Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M501701200 on August 3, 2005

J. Biol. Chem., Vol. 280, Issue 39, 33669-33678, September 