the promoter sequence. B12 has also been reported to inhibit the hepatitis C virus IRES-driven translation (44) by stalling the 80 S ribosomal complex on the IRES (23).

Our studies reveal the presence of three other protein complexes that bind to the MS 5'-UTR independently of B12 (Fig. 6). These putative ITAFs may be involved in modulating IRES activity. The identities of these proteins as well as of the B12 responsive protein are currently under investigation in our laboratory.



View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 7.
Model of B12 regulation of the MS-IRES. Binding of B12 to an ITAF elicits a conformational change in the protein that enables binding to the MS 5'-UTR and enhances IRES recruitment of ribosomes. Additional hypothetical ITAFs are shown bound to the MS IRES element.

 
In summary, we have shown that MS, which is essential for survival, is translated via an IRES mechanism and that a protein factor appears to be involved in mediating the B12-dependent response of the IRES element. Modulation of IRES-dependent translation of MS by B12 represents a novel mode of gene regulation by a nutritional factor, which is also the cofactor for the encoded enzyme.


   FOOTNOTES
 
* This work was supported by Grant DK64959 from the National Institutes of Health and by a predoctoral fellowship from the Heartland Affiliate of the American Heart Association (to S. O.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{boxs} The online version of this article (available at http://www.jbc.org) contains supplemental Table S1. Back

1 To whom correspondence should be addressed. Tel.: 402-472-2941; E-mail: rbanerjee1{at}unl.edu.

2 The abbreviations used are: MS, methionine synthase; UTR, untranslated region; IRES, internal ribosome entry sequence; OHCbl, hydroxocobalamin; AdoCbl, 5'-deoxyadenosylcobalamin; CNCbl, cyanocobalamin; MeCbl, methylcobalamin; CAT, chloramphenicol acetyltransferase; LUC, luciferase; BIP, immunoglobulin-binding protein; ICS, intercistronic sequence; REMSA, RNA electrophoretic mobility shift assay; ITAF, IRES trans-activating factors. Back


   ACKNOWLEDGMENTS
 
We thank Ali Nahvi and Dr. Ronald Breaker (Yale University) for assistance with the RNA "in-line" probing experiments.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Paoloni-Giacobino, A., Grimble, R., and Pichard, C. (2003) Clin. Nutr. 22, 429–435[CrossRef][Medline] [Order article via Infotrieve]
  2. Friso, S., and Choi, S. W. (2002) J. Nutr. 132, 2382S–2387S[Abstract/Free Full Text]
  3. Refsum, H., Ueland, P. M., Nygard, O., and Vollset, S. E. (1998) Annu. Rev. Med. 49, 31–62[CrossRef][Medline] [Order article via Infotrieve]
  4. Mills, J. L., McPartlin, J. M., Kirke, P. N., Lee, Y. J., Conle, M. R., and Weir, D. G. (1995) Lancet 345, 149–151[CrossRef][Medline] [Order article via Infotrieve]
  5. Clarke, R., Smith, A. D., Jobst, K. A., Refsum, H., Sutton, L., and Ueland, P. M. (1998) Arch. Neurol. 55, 1449–1455[Abstract/Free Full Text]
  6. Watkins, D., Ru, M., Hwang, H. Y., Kim, C. D., Murray, A., Philip, N. S., Kim, W., Legakis, H., Wai, T., Hilton, J. F., Ge, B., Dore, C., Hosack, A., Wilson, A., Gravel, R. A., Shane, B., Hudson, T. J., and Rosenblatt, D. S. (2002) Am. J. Hum. Genet. 71, 143–153[CrossRef][Medline] [Order article via Infotrieve]
  7. Kozich, V., Kraus, E., de Franchis, R., Fowler, B., Boers, G. H., Graham, I., and Kraus, J. P. (1995) Hum. Mol. Genet. 4, 623–629[Abstract/Free Full Text]
  8. Schnyder, G., Roffi, M., Pin, R., Flammer, Y., Lange, H., Eberli, F. R., Meier, B., Turi, Z. G., and Hess, O. M. (2001) N. Engl. J. Med. 345, 1593–1600[Abstract/Free Full Text]
  9. Schnyder, G., Roffi, M., Flammer, Y., Pin, R., and Hess, O. M. (2002) J. Am. Med. Assoc. 288, 973–979[Abstract/Free Full Text]
  10. Schnyder, G., Roffi, M., Flammer, Y., Pin, R., Eberli, F. R., Meier, B., Turi, Z. G., and Hess, O. M. (2003) Am. J. Cardiol. 91, 1265–1269[CrossRef][Medline] [Order article via Infotrieve]
  11. Boushey, C. J., Beresford, S. A., Omenn, G. S., and Motulsky, A. G. (1995) J. Am. Med. Assoc. 274, 1049–1057[Abstract/Free Full Text]
  12. Mangum, J. H., Murray, B. K., and North, J. A. (1969) Biochemistry 8, 3496–3499[CrossRef][Medline] [Order article via Infotrieve]
  13. Oltean, S., and Banerjee, R. (2003) J. Biol. Chem. 278, 20778–20784[Abstract/Free Full Text]
  14. Hellen, C. U., and Sarnow, P. (2001) Genes Dev. 15, 1593–1612[Free Full Text]
  15. Fernandez, J., Yaman, I., Mishra, R., Merrick, W. C., Snider, M. D., Lamers, W. H., and Hatzoglou, M. (2001) J. Biol. Chem. 276, 12285–12291[Abstract/Free Full Text]
  16. Holcik, M., Lefebvre, C., Yeh, C., Chow, T., and Korneluk, R. G. (1999) Nat. Cell Biol. 1, 190–192[CrossRef][Medline] [Order article via Infotrieve]
  17. Macejak, D. G., and Sarnow, P. (1991) Nature 353, 90–94[Medline] [Order article via Infotrieve]
  18. Nahvi, A., Sudarsan, N., Ebert, M. S., Zou, X., Brown, K. L., and Breaker, R. R. (2002) Chem. Biol. 9, 1043[CrossRef][Medline] [Order article via Infotrieve]
  19. Beretta, L., Gingras, A. C., Svitkin, Y. V., Hall, M. N., and Sonenberg, N. (1996) EMBO J. 15, 658–664[Medline] [Order article via Infotrieve]
  20. Nevins, T. A., Harder, Z. M., Korneluk, R. G., and Holcik, M. (2003) J. Biol. Chem. 278, 3572–3579[Abstract/Free Full Text]
  21. Finkelstein, J. (1990) J. Nutr. Biochem. 1, 228–237[CrossRef][Medline] [Order article via Infotrieve]
  22. Holcik, M., Yeh, C., Korneluk, R. G., and Chow, T. (2000) Oncogene 19, 4174–4177[CrossRef][Medline] [Order article via Infotrieve]
  23. Takyar, S. S., Gowans, E. J., and Lott, W. B. (2002) J. Mol. Biol. 319, 1–8[CrossRef][Medline] [Order article via Infotrieve]
  24. Zuker, M. (2003) Nucleic Acids Res. 31, 3406–3415[Abstract/Free Full Text]
  25. Soukup, G. A., and Breaker, R. R. (1999) RNA 5, 1308–1325[Abstract]
  26. Hershey, J. (2000) Initiation of Protein Synthesis, pp. 33–88, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  27. Stoneley, M., and Willis, A. E. (2004) Oncogene 23, 3200–3207[CrossRef][Medline] [Order article via Infotrieve]
  28. Swanson, D. A., Liu, M. L., Baker, P. J., Garrett, L., Stitzel, M., Wu, J., Harris, M., Banerjee, R., Shane, B., and Brody, L. C. (2001) Mol. Cell. Biol. 21, 1058–1065[Abstract/Free Full Text]
  29. Mellman, I. S., Youngdahl-Turner, P., Huntington, F. W., and Rosenberg, L. E. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 916–920[Abstract/Free Full Text]
  30. Kolhouse, J. F., and Allen, R. H. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 921–925[Abstract/Free Full Text]
  31. Winkler, W. C., and Breaker, R. R. (2003) Chembiochem. 4, 1024–1032[CrossRef][Medline] [Order article via Infotrieve]
  32. Winkler, W., Nahvi, A., and Breaker, R. R. (2002) Nature 419, 952–956[CrossRef][Medline] [Order article via Infotrieve]
  33. Winkler, W. C., Cohen-Chalamish, S., and Breaker, R. R. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 15908–15913[Abstract/Free Full Text]
  34. Winkler, W. C., Nahvi, A., Sudarsan, N., Barrick, J. E., and Breaker, R. R. (2003) Nat. Struct. Biol. 10, 701–707[CrossRef][Medline] [Order article via Infotrieve]
  35. Nahvi, A., Barrick, J. E., and Breaker, R. R. (2004) Nucleic Acids Res. 32, 143–150[Abstract/Free Full Text]
  36. Sudarsan, N., Barrick, J. E., and Breaker, R. R. (2003) RNA 9, 644–647[Abstract/Free Full Text]
  37. Hellen, C. U., Witherell, G. W., Schmid, M., Shin, S. H., Pestova, T. V., Gil, A., and Wimmer, E. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 7642–7646[Abstract/Free Full Text]
  38. Holcik, M., and Korneluk, R. G. (2000) Mol. Cell. Biol. 20, 4648–4657[Abstract/Free Full Text]
  39. Holcik, M., Gordon, B. W., and Korneluk, R. G. (2003) Mol. Cell. Biol. 23, 280–288[Abstract/Free Full Text]
  40. Jan, E., and Sarnow, P. (2002) J. Mol. Biol. 324, 889–902[CrossRef][Medline] [Order article via Infotrieve]
  41. Olteanu, H., and Banerjee, R. (2001) J. Biol. Chem. 276, 35558–35563[Abstract/Free Full Text]
  42. Cervantes, M., and Murillo, F. J. (2002) J. Bacteriol. 184, 2215–2224[Abstract/Free Full Text]
  43. Lopez-Rubio, J. J., Elias-Arnanz, M., Padmanabhan, S., and Murillo, F. J. (2002) J. Biol. Chem. 277, 7262–7270[Abstract/Free Full Text]
  44. Lott, W. B., Takyar, S. S., Tuppen, J., Crawford, D. H., Harrison, M., Sloots, T. P., and Gowans, E. J. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 4916–4921[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
D. Leclerc and R. Rozen
Endoplasmic Reticulum Stress Increases the Expression of Methylenetetrahydrofolate Reductase through the IRE1 Transducer
J. Biol. Chem., February 8, 2008; 283(6): 3151 - 3160.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
J. Selhub, M. S. Morris, and P. F. Jacques
In vitamin B12 deficiency, higher serum folate is associated with increased total homocysteine and methylmalonic acid concentrations
PNAS, December 11, 2007; 104(50): 19995 - 20000.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. F. Woeller, J. T. Fox, C. Perry, and P. J. Stover
A Ferritin-responsive Internal Ribosome Entry Site Regulates Folate Metabolism
J. Biol. Chem., October 12, 2007; 282(41): 29927 - 29935.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
V. Vitvitsky, M. Thomas, A. Ghorpade, H. E. Gendelman, and R. Banerjee
A Functional Transsulfuration Pathway in the Brain Links to Glutathione Homeostasis
J. Biol. Chem., November 24, 2006; 281(47): 35785 - 35793.
[Abstract] [Full Text] [PDF]

Home page
 RNAHome page
S. D. Baird, M. Turcotte, R. G. Korneluk, and M. Holcik
Searching for IRES
RNA, October 1, 2006; 12(10): 1755 - 1785.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
M. Kozak
A second look at cellular mRNA sequences said to function as internal ribosome entry sites
Nucleic Acids Res., November 28, 2005; 33(20): 6593 - 6602.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
280/38/32662    most recent
M501964200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oltean, S.
Right arrow Articles by Banerjee, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oltean, S.
Right arrow Articles by Banerjee, R.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement