Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M507617200 on August 1, 2005

J. Biol. Chem., Vol. 280, Issue 39, 33240-33249, September 30, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/39/33240    most recent
M507617200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Han, S.
Right arrow Articles by Roman, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Han, S.
Right arrow Articles by Roman, J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Activation of Peroxisome Proliferator-activated Receptor {beta}/{delta} (PPAR{beta}/{delta}) Increases the Expression of Prostaglandin E2 Receptor Subtype EP4

THE ROLES OF PHOSPHATIDYLINOSITOL 3-KINASE AND CCAAT/ENHANCER-BINDING PROTEIN {beta}*

ShouWei Han{ddagger}1, Jeffrey D. Ritzenthaler{ddagger}, Byron Wingerd§, and Jesse Roman{ddagger}

From the {ddagger}Division of Pulmonary, Allergy and Critical Care Medicine, Department of Medicine, Emory University School of Medicine, Atlanta, Georgia 30322, the §Department of Biochemistry, Michigan State University, East Lansing, Michigan 48824, and the Atlanta Veterans Affairs Medical Center, Atlanta, Georgia 30033

Received for publication, July 13, 2005


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The prostaglandin E2 receptor subtype EP4 has been implicated in the growth and progression of human non-small cell lung carcinoma (NSCLC). However, the factors that control its expression have not been entirely elucidated. Our studies show that NSCLC cells express peroxisome proliferator-activated receptor {beta}/{delta} (PPAR{beta}/{delta}) protein and that treatment with a selective PPAR{beta}/{delta} agonist (GW501516) increases EP4 mRNA and protein levels. GW501516 induced NSCLC cell proliferation, and this effect was prevented by PPAR{beta}/{delta} antisense or EP4 short interfering RNA (siRNA). GW501516 increased the phosphorylation of Akt and decreased PTEN expression. The selective inhibitor of phosphatidylinositol 3-kinase (PI3-K), wortmannin, and PPAR{beta}/{delta} antisense, abrogated the effect of GW501516 on EP4 expression, whereas that of the inhibitor of Erk did not. GW501516 also increased EP4 promoter activity through effects on the region between –1555 and –992 bp in the EP4 promoter, and mutation of the CCAAT/enhancer-binding protein (C/EBP) site in this region abrogated the effect of GW501516. GW501516 increased not only the binding activity of C/EBP to the NF-IL6 site in the EP4 promoter, which was prevented by the inhibitor of PI3-K, but also increased C/EBP{beta} protein in a dose- and PPAR{beta}/{delta}-dependent manner. The effect of GW501516 on EP4 protein was eliminated in the presence of C/EBP{beta} siRNA. Finally, we showed that pretreatment of NSCLC with GW501516 further increased NSCLC cell proliferation in response to exogenous dimethyl-prostaglandin E2(PGE2) that was diminished in the presence of PPAR{beta}/{delta} antisense and EP4 siRNA. Taken together, these findings suggest that activation of PPAR{beta}/{delta} induces PGE2 receptor subtype EP4 expression through PI3-K signals and increases human lung carcinoma cell proliferation in response to PGE2. The increase in transcription of the EP4 gene by PPAR{beta}/{delta} agonist was associated with increased C/EBP binding activity in the NF-IL6 site of EP4 promoter region and C/EBP{beta} protein expression that were mediated through both PI3-K/Akt and PPAR{beta}/{delta} signaling pathways.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Lung carcinoma is one of the most common malignant tumors in the world and is the leading cause of carcinoma death in men and women in the United States (1). Despite recent advances in understanding the molecular biology of lung carcinoma and the introduction of multiple new chemotherapeutic agents for its treatment, its dismal five-year survival rate (<15%) has not changed substantially (2). The lack of advancements in this area reflects the limited knowledge available concerning the cellular factors that promote oncogenic transformation and proliferation of carcinoma cells in the lung. Although many research programs focus on the initial transformation of cells, few studies examine the mechanisms that promote survival, proliferation, and growth of the tumors. A line of evidence indicates that overexpression of COX-2 is associated with cancer progression and development because overproduction of prostaglandin E2 (PGE2)2 promotes carcinoma growth, and inhibition of PGE2 synthesis blocks it (3, 4). The effect of PGE2 has been attributed to its known capacity to bind to receptors designated EP1, EP2, EP3, and EP4 (5–10). Acting via EP4, PGE2 contributes to the growth of gall bladder and colorectal carcinomas (7, 8). Studies with EP4 knock-out mice suggest a potential role for this receptor in colon carcinogenesis (6). More relevant to the current work, one study showed that PGE2 and its signaling through the EP4 receptor mediated NSCLC invasiveness (10). These observations led us to search for agents capable of modulating EP4 expression. This led us to PPAR{beta}/{delta}.

Like other PPARs, PPAR{beta}/{delta} functions as a ligand-activated transcription factor by heterodimerizing with the retinoid X receptor (11). Transcription of target genes occurs after the activated PPAR-retinoid X receptor complex binds to a peroxisome proliferator response element in the 5' region of a target gene. Although genes regulated by PPAR{alpha} and PPAR{gamma} have been described, far less is known about the genes that are regulated by PPAR{beta}/{delta}. Work using PPAR{beta}/{delta}-null mice suggests a possible role for PPAR{beta}/{delta} in cell cycle control (12). Studies examining the relationship of PPAR{beta}/{delta} in colon cancer suggest that PPAR{beta}/{delta} is important in colorectal cancer development. PPAR{beta}/{delta} expression and activity were found to be increased after the loss of the adenomatous polyposis coli tumor suppressor gene or after K-Ras activation, and this promoted the growth of intestinal adenomas (13). However, although PPAR{beta}/{delta} is ubiquitously expressed, a pathophysiological role for this receptor remains to be discovered. In this study, we assessed the expression of PPAR{beta}/{delta} in NSCLC and explored how its activation might affect NSCLC cell growth through stimulation of EP4 expression.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Culture and Chemicals—The NSCLC cell lines H157 and H1838 were obtained from the American Type Culture Collection (Manassas, VA) and grown in RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum, HEPES buffer, 50 IU/ml penicillin/streptomycin, and 1 µg amphotericin (complete medium) as previously described (3). The antibody against EP4, 16,16-dimethyl-prostaglandin E2 (dmPGE2), and GW9662 were obtained from Cayman Chemical Co. (Ann Arbor, MI); GW501516, ciglitazone, and WY14643 were purchased from Sigma; poly(dI-dC) and [methyl-3H]thymidine were purchased from Amersham Biosciences; [{gamma}-32P]dATP was purchased from PerkinElmer Life Sciences; the phosphatidylinositol 3-kinase (PI3-K) inhibitor wortmannin was purchased from Calbiochem; antibodies against PPAR{beta}/{delta}, C/EBPs, and actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA); antibodies against Akt, Erk1, and Erk2 and their phosphorylated forms and against phosphatase and tensin homolog on chromosome 10 (PTEN), and protein kinase C (PKC) were purchased from Cell Signaling Technology, Inc. (Beverly, MA); the gel shift assay system and the dual luciferase report assay kit were obtained from Promega (Madison, WI), and the LightCycler-FastStart DNA Master SYBR Green I kit and the 5' DNA terminus labeling system were purchased from Roche Applied Science. RT-PCR kit components were obtained from PerkinElmer Life Sciences. All other chemicals were purchased from Sigma unless otherwise indicated.

Reverse Transcriptase PCR—Total RNA was prepared from human lung carcinoma cells using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. To amplify 465-bp EP4 and 200-bp GAPDH cDNA fragments, the sequences of PCR primers (Sigma Genosys, Woodlands, TX) were: for EP4 sense (5'-TCGCGCAAGGAGCAGAAGGAGAC-3') and antisense (5'-GACGGTGGCGAGAATGAGGAAGGA-3'), and for GAPDH sense (5'-CCATGGAGAAGGCTGGGG-3') and antisense (5'-CAAAGTTGTCATGGATGACC-3'), according to published data (14). RT-PCR was carried out as previously described (14). The samples were first denatured at 95 °C for 30 s, followed by 32 PCR cycles, each with temperature variations as follows: 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s. The last cycle was followed by an additional extension incubation of 7 min at 72 °C. Analysis of amplicons was accomplished on 1% agarose gel containing 0.2 µg/µl ethidium bromide and visualized under a UV transiluminator. The densitometric analysis of PCR products was performed by computer software (Bio-Rad Quantity One) and a GS-800 Imaging Densitometer. A 100-bp ladder (Invitrogen) was used as a size standard.

Real Time RT-PCR—This procedure was described previously (3, 14). The final results, which were expressed as n-fold differences in EP4 gene expression relative to the GAPDH gene, were calculated using the following formula, which is based on a doubling of the product after each cycle.

(Eq. 1)
C indicates the cycle threshold for EP4 or GAPDH mRNA detection in control samples, and T indicates the cycle threshold for EP4 or GAPDH mRNA detection in treatment samples. The treatment and total RNA preparation was identical to that described for RT-PCR. All PCRs using the LightCycler-FastStart DNA Master SYBR Green I kit were performed in the Cepheid Smart-Cycler real time PCR cycler (Sunnyvale, CA). The cycling conditions were as follows: initial denaturation at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s, 60 °C for 10 s, and 72 °C for 10 s. The experiments were performed in triplicate for each data point. For all of the experiments, controls without templates were included.

Oligodeoxynucleotide and Short Interfering RNA (siRNA) Transfections—The sequences of phosphorothioate oligodeoxynucleotides and Akt siRNA duplexes used in this study were as follows: The antisense-oligonucleotide sequence was 5'-CGGAGGCTGCTCCATGGCT-3' (referred to as AS PPAR{beta}/{delta}) and the corresponding sense-sequence was 5'-TCAGCCATGGAGCAGCCTCCG-3' (referred to as S PPAR{beta}/{delta}). For the Akt siRNA, we used 5'-GCUGGAGAACCUCAUGCUGTT-3' (sense) and 5'-CAGCAUGAGGUUCUCCAGCTT-3' (antisense), which were synthesized by Sigma Genoys according to published data (10, 15). The EP4 siRNA (catalog number M-005714-00) was purchased from Dharmacon Inc (Lafayette, CO). C/EBP{beta} siRNA (siRNA identification number 114496 and catalog number 16708) was purchased from Ambion (Austin, TX). For the transfection procedure, the cells were grown to 70% confluence, and PPAR{beta}/{delta} oligonucleotides or Akt, EP4, and C/EBP{beta} siRNA and their respective control oligonucleotides or control siRNA were transfected using the LipofectamineTM 2000 reagent (Invitrogen) according to the manufacturer's instructions. Briefly, LipofectamineTM 2000 reagent was incubated with serum-free medium for 10 min. Subsequently, a mixture of respective antisense, sense oligonucleotide or siRNA was added. After incubation for 15 min at room temperature, the mixture was diluted with medium and added to each well. The final concentration of PPAR{beta}/{delta} oligonucleotides or Akt, EP4, C/EBP{beta} siRNA in each well was 5 µM and 100 nM, respectively. After culturing for 24–30 h, the cells were washed and resuspended in new culture media. Afterward, the cells were treated with GW501516 for an additional 24 h for Western blot, [3H]thymidine incorporation assay, and gel mobility shift assay.

Western Blot Analysis—The procedure was performed as previously described (3, 14). Protein concentrations were determined by the Bio-Rad protein assay. Equal amounts of protein from whole cell lysates (50 µg) were solubilized in 2x SDS sample buffer and separated on SDS-6% polyacrylamide gels. The blots were incubated with antibodies raised against PPAR{beta}/{delta}, EP4, Akt, phosphor-Akt, PTEN, C/EBP{beta}, C/EBP{gamma}, and C/EBP{alpha} (1:1000). The blots were washed and followed by incubation with a secondary goat antibody raised against rabbit IgG conjugated to horseradish peroxidase (1:2000; Cell Signaling, Beverly, MA). The blots were washed, transferred to freshly made ECL solution (Amersham Biosciences) for 1 min, and exposed to x-ray film. In controls, the antibodies were omitted or replaced with a control rabbit IgG.

[Methyl-3H]Thymidine Incorporation Assay—Cells (0.5 x 104) were incubated with 1 µCi/ml [methyl-3H]thymidine (Amersham Biosciences; specific activity, 250 Ci/mmol) in the presence or absence of the indicated concentrations of GW501516 for up to 24 h. The medium was removed, and the attached cells were washed with 1x phosphate-buffered saline. Afterward, the attached cells were treated with ice-cold 6% trichloroacetic acid at 4 °C for 20 min and washed once with 6% trichloroacetic acid. The cells were then solubilized with 0.1 N NaOH and counted in a liquid scintillation counter in 4 ml of scintillation fluid.

Site-directed Mutagenesis—The C/EBP element located at –1472 bp within the mouse EP4 receptor promoter was mutated using the GeneTailor site-directed mutagenesis system from Invitrogen according the manufacturer's instructions. The mutagenic primer sequence was as follows: TTTAGGAGAATAGTTGATAAGACTAGTCTGATTGTTCC (underline depicts mutated base pairs). The reverse primer sequence was the following: TTATCAACTATTCTCCTAAAAAACAGAATTTAA. Briefly, double-stranded EP4 promoter plasmid was alkaline denatured, precipitated, washed, and resuspended in TE. Mutated NF-IL6 (C/EBP) oligonucleotide and selection oligonucleotide were annealed; the mutant strand was synthesized, ligated, and transformed into BMH 71–18 mutS competent cells. The mutated NF-IL6 (C/EBP) EP4 plasmid was isolated and transformed into JM109 competent cells. Approximately 10–20 colonies were selected and screened for mutants by sequencing using an Applied Biosystems ABI Prism 377 DNA sequencer. The mutated CEB/P EP4 receptor promoter was then transfected into H157 cells for 24 h and tested for its ability to respond to GW591516 for Luciferase assay.

Transient Transfection Assay—The mouse EP4 wild type and deletion promoter constructs (pGlep4-1 to -5) ligated to the luciferase reporter gene have been reported previously (16). The EP4 promoter construct contains ~4200 bp of the 5'-flanking region of the mouse EP4 receptor gene connected to the pGL3 basic luciferase reporter vector (Promega). NSCLC cells were seeded at a density of 5 x 105 cells/well in 6-well dishes and grown to 50–60% confluence. For each well, 2 µgof the above plasmid DNA constructs, and 0.2 µg of the internal control phRL-TK synthetic Renilla luciferase were cotransfected into the cells using FuGENE 6 lipofection reagent (Roche Applied Science) as described in our earlier work (3). After 24 h of incubation, the cells were treated with or without ciglitazone (30 µM), GW501516 (1 µM), or WY14643 (15 µM) for an additional 24 h. The preparation of cell extracts and measurement of luciferase activities were carried out using the dual luciferase reporter kit according to recommendations by the manufacturer (Promega). The assays for firefly luciferase activity and Renilla luciferase activity were performed sequentially in a Labsystems Luminoskan Ascent luminometer equipped with dual injectors. Changes in firefly luciferase activity were calculated and plotted after normalization with changes in Renilla luciferase activity within the same sample.

Electrophoretic Mobility Shift Assay—Electrophoretic mobility shift assay experiments were performed as described before (3). The oligonucleotides used as probes were: wild type Sp1 (5'-CTCCCCGCCCAAGCCTGG-3'); mutant Sp1 (5'-CTCCCttCCCAAGCCTGG-3'); wild type C/EBP (5'-GATAATTAAGAAATGAT-3'); C/EBP mutant (5'-GATccTTAAGAAATGA-3'); wild type activator protein-2 (AP-2) (5'-TCCTCCCCGCCTCCGC-3'); and mutant AP-2 (5'-TCCTCtttGCCTCCGC-3'), which were based on EP4 promoter sequences (16). The complimentary oligonucleotides were annealed and purified following the manufacturer's protocol (Sigma). The Sp1, C/EBP, and AP-2 oligonucleotides were end-labeled with [{gamma}-32P]ATP using T4 polynucleotide kinase as recommended by the manufacturer. Nuclear proteins (5 µg) were first incubated under binding conditions (10 mM HEPES, Tris-HCl, pH 7.9, 50 mM KCl, 0.1 mM EDTA, 1 mM dithiothreitol, 12% (v/v) glycerol, and 2 µg of poly(dI-dC)) for 10 min and then [{gamma}-32P]ATP probe was added for another 20 min at room temperature in a final volume of 20 µl. For cold competition, a 100-fold excess of the respective unlabeled consensus oligonucleotides was added for 15 min before adding the probe. The same amount of mutated oligonucleotides added with the probe was used as another control. When applicable, 2 µg of anti-C/EBPs antibodies were added to each binding reaction. All of these were in the same binding conditions as described before. After binding, protein-DNA complexes were electrophoresed on a native 4.5% polyacrylamide gel at 150 volts using 1x Tris-glycine buffer (10x Tris-glycine: Tris base, 30.28 g; glycine, 142.7 g; EDTA, 3.92 g; and H2O added up to 1 liter, pH 8.5). Each gel was then dried and subjected to autoradiography at –80 °C.

Statistical Analysis—All of the experiments were repeated a minimum of three times. Data from gel shift assays, luciferase activity assays, RT-PCR or real time RT-PCR, and Western blots were expressed as the means ± S.D. The data presented in some figures are from a representative experiment that was qualitatively similar in the replicate experiments. Statistical significance was determined with Student's t test (two-tailed) comparison between two groups of data set. The asterisks shown in the figures indicate significant differences of experimental groups in comparison with the corresponding control condition (p < 0.05; see figure legends).



View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 1.
Dose- and time-dependent effects of the PPAR{beta}/{delta} agonist on EP4 protein expression in human lung carcinoma cells. A, expression of PPAR{beta}/{delta} protein in two NSCLC cell lines. Cellular protein was isolated from H157 and H1838 cells and tested for PPAR{beta}/{delta} protein via Western blotting; actin was tested as control. B, dose-dependent effect of GW501516 on EP4 protein expression. Cellular protein was isolated from H157 cells treated with increasing concentrations of GW501516 as indicated followed by Western blotting for EP4 protein. C, time-dependent effect of GW501516 on EP4 protein expression. Cellular protein was isolated from H157 cells treated with GW501516 (1 µM) for the indicated time period. Afterward, the samples were subjected to Western blot analysis using a polyclonal antibody against EP4. Actin served as internal control for normalization purposes. The right panel summarizes the data by showing the densitometric analysis of at least three separate experiments. *, significant difference from control (0).

 

   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
PPAR{beta}/{delta} Agonist Increases EP4 Expression in a Dose- and Time-dependent Manner—We first examined whether human lung carcinoma cells contain PPAR{beta}/{delta}. In both the H157 and H1838 human NSCLC cell lines, the expression of PPAR{beta}/{delta} was clearly evident (Fig. 1A). In H157 cells, treatment with GW501516, a selective PPAR{beta}/{delta} agonist, resulted in increased EP4 protein. This stimulatory effect occurred in a dose- and time-dependent manner with maximal efficiency at 1 µM in 24 h (Fig. 1, B and C). GW501516 also induced the expression of EP4 mRNA in a dose-dependent manner with optimal induction at 1 µM in 24 h as determined by RT-PCR analysis in H157 cells (Fig. 2A). This finding was confirmed with real time RT-PCR analysis (Fig. 2B). Higher concentrations of GW501516 had no further effect or even less effect. To test whether the effect of GW501516 on EP4 involves the activation of PPAR{beta}/{delta}, H157 cells were transfected with PPAR{beta}/{delta} antisense or sense oligodeoxynucleotides before exposing the cells to the GW501516. As shown in Fig. 2C, the PPAR{beta}/{delta} antisense blocked the stimulatory effect of the PPAR{beta}/{delta} agonist on EP4 protein expression, whereas the PPAR{beta}/{delta} sense oligonucleotide had no effect, indicating the dependence of PPAR{beta}/{delta} activation for mediating the effects of GW501516. Similar results were obtained in H1838 cells (not shown).

Antisense Oligonucleotides for PPAR{beta}/{delta} and EP4 siRNA Functionally Block PPAR{beta}/{delta} Agonist-induced Human Lung Carcinoma Cell Growth—Having found that the PPAR{beta}/{delta} agonist stimulates EP4 expression, we tested whether it stimulates NSCLC cell growth. As shown in Fig. 3A, H157 cells exposed to GW501516 for 24 h showed an increase in cell proliferation in a dose-dependent manner with the maximal increase seen at 1µM as determined by [methyl-3H]thymidine incorporation assay. Next, we investigated whether the effects of the agonist were due to PPAR{beta}/{delta} activation and EP4 expression. To this end, we depleted PPAR{beta}/{delta} from the cells using antisense oligonucleotides. As shown in Fig. 3B, in H157 cells, the PPAR{beta}/{delta} antisense oligonucleotide completely blocked PPAR{beta}/{delta} protein production. A siRNA strategy was used to delete EP4 (Fig. 3C). The levels of PPAR{beta}/{delta} and EP4 proteins remained unchanged in cells transfected with PPAR{beta} sense oligodeoxynucleotides or control siRNA, respectively. To determine the role of PPAR{beta}/{delta} and EP4 in the growth-promoting effects of GW501516, H157 cells were transfected with PPAR{beta}/{delta} antisense oligonucleotide or EP4 siRNA using the oligofectamine transfection reagent as described previously. Afterward, the cells were treated with GW501516 for an additional 24 h. As shown in Fig. 3 (D and E), the stimulatory effect of GW501516 was inhibited by the PPAR{beta}/{delta} antisense oligodeoxynucleotides (Fig. 3D) and EP4 siRNA (Fig. 3E), whereas PPAR{beta}/{delta} sense oligodeoxynucleotides and EP4 control siRNA had no effect. PPAR{beta}/{delta} antisense or EP4 siRNA alone also reduced the NSCLC cell proliferation slightly (Fig. 3, D and E). Together, these observations suggest that PPAR{beta}/{delta} activation by GW501516 induces EP4 expression, and both of these (i.e. PPAR{beta}/{delta} and EP4) are required for NSCLC cell proliferation and the growth-promoting effects of GW501516.



View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 2.
Effect of the PPAR{beta}/{delta} agonist and PPAR{beta}/{delta}-antisense oligonucleotides on EP4 expression in human lung carcinoma cells. A, dose-dependent effect of GW501516 on EP4 mRNA expression. Total RNA was isolated from H157 cells cultured with increasing concentrations of GW501516 followed by RT-PCR analysis. GAPDH expression was evaluated as control. B, effect of GW501516 on EP4 mRNA expression as determined by real time RT-PCR. Total RNA was isolated from H157 cells cultured in the presence or absence of GW501516 (1 µM) followed by real time PCR. GAPDH served as internal control for normalization purposes. C, antisense oligonucleotides of PPAR{beta}/{delta} block the effect of GW501516 on EP4 protein expression. Cellular protein was isolated from H157 cells transfected with control or PPAR{beta}/{delta} antisense oligonucleotide (5 µM each) for 24 h before exposing the cells to GW501516 (1 µM) for an additional 24 h and then subjected to Western blot analysis. The data are expressed as the means ± S.D. of at least three independent experiments. *, significant difference from control (Con). **, significance of combination treatment as compared with GW501516 alone.

 



View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 3.
Antisense oligonucleotides for PPAR{beta}/{delta} and EP4 siRNA prevent PPAR{beta}/{delta} agonist-induced lung carcinoma cell growth and EP4 protein expression. A, effect of GW501516 on cell proliferation. H157 cells (0.5 x 104/well in 6-well dish) cultured with increasing concentrations of GW501516 were incubated with 1 µCi/ml [methyl-3H]thymidine for 24 h to examine cell proliferation. Note that GW501516 stimulated cell thymidine incorporation, indicating a mitogenic effect. B, effect of PPAR{beta}/{delta} antisense oligonucleotides on PPAR{beta}/{delta} protein. Cellular protein was isolated from H157 cells transfected with control or PPAR{beta}/{delta} antisense oligonucleotides (5 µM each) for 24 h and then subjected to Western blot analysis to detect PPAR{beta}/{delta} or actin (control). C, effect of EP4 siRNA on EP4 protein expression. Cellular protein was isolated from H157 cells transfected with control or EP4 siRNA (100 nM each) for 30 h and then subjected to Western blot analysis to detect EP4 and actin (control). D, effect of PPAR{beta}/{delta} antisense oligonucleotide on cell proliferation induced by GW501516. H157 cells (0.5 x 104 well in 6-well dish) were transfected with control or PPAR{beta}/{delta} antisense oligonucleotides for 24 h before being exposed to GW501516 (1 µM). Afterward, the cells were incubated with 1 µCi/ml [methyl-3H]thymidine for an additional 24 h to examine cell proliferation. E, effect of EP4 siRNA on cell proliferation induced by GW501516. H157 cells (0.5 x 104 well in 6-well dish) were transfected with control or EP4 siRNA for 30 h before being exposed to GW501516 (1 µM). Afterward, the cells were incubated with 1 µCi/ml [methyl-3H]thymidine for an additional 24 h as indicated to examine cell proliferation. *, significant difference from control (Con). **, significance of combination treatment as compared with GW501516 alone.

 
The PI3-K/Akt but Not Erk Signal Pathway Is Involved in PPAR{beta}/{delta} Agonist-induced EP4 Protein Expression—Next, we examined the intracellular mechanisms involved in the induction of EP4 by the PPAR{beta}/{delta} agonist. Specifically, we tested whether regulation of EP4 by the PPAR{beta}/{delta} agonist was mediated by activation of the PI3-K/Akt, PKC, and mitogen-activated protein kinase kinase/extracellular signal-regulated kinase (MEK-1/Erk) pathways, because these kinases have been shown to be involved in regulating the expression of the EP4 gene, and PI3-K signals have been linked to PPAR{beta}/{delta} activation. As shown in Fig. 4A, the PPAR{beta}/{delta} agonist GW501516 increased the phosphorylation of Akt protein in a time-dependent manner, whereas it had no effect on the abundance of total Akt and PKC protein content. GW501516 also decreased the expression of the tumor suppressor gene PTEN in a time-dependent manner. The stimulatory effect of GW501516 on phosphorylation of Akt was abrogated in the presence of PPAR{beta}/{delta} antisense but not sense oligonucleotides (Fig. 4B). Consistent with a role for Akt, treatment with wortmannin, an inhibitor of the PI3-K/Akt pathway, blocked the stimulatory effect of GW501516 on EP4 protein expression (Fig. 4C). In parallel studies, siRNA interference assays were used to eliminate endogenous Akt expression in H157 cells. Western blot analysis in Fig. 4D demonstrates that cells transfected with the Akt siRNA eliminated Akt protein expression (98% of control). Cells transfected with Akt siRNA had similar amounts of EP4 protein as compared with nontreated control cells but showed limited induction of EP4 when treated with GW501516 (Fig. 4E).



View larger version (42K):
[in this window]
[in a new window]
  		FIGURE 4.
Role of the PI3-K/Akt pathway in the induction of EP4 by the PPAR{beta}/{delta} agonist. A, effect of GW501516 on Akt, PTEN, and PKC protein expression. Cellular protein was isolated from H157 cells cultured for the indicated periods of time in the presence or absence of GW501516 (1 µM), and then Western blot analysis was performed with antibodies against Akt and its phosphorylation form, PTEN and PKC. Note that GW501516 increased p-Akt but diminished PTEN. B, effect of PPAR{beta}/{delta} antisense on GW501516-induced phosphorylation of Akt. Cellular protein was isolated from H157 cells first transfected with control or PPAR{beta}/{delta} antisense oligonucleotides for 24 h before being exposed to GW501516 (1 µM) for an additional 4 h. Afterward, Western blot analysis was performed with antibodies against Akt and its phosphorylation form. C, effect of a PI3-K inhibitor on GW501516-induced EP4 expression. Cellular protein was isolated from H157 cells cultured with wortmannin (100 nM) for 1 h before exposing the cells to GW501516 (1 µM) for an additional 24 h, followed by Western blot analysis using an antibody against EP4. D, the effect of Akt siRNA on Akt protein expression. Cellular protein was isolated from H157 cells transfected with Akt siRNA or control (Con) siRNA (100 nM each) for 30 h followed by Western blot analysis for total Akt protein detection. E, effect of Akt siRNA on GW501516-induced EP4 protein expression. Cellular protein was isolated from H157 cells transfected with Akt siRNA or control (Con) siRNA (100 nM each) for 30 h before exposing the cells to GW501516 (1 µM) for an additional 24 h. Afterward, Western blot analysis was performed for EP4. F, effect of Akt siRNA on GW501516-induced NSCLC cell growth. H157 cells (0.5 x 104/well in 6-well dish) transfected with Akt siRNA or control (Con) siRNA (100 nM each) for 30 h before exposing the cells to GW501516 (1 µM) and incubated with 1 µCi/ml [methyl-3H]thymidine for an additional 24 h to examine cell proliferation. G, effects of GW501516 on Erk1/2 protein expression and phosphorylation. Cellular protein was isolated from H157 cells cultured for the indicated periods of time in the presence or absence of GW501516 (1 µM), and then Western blot analysis was performed with antibodies against Erk1 and Erk2, and its phosphorylation form (p-Erk1/2). H, effect of a MEK-1/Erk pathway inhibitor on GW501516-induced EP4 protein expression. Cellular protein was isolated from H157 cells cultured with the MEK-1/Erk inhibitor PD98095 (25 µM) for 1 h before being exposed to GW501516 (1 µM) for an additional 24 h, followed by Western blot analysis using an antibody against EP4. The right panels in A, B, C, E, G, and H summarize the results by depicting the results of densitometric analysis of gels. Actin served as internal control for normalization purposes. *, significant difference from control (Con). **, significance of combination treatment as compared with GW501516 alone.

 
We also tested the role of Akt in mediating the growth-promoting effects of GW501516. As shown in Fig. 4F, Akt siRNA transfected into H157 cells resulted in a reduction of NSCLC cell growth; it also diminished the stimulatory effect of GW501516-induced cell proliferation. The control siRNA had no effect.

We also found that GW501516 activated the phosphorylation of Erk1/2 in a time-dependent manner, whereas it had no effect on the abundance of Erk1 and Erk2 total protein content (Fig. 4G). However, the inhibitor of Erk1/2, PD98095, had no effect on GW501516-induced EP4 protein expression, suggesting that the MEK-1/Erk pathway is not critical for this process (Fig. 4H).



View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 5.
Effect of the PPAR{beta}/{delta} agonist on EP4 promoter activity. A, promoter map. The 5'-flanking region of the mouse EP4 gene and wild type promoter constructs schematics are presented. This region contains several transcription factor-binding sites including NF-{kappa}B (open circle), AP-2 (solid rectangle), Sp1 (open rectangle), AP-1 (solid square), NF-IL6 (solid circle), and others. B, effects of PPAR agonists on EP4 promoter activity. H157 cells (1 x 105 well in 6-well dish) were cotransfected with a full-length and several deleted mouse EP4 promoter reporter constructs shown in A connected to the luciferase reporter gene and an internal control phRL-TK Synthetic Renilla luciferase reporter vector for 24 h, followed by exposure to ciglitazone (30 µM), GW501516 (1 µM), or WY14643 (15 µM) for an additional 24 h. The ratio of firefly luciferase to Renilla luciferase activity was quantified as described under "Experimental Procedures." The bars represent the means ± S.D. of at least four independent experiments for each condition. The PPAR{alpha} agonist (WY14643) had no effect. *, significant inhibition of activity as compared with vehicle controls (Con).

 
The Effect of PPAR{beta}/{delta} Agonist on EP4 Gene Promoter Activity—The EP4 gene promoter contains multiple transcription factor-binding sites including NF-IL6 (C/EBP), Sp1, and AP-2 (Fig. 5A), and these sites have been shown to respond to different stimuli (16–18). To elucidate the cis-acting elements in the EP4 gene promoter that mediate the stimulatory effects of the PPAR{beta}/{delta} agonist, transient transfection assays were performed with wild type and deletion constructs connected to a luciferase reporter gene. As shown in Fig. 5B, the PPAR{beta}/{delta} agonist GW501516 (1 µM) increased, whereas ciglitazone (30 µM), a PPAR{gamma} ligand, reduced EP4 promoter (–4200/–116 and –1555/–116 bp) activities in H157 cells. WY14643, a PPAR{alpha} agonist, had no effect. Of note, there was no response to GW501516 with other EP4 deletion constructs (–992/–116 and –554/–116 bp), indicating that the region between –1555 and –992 bp in the promoter of EP4 played an important role in mediating the effect of GW501516.

C/EBP{beta} Binding to C/EBP Sites, but Not Sp1 and AP-2 Sites, in the EP4 Gene Promoter Mediate the Effects of the PPAR{beta}/{delta} Agonist on EP4 Gene Expression—Electrophoretic mobility shift assays were performed to identify the transcription factors that mediate the induction of EP4 gene expression by the PPAR{beta}/{delta} agonist. As shown in Fig. 6, the PPAR{beta}/{delta} agonist GW501516 caused an induction in the binding of C/EBP (Fig. 6A), whereas few effects were noticed in AP-2 (Fig. 6B) and Sp1 (Fig. 6C) binding activities. The addition of C/EBP{beta} antibody resulted in one supershift band in the group treated with GW501516, whereas incubation with other two C/EBP antibodies resulted in no supershift bands (Fig. 6D). Also, we found that GW501516 induced C/EBP{beta} protein in a time-dependent manner with maximal increase at 24 h, whereas it had no effect on C/EBP{alpha} and C/EBP{gamma} protein levels (Fig. 7A). The effect of GW501516-induced C/EBP{beta} protein was blocked in the presence of PPAR{beta}/{delta} antisense but not sense oligonucleotides (Fig. 7B). Consistent with this result, we found that GW501516 had no effect on EP4 promoter (–1555/–116) activity in which the NF-IL6 (C/EBP) site was mutated (Fig. 8A); this suggests that the NF-IL6 (C/EBP) site in this region plays a key role in mediating the effect of GW501516. To further determine the role of C/EBP{beta}, siRNA interference assay was used to knock down the expression of C/EBP{beta}; as shown in Fig. 8B, H157 cells transfected with C/EBP{beta} siRNA completely eliminated C/EBP{beta} protein production, whereas control siRNA had no effect. C/EBP{beta} siRNA also abolished the effect of GW501516-induced EP4 protein expression as compared with the cells exposed GW501516 alone. The control siRNA had no such effect (Fig. 8C). Together, these results suggest that increased transcription factor C/EBP{beta} binding to C/EBP sites play a critical role in mediating the effect of GW501516 in regulation of EP4 gene expression.

The Effects of Combination Treatment with PPAR{beta}/{delta} Agonist and Exogenous PGE2 on EP4 Expression and Cell Growth—PGE2 has been demonstrated to promote carcinoma cell growth and invasion. Its mitogenic effects are, at least in part, mediated by EP4. We reasoned that stimulation of EP4 expression by GW501516 would further enhance the growth-promoting effect of PGE2. Here, we show that cotreatment with GW501516 and dmPGE2 dramatically increased the expression of EP4 protein (Fig. 9A). We also found that the concomitant addition of GW501516 and dmPGE2 stimulated NSCLC cell growth more efficiently when compared with either reagent alone (Fig. 9B). We next examined whether the mitogenic effects of PGE2 on cell growth were related to the PPAR{beta}/{delta} or EP4 signals; as shown in Fig. 9C, NSCLC cells transfected with PPAR{beta}/{delta} antisense or EP4 siRNA resulted in blockade of the stimulatory effect of PGE2 on NSCLC cell growth, suggesting that both PPAR{beta}/{delta} and EP4 signals were involved in the stimulatory effect of PGE2.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Despite the ubiquitous expression of PPAR{beta}/{delta}, its physiological and pathophysiological roles remain unclear, particularly in cancer biology. In this study, we provide evidence for a role of PPAR{beta}/{delta} activation in the regulation of lung carcinoma cell proliferation. We demonstrated that PPAR{beta}/{delta} is expressed in human lung carcinoma cells and that the highly selective agonist for PPAR{beta}/{delta}, GW501516, stimulated carcinoma cell proliferation. This observation is important particularly in view of other data indicating that agonists of other PPARs (e.g. PPAR{gamma}) inhibit carcinoma cell growth (19, 20). Furthermore, we demonstrated that the mitogenic effect of the PPAR{beta}/{delta} agonist is associated with the induced expression of the PGE2 receptor subtype EP4. PGE2 is a predominant prostaglandin product of the cyclooxygenase pathway found in several tumors. It is known to promote cancer growth and invasion, and inhibition of PGE2 synthesis blocks the growth of carcinoma cells (3, 4). The effects of PGE2 are often mediated by its receptors including EP4 (5).



View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 6.
Electrophoresis mobility gel shift assays to determine the DNA binding activities of C/EBP, AP-2, and Sp1 protein and the effect of the PPAR{beta}/{delta} agonist on this process. A–C, effects of the PPAR{beta}/{delta} agonist on transcription factor DNA binding. Oligonucleotides containing the C/EBP (A), AP-2 (B), or Sp1 (C) sites were end-labeled with [{gamma}-32P]ATP and incubated with nuclear extracts (5 µg) from H157 cells treated with GW501516 (1 µM), ciglitazone (30 µM), or WY14643 (15 µM)) for 24 h followed by gel loading and electrophoresis. D, the supershift assay for C/EBPs. Oligonucleotides containing C/EBP site were end-labeled with [{gamma}-32P]ATP and incubated with nuclear extracts (5 µg) isolated from H157 cell treated with GW501516 for 24 h and with C/EBP{alpha}, {beta}, and {gamma} antibodies separately for 30 min followed by gel loading and electrophoresis. E, effect of the PI3-K/Akt inhibitor on C/EBP. Oligonucleotides containing C/EBP site were end-labeled with [{gamma}-32P]ATP and incubated with nuclear extracts (5 µg) from H157 cells treated with wortmannin (100 nM) for 1 h before exposing the cells to GW501516 (1 µM) for an additional 24 h. For competition assays, a molar excess (x100) of consensus C/EBP (Cold C/EBP), AP-2 (Cold AP-2), or Sp1 (Cold Sp1) oligonucleotide were added to the binding reaction. Oligonucleotides containing mutated C/EBP (Mut C/EBP), AP-2 (Mut AP-2), or Sp1 (Mut Sp1) sites that were end-labeled with [{gamma}-32P]ATP were used to confirm the binding specificity. Con, control.

 
EP4 has been shown to play an important role in carcinoma growth and progression (6–10). The activation of T lymphocytes up-regulates EP4 receptor mRNA expression, and PGE2 enhances non-neuronal lymphocytic cholinergic transmission in human leukemic T cells, at least in part, via EP4 receptor-mediated pathways (21). Others found a functional link between PGE2-induced cell proliferation and EP4-mediated Erk signaling, and PGE2 stimulated mouse colon adenocarcinoma (CT26) cell growth through this receptor-signaling pathway (8). Yet another study showed that PGE2 and its signaling through the EP4 receptor mediated NSCLC invasiveness (10). In view of the above, we investigated the mechanisms responsible for controlling EP4 expression.

Recent studies have suggested a role for PPAR{beta}/{delta} in colorectal and hepatocellular cancer (22, 23); however, its role in lung carcinoma is unknown. To explore this, we first evaluated the effects of PPAR{beta}/{delta} activation on NSCLC cell proliferation. We found that GW501516 stimulates NSCLC cell growth and that the blockade of PPAR{beta}/{delta} prevents the basal and stimulatory effect of the PPAR{beta}/{delta} agonist, confirming a role for PPAR{beta}/{delta}-dependent signals in NSCLC cell growth. GW501516, which is a PPAR{beta}/{delta} subtype-selective agonist (24), has been shown to stimulate the growth of several other cancer cells through activation of PPAR{beta}/{delta} (23, 25). We also showed that the functional knock down of EP4 production resulted in inhibition of cell growth in basal conditions and in response to GW501516. This suggests that EP4 is required for NSCLC cell growth and plays a direct role in mediating the PPAR{beta}/{delta} agonist effect. Furthermore, we assessed the consequences of PPAR{beta}/{delta} activation on EP4 expression and found that GW501516 increased the expression of EP4 protein, which, in turn, can be blocked by a PPAR{beta}/{delta} antisense oligonucleotide. Together, these findings suggest that activation of PPAR{beta}/{delta} is required for the effects of GW501516 on NSCLC cell proliferation and EP4 induction.

Few studies have explored the intracellular mechanisms by which PPAR{beta}/{delta} agonists stimulate human carcinoma cell growth. The PI3-K/Akt pathway has been shown to play a central role in protecting cells against apoptosis. Akt is also reported to be involved in tumorigenesis (26). We found that GW501516 increased the phosphorylation of Akt and decreased the tumor suppressor gene PTEN. Similarly, PPAR{beta}/{delta} agonists have been reported by others to activate the PI3-K/Akt signal in keratinocytes (27). We also showed that the increased phosphorylation of Akt by GW501516 was eliminated by the PPAR{beta}/{delta} antisense, but not sense oligonucleotides, indicating the role of PPAR{beta}/{delta} activation in mediating the effect of this agonist on PI3-K/Akt signal regulation. The stimulatory effect of GW501516 on EP4 protein was abolished in the presence of the PI3-K/Akt inhibitor wortmannin, as well as by Akt siRNA interference, indicating the involvement of PI3-K/Akt signals in mediating the up-regulation of EP4 by PPAR{beta}/{delta} activation in our system.

Our findings with PTEN are interesting because PTEN has been implicated in a variety of human cancers including lung cancer (28, 29), and it is considered a prognostic factor for overall and disease-free survival in patients with non-small cell lung cancer (29). PTEN activity normally serves to restrict growth and survival signals by limiting activity of the PI3-K pathway. Indeed, the absence of functional PTEN in cancer cells leads to constitutive activation of downstream components of the PI3-K pathway including the Akt and the mammalian target of rapamycin signal (28). In contrast, PTEN was reported to be up-regulated by the PPAR{gamma} agonist rosiglitazone in human pancreatic cancer cells (30). The opposite regulation of PTEN by PPAR{beta}/{delta} (this report) and PPAR{gamma} suggests a PPAR- and cell-specific regulation of PTEN, which remains to be further explored. We also examined the role of the MEK-1/Erk pathway. Prostacyclin (PGI2), which serves as an agonist for PPAR{beta}/{delta}, has been shown to activate the MEK-1/Erk signal in other cell systems (31, 32). Here, GW501516 also increased the phosphorylation of the MEK-1/Erk signal; however, the inhibitor of MEK-1/Erk, PD98095, did not inhibit the stimulatory effect of GW501516 on EP4. This suggests that activation of MEK-1/Erk by the PPAR{beta}/{delta} agonist is not involved in the regulation of EP4 expression in NSCLC cells.



View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 7.
Effects of the PPAR{beta}/{delta} agonist on nuclear protein C/EBP protein levels. A, the effect of GW501516 on C/EBP protein expression. Nuclear protein (20 µg) was isolated from H157 cells treated with GW501516 (1 µM) at indicated time periods. Afterward, Western blot analysis was performed using polyclonal antibodies against C/EBP{alpha}, C/EBP{beta}, or C/EBP{gamma}. B, the PPAR{beta}/{delta} antisense abrogated the effect of GW501516 on C/EBP{beta}. Cellular protein was isolated from H157 cells first transfected with control or PPAR{beta}/{delta} antisense oligonucleotides for 24 h before being exposed to GW501516 (1 µM) for an additional 24 h. Afterwards, Western blot analysis was performed with antibody against C/EBP{beta}. The right panel summarizes the results of densitometry analysis of the gels. *, significance as compared with vehicle controls (Con). **, significance of combination treatment as compared with GW501516 alone.

 



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 8.
The C/EBP{beta} binds to NF-IL6 (C/EBP) and mediates the effect of GW501516 on EP4 expression. A, effect of PPAR{beta}/{delta} agonist on EP4 promoter activity. H157 cells were cotransfected with a mouse wild type and mutated (NF-IL6 site) EP4 promoter reporter construct (–1555/–116 bp) connected to the luciferase reporter gene and an internal control phRL-TK synthetic Renilla luciferase reporter vector for 24 h, followed by exposure to GW501516 (1 µM) for an additional 24 h. The ratio of firefly luciferase to Renilla luciferase activity was quantified as described under "Experimental Procedure." The bars represent the means ± S.D. of at least four independent experiments for each condition. B, effect of C/EBP{beta} siRNA on C/EBP{beta} expression. Cellular protein was isolated from H157 cells transfected with C/EBP{beta} siRNA or control (Con) siRNA (100 nM each) for 30 h followed by Western blot analysis for C/EBP{beta} protein detection. C, effect of C/EBP{beta} siRNA on GW501516-induced EP4 protein expression. Cellular protein was isolated from H157 cells transfected with C/EBP{beta} siRNA or control (Con) siRNA (100 nM each) for 30 h before exposing the cells to GW501516 (1 µM) for an additional 24 h. Afterward, Western blot analysis was performed for EP4. *, significant inhibition of activity as compared with vehicle controls.

 



View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 9.
Effects of the PPAR{beta}/{delta} agonist and PGE2 on the expression of EP4 and cell growth. A, effects of GW501516 and PGE2 on EP4 protein expression. Cellular protein was isolated from H157 cells cultured for 24 h in the presence or absence of GW501516 (1 µM), dmPGE2 (10 µg/ml), or both. Afterward, Western blot analysis was performed with antibodies against EP4; actin was used as control. The lower graph summarizes the data by depicting the results of the densitometric analysis of gels. B, effects of GW501516 and PGE2 on cell proliferation. H157 cells (0.5 x 105) were cultured with GW501516 (1 µM) or dmPGE2 (10 µg/ml), followed by incubation with 1 µCi/ml [methyl-3H]thymidine for 24 h to examine cell proliferation. C, the role of PPAR{beta}/{delta} and EP4 in mediating the effect of PGE2 on NSCLC cell growth. H157 cells (0.5 x 104/well in 6-well dish) were transfected with control or PPAR{beta}/{delta} antisense oligonucleotides, with Akt siRNA or control (Con) siRNA (100 nM each) for 30 h before exposing the cells to dmPGE2 (10 µg/ml) and incubated with 1 µCi/ml [methyl-3H]thymidine for an additional 24 h to examine cell proliferation. *, significant difference from control. **, significance of combination treatment as compared with GW501516 or dmPGE2 alone.

 
EP4 has been shown to be regulated at the level of gene transcription in different cell types (19, 33, 34). To investigate whether up-regulation of EP4 by PPAR{beta}/{delta} activation reflects transactivation of the EP4 gene, we performed transient transcription experiments utilizing mouse EP4 promoter-reporter constructs connected to a luciferase reporter gene. We found that GW501516 increased and ciglitazone decreased EP4 promoter activities. In contrast, WY14643, a PPAR{alpha} ligand, had no effect. Furthermore, the region between –1555 to –992 was demonstrated to play a major role in the induction of EP4 in our system. Several transcription factor-binding sites within this region in the EP4 promoter have been characterized, including the regulatory elements for AP-2, C/EBP, Sp1, and others (16–18). We therefore evaluated the possibility that these sites might play a role in EP4 expression in response to the PPAR{beta}/{delta} agonist. We found that GW501516 significantly increased the binding activity of C/EBP to the NF-IL6 site in the EP4 promoter. This, together with the supershift results, indicates that C/EBP{beta} is involved in the up-regulation of the EP4 gene induced by the PPAR{beta}/{delta} agonist. Consistent with this, we demonstrated that mutations of the NF-IL6 (C/EBP) site resulted in a loss of the response to GW501516. This indicated that the NF-IL6 (C/EBP) site played a key role in mediating the effect of GW501516 in inducing EP4 transcription activity. Of note, a role for the C/EBP site in regulation of EP4 expression has never been reported. The C/EBP family of bZIP transcription factors controls the proliferation and differentiation of cells in a variety of tissues (35–37). C/EBP{beta} can be activated or inactivated by phosphorylation through pathways stimulated by oncogenic Ras in fibroblasts, erythroblasts, and P19 embryonic carcinoma cells (38, 39), suggesting a role for C/EBP{beta} as a nuclear regulator of Ras signaling. C/EBP{beta} has a critical role in Ras-mediated tumorigenesis and cell survival and has been proposed as a target for tumor inhibition (40). Other reports demonstrate that C/EBP{beta} is essential for oncogenic transformation of macrophages and functions, at least in part, by regulating the expression of the survival factor insulin-like growth factor I (41). Our findings demonstrated that this transcription factor interacts with NF-IL6 (C/EBP) sites in EP4 promoter and mediates the effect of GW501516 on EP4 protein expression. We also showed that blocking the activation of PPAR{beta}/{delta} abrogated the effect of GW501516 in C/EBP{beta} protein expression, further confirming that PPAR{beta}/{delta}-dependent signals mediate the effect of GW501516 in this study. The PI3-K/Akt blockers also prevented C/EBP binding activity induced by GW501516. The connection between the C/EBP and PI3-K signal has been reported in other studies as well (42, 43). PI3K/Akt/GSK-3 mediates signaling between growth hormone receptors and the nucleus, promoting dephosphorylation of C/EBP{beta} (43).

Finally, we found that GW501516 and exogenous PGE2 exerted a synergistic effect on EP4 expression; this was associated with more efficient cell growth. PGE2 has been shown to indirectly transactivate PPAR{beta}/{delta} through PI3K/Akt signaling, which promotes cell survival and intestinal adenoma formation (25). PGE2 has pro-oncogenic activity that resulted in inhibition of apoptosis and increased intestinal polyp growth (25). High levels of expression of functional EP4 receptors reported in breast cancer cells were associated with a dose-dependent increase of intracellular cAMP synthesis in response to PGE2, suggesting an autocrine regulation of EP4 by PGE2 (44). Receptor cross-talk between PPAR{beta}/{delta} and EP4 may promote lung carcinoma cell growth. Given that PPAR{beta}/{delta} antisense and EP4 siRNA blocked the stimulatory effect of PGE2 on cell growth, our results suggest that PGE2 stimulates NSCLC cell growth via both its receptor EP4 and PPAR{beta}/{delta} signal pathways.

In summary, our results demonstrate that PPAR{beta}/{delta} activation stimulates human lung carcinoma cell proliferation through induction of PGE receptor subtype EP4 gene expression. The control of EP4 gene expression by a PPAR{beta}/{delta} agonist was associated with activation of PI3-K/Akt signaling pathways and involved DNA binding by the transcription factor C/EBP in the EP4 promoter region (–1555 to –992 bp). This represents a novel molecular mechanism mediating the role of PPAR{beta}/{delta} activation in regulation of human lung carcinoma cell growth. Further studies using PPAR{beta}/{delta} knock-out animals will be required to assign these effects to PPAR{beta}/{delta} activation in vivo conclusively.


   FOOTNOTES
 
* This work was supported by American Cancer Society Institutional Research Grant 6-47083 (to S. W. H.), American Lung Association Bioresearch Grant RG-10215-N (to S. W. H.), and a Merit Review Grant from the Department of Veterans Affairs (to J. R.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Division of Pulmonary, Allergy and Critical Care Medicine, Emory University School of Medicine, Whitehead Bioresearch Bldg., 615 Michael St., Suite 205-M, Atlanta, GA, 30322. Tel.: 404-712-2661; Fax: 404-712-2151; E-mail: shan2{at}emory.edu.

2 The abbreviations used are: PGE2, prostaglandin E2; dmPGE2, dimethyl-PGE2; PI3-K, phosphatidylinositol 3-kinase; NSCLC, non-small cell lung carcinoma; siRNA, short interfering RNA; C/EBP, CCAAT/enhancer-binding protein; PPAR, peroxisome proliferator-activated receptor; AP-2, activator protein-2; RT, reverse transcriptase; PKC, protein kinase C; Erk, extracellular signal-regulated kinase; MEK, mitogen-activated protein kinase kinase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. Back


   ACKNOWLEDGMENTS
 
We are grateful to Dr. Shi-Yong Sun for providing the H157 NSCLC cells and Dr. William L. Smith for providing the EP4 plasmid constructs.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Stabile, L. P., and Siegfried, J. M. (2003) J. Gend. Specif. Med. 6, 37–48[Medline] [Order article via Infotrieve]
  2. Pass, H. I., Mitchell, J. B., Johnson, D. H., Turrisi, A. T., and Minna, J. D. (2000) in Lung Cancer: Etiology and Epidemiology of Lung Cancer (Schottenfeld, D., ed) pp. 367–388, Williams & Wilkins, Philadelphia, PA
  3. Han, S. W., Sidell, N., Roser-Page, S., and Roman, J. (2004) Int. J. Cancer 111, 322–331[CrossRef][Medline] [Order article via Infotrieve]
  4. Lanchon, P., Veber, N., Magnien, V., Israel, L., and Starzec, A. B. (1995) Mol. Cell Endocrinol. 111, 219–223[CrossRef][Medline] [Order article via Infotrieve]
  5. Coleman, R. A., Smith, W. L., and Narumiya, S. (1994) Pharmacol. Rev. 46, 205–229[Medline] [Order article via Infotrieve]
  6. Mutoh, M., Watanabe, K., Kitamura, T., Shoji, Y., Takahashi, M., Kawamori, T., Tani, K., Kobayashi, M., Maruyama, T., Kobayashi, K., Ohuchida, S., Sugimoto, Y., Narumiya, S., Sugimura, T., and Wakabayashi, K. (2002) Cancer Res. 62, 28–32[Abstract/Free Full Text]
  7. Asano, T., Shoda, J., Ueda, T., Kawamoto, T., Todoroki, T., Shimonishi, M., Tanabe, T., Sugimoto, Y., Ichikawa, A., Mutoh, M., Tanaka, N., and Miwa M. (2002) Clin. Cancer Res. 8, 1157–1167[Abstract/Free Full Text]
  8. Pozzi, A., Yan, X., Macias-Perez, I., Wei, S., Hata, A. N., Breyer, R. M., Morrow, J. D., and Capdevila, J. H. (2004) J. Biol. Chem. 279, 29797–29804[Abstract/Free Full Text]
  9. Hull, M. A., Ko, S. C., and Hawcroft, G. (2004) Mol. Cancer Ther. 3, 1031–1039[Abstract/Free Full Text]
  10. Dohadwala, M., Batra, R. K., Luo, J., Lin, Y., Krysan, K., Pold, M., Sharma, S., and Dubinett, S. M. (2002) J. Biol. Chem. 277, 50828–50833[Abstract/Free Full Text]
  11. Smith, S. A., Monteith, G. R., Robinson, J. A., Venkata, N. G., May, F. J., and Roberts-Thomson, S. J. (2004) J. Neurosci. Res. 77, 240–249[CrossRef][Medline] [Order article via Infotrieve]
  12. Peters, J. M., Lee, S. S., Li, W., Ward, J. M., Gavrilova, O., Everett, C., Reitman, M. L., Hudson, L. D., and Gonzalez, F. J. (2000) Mol. Cell Biol. 20, 5119–5128[Abstract/Free Full Text]
  13. Gupta, R. A., Wang, D., Katkuri, S., Wang, H., Dey, S. K., and DuBois, R. N. (2004) Nat. Med. 10, 245–247[CrossRef][Medline] [Order article via Infotrieve]
  14. Han, S., and Roman, J. (2004) Biochem. Biophys. Res. Commun. 314, 1093–1099[CrossRef][Medline] [Order article via Infotrieve]
  15. Miyashita, T., Kawakami, A., Tamai, M., Izumi, Y., Mingguo, H., Tanaka, F., Abiru, S., Nakashima, K., Iwanaga, N., Aratake, K., Kamachi, M., Arima, K., Ida, H., Migita, K., Origuchi, T., Tagashira, S., Nishikaku, F., and Eguchi, K. l. (2003). Biochem. Biophys. Res. Commun. 312, 397–404[CrossRef][Medline] [Order article via Infotrieve]
  16. Chien, E. K., and Macgregor, C. (2003) Am. J. Obstet. Gynecol. 189, 1501–1510[CrossRef][Medline] [Order article via Infotrieve]
  17. Arakawa, T, Laneuville, O., Miller, C. A., Lakkides, K. M., Wingerd, B. A., DeWitt, D. L., and Smith, W. L. (1996) J. Biol. Chem. 271, 29569–29575[Abstract/Free Full Text]
  18. Foord, S. M., Marks, B., Stolz, M., Bufflier, E., Fraser, N. J., and Lee, M. G. (1996) Genomics 35, 182–188[CrossRef][Medline] [Order article via Infotrieve]
  19. Han, S., Sidell, N., Fisher, P. B., and Roman, J. (2004) Clin. Cancer Res. 10, 1911–1919[Abstract/Free Full Text]
  20. Keshamouni, V. G., Reddy, R. C., Arenberg, D. A., Joel, B., Thannickal, V. J., Kalemkerian, G. P., and Standiford, T. J. (2004) Oncogene 23, 100–108[CrossRef][Medline] [Order article via Infotrieve]
  21. Suenaga, A., Fujii, T., Ogawa, H., Maruyama, T., Ohuchida, S., Katsube, N., Obata, T., and Kawashima, K. (2004) Vascul. Pharmacol. 41, 51–58[CrossRef][Medline] [Order article via Infotrieve]
  22. Gupta, R. A., Tan, J., Krause, W. F., Geraci, M. W., Willson, T. M., Dey, S. K., and DuBois, R. N. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 13275–13280[Abstract/Free Full Text]
  23. Glinghammar, B., Skogsberg, J., Hamsten, A., and Ehrenborg, E. (2003) Biochem. Biophys. Res. Commun. 308, 361–368[CrossRef][Medline] [Order article via Infotrieve]
  24. Oliver, W. R. Jr., Shenk. J. L., Snaith, M. R., Russell, C. S., Plunket, K. D., Bodkin, N. L., Lewis, M. C., Winegar, D. A., Sznaidman, M. L., Lambert, M. H., Xu, H. E., Sternbach, D. D., Kliewer, S. A., Hansen, B. C., and Willson, T. M. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 5306–5311[Abstract/Free Full Text]
  25. Wang, D., Wang, H., Shi, Q., Katkuri, S., Walhi, W., Desvergne, B., Das, S. K., Dey, S. K., and DuBois, R. N. (2004) Cancer Cell 6, 285–295[CrossRef][Medline] [Order article via Infotrieve]
  26. Mitsiades, C. S., Mitsiades, N., and Koutsilieris, M. (2004) Curr. Cancer Drug Targets 4, 235–256[CrossRef][Medline] [Order article via Infotrieve]
  27. Di-Poi, N., Tan, N. S., Michalik, L., Wahli, W., and Desvergne, B. (2002) Mol. Cell 10, 721–733[CrossRef][Medline] [Order article via Infotrieve]
  28. Sansal, I., and Sellers, W. R. (2004) J. Clin. Oncol. 22, 2954–2963[Abstract/Free Full Text]
  29. Bepler, G., Sharma, S., Cantor, A., Gautam, A., Haura, E., Simon, G., Sharma, A., Sommers, E., and Robinson, L. (2004) J. Clin. Oncol. 22, 1878–1885[Abstract/Free Full Text]
  30. Patel, L., Pass, I., Coxon, P., Downes, C. P., Smith, S. A., and Macphee, C. H. (2001) Curr. Biol. 11, 764–768[CrossRef][Medline] [Order article via Infotrieve]
  31. Shao, J., Sheng, H., and DuBois, R. N. (2002) Cancer Res. 62, 3282–3288[Abstract/Free Full Text]
  32. Chu, K. M., Chow, K. B., Wong, Y. H., and Wise, H. (2004) Cell Signal. 16, 477–486[CrossRef][Medline] [Order article via Infotrieve]
  33. Southall, M. D., and Vasko, M. R. (2001) J. Biol. Chem. 276, 16083–16091[Abstract/Free Full Text]
  34. Tsuboi, H., Sugimoto, Y., Kainoh, T., and Ichikawa, A. (2004) Biochem. Biophys. Res. Commun. 322, 1066–1072[CrossRef][Medline] [Order article via Infotrieve]
  35. Grimm, S. L., and Rosen, J. M. (2003) J. Mammary Gland Biol. Neoplasia 8, 191–204[CrossRef][Medline] [Order article via Infotrieve]
  36. Hu, B., Wu, Z., Jin, H., Hashimoto, N., Liu, T., and Phan, S. H. (2004) J. Immunol. 173, 4661–4668[Abstract/Free Full Text]
  37. Park, B. H., Qiang, L., and Farmer, S. R. (2004) Mol. Cell Biol. 24, 8671–8680[Abstract/Free Full Text]
  38. Nakajima, T., Kinoshita, S., Sasagawa, T., Sasaki, K., Naruto, M., Kishimoto, T., and Akira, S. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 2207–2211[Abstract/Free Full Text]
  39. Kowenz-Leutz, E., Twamley, G., Ansieau, S., and Leutz, A. (1994) Genes Dev. 8, 2781–2791[Abstract/Free Full Text]
  40. Zhu, S., Yoon, K., Sterneck, E., Johnson, P. F., and Smart, R. C. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 207–212[Abstract/Free Full Text]
  41. Wessells, J., Yakar, S., and Johnson, P. F. (2004) Mol. Cell Biol. 24, 3238–3250[Abstract/Free Full Text]
  42. Guo, S., Cichy, S. B., He, X., Yang, Q., Ragland, M., Ghosh, A. K., Johnson, P. F., and Unterman, T. G. (2001) J. Biol. Chem. 276, 8516–8523[Abstract/Free Full Text]
  43. Piwien-Pilipuk, G., Van Mater, D., Ross, S. E., MacDougald, O. A., and Schwartz, J. (2001) J. Biol. Chem. 276, 19664–19671[Abstract/Free Full Text]
  44. Timoshenko, A. V., Xu, G., Chakrabarti, S., Lala, P. K., and Chakraborty, C. (2003) Exp. Cell Res. 289, 265–274[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 JNCI J Natl Cancer InstHome page
X. Zuo, Z. Peng, M. J. Moussalli, J. S. Morris, R. R. Broaddus, S. M. Fischer, and I. Shureiqi
Targeted Genetic Disruption of Peroxisome Proliferator-Activated Receptor-{delta} and Colonic Tumorigenesis
J Natl Cancer Inst, May 20, 2009; 101(10): 762 - 767.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
S. Han, J. D. Ritzenthaler, X. Sun, Y. Zheng, and J. Roman
Activation of Peroxisome Proliferator-Activated Receptor {beta}/{delta} Induces Lung Cancer Growth via Peroxisome Proliferator-Activated Receptor Coactivator {gamma}-1{alpha}
Am. J. Respir. Cell Mol. Biol., March 1, 2009; 40(3): 325 - 331.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
Y. Zheng, J. D. Ritzenthaler, X. Sun, J. Roman, and S. Han
Prostaglandin E2 Stimulates Human Lung Carcinoma Cell Growth through Induction of Integrin-Linked Kinase: The Involvement of EP4 and Sp1
Cancer Res., February 1, 2009; 69(3): 896 - 904.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
S. Han, X. Sun, J. D. Ritzenthaler, and J. Roman
Fish Oil Inhibits Human Lung Carcinoma Cell Growth by Suppressing Integrin-Linked Kinase
Mol. Cancer Res., January 1, 2009; 7(1): 108 - 117.
[Abstract] [Full Text] [PDF]

Home page
 Molecular Cancer TherapeuticsHome page
X. Sun, J. D. Ritzenthaler, Y. Zheng, J. Roman, and S. Han
Rosiglitazone inhibits {alpha}4 nicotinic acetylcholine receptor expression in human lung carcinoma cells through peroxisome proliferator-activated receptor {gamma}-independent signals
Mol. Cancer Ther., January 1, 2009; 8(1): 110 - 118.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
J.-M. Oh, S.-H. Kim, Y.-I. Lee, M. Seo, S.-Y. Kim, Y.-S. Song, W.-H. Kim, and Y.-S. Juhnn
Human papillomavirus E5 protein induces expression of the EP4 subtype of prostaglandin E2 receptor in cyclic AMP response element-dependent pathways in cervical cancer cells
Carcinogenesis, January 1, 2009; 30(1): 141 - 149.
[Abstract] [Full Text] [PDF]

Home page
 Sci SignalHome page
N. M. Heller, X. Qi, I. S. Junttila, K. A. Shirey, S. N. Vogel, W. E. Paul, and A. D. Keegan
Type I IL-4Rs Selectively Activate IRS-2 to Induce Target Gene Expression in Macrophages
Sci. Signal., December 23, 2008; 1(51): ra17 - ra17.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
T. V. Pedchenko, A. L. Gonzalez, D. Wang, R. N. DuBois, and P. P. Massion
Peroxisome Proliferator-Activated Receptor {beta}/{delta} Expression and Activation in Lung Cancer
Am. J. Respir. Cell Mol. Biol., December 1, 2008; 39(6): 689 - 696.
[Abstract] [Full Text] [PDF]

Home page
 CirculationHome page
J.-K. Han, H.-S. Lee, H.-M. Yang, J. Hur, S.-I. Jun, J.-Y. Kim, C.-H. Cho, G.-Y. Koh, J. M. Peters, K.-W. Park, et al.
Peroxisome Proliferator-Activated Receptor-{delta} Agonist Enhances Vasculogenesis by Regulating Endothelial Progenitor Cells Through Genomic and Nongenomic Activations of the Phosphatidylinositol 3-Kinase/Akt Pathway
Circulation, September 2, 2008; 118(10): 1021 - 1033.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Han, J. D. Ritzenthaler, Y. Zheng, and J. Roman
PPAR{beta}/{delta} agonist stimulates human lung carcinoma cell growth through inhibition of PTEN expression: the involvement of PI3K and NF-{kappa}B signals
Am J Physiol Lung Cell Mol Physiol, June 1, 2008; 294(6): L1238 - L1249.
[Abstract] [Full Text] [PDF]

Home page
 Stem CellsHome page
Y. H. Kim and H. J. Han
High-Glucose-Induced Prostaglandin E2 and Peroxisome Proliferator-Activated Receptor {delta} Promote Mouse Embryonic Stem Cell Proliferation
Stem Cells, March 1, 2008; 26(3): 745 - 755.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
T. Daikoku, S. Tranguch, A. Chakrabarty, D. Wang, D. Khabele, S. Orsulic, J. D. Morrow, R. N. DuBois, and S. K. Dey
Extracellular Signal-Regulated Kinase Is a Target of Cyclooxygenase-1-Peroxisome Proliferator-Activated Receptor-{delta} Signaling in Epithelial Ovarian Cancer
Cancer Res., June 1, 2007; 67(11): 5285 - 5292.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Han, J. D. Ritzenthaler, B. Wingerd, H. N. Rivera, and J. Roman
Extracellular Matrix Fibronectin Increases Prostaglandin E2 Receptor Subtype EP4 in Lung Carcinoma Cells through Multiple Signaling Pathways: THE ROLE OF AP-2
J. Biol. Chem., March 16, 2007; 282(11): 7961 - 7972.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
L. Brunelli, K. A. Cieslik, J. L. Alcorn, M. Vatta, and A. Baldini
Peroxisome Proliferator-Activated Receptor-{delta} Upregulates 14-3-3{epsilon} in Human Endothelial Cells via CCAAT/Enhancer Binding Protein-{beta}
Circ. Res., March 16, 2007; 100(5): e59 - e71.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
L. Yang, Y. Huang, R. Porta, K. Yanagisawa, A. Gonzalez, E. Segi, D. H. Johnson, S. Narumiya, and D. P. Carbone
Host and Direct Antitumor Effects and Profound Reduction in Tumor Metastasis with Selective EP4 Receptor Antagonism
Cancer Res., October 1, 2006; 66(19): 9665 - 9672.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/39/33240    most recent
M507617200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Han, S.
Right arrow Articles by Roman, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Han, S.
Right arrow Articles by Roman, J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement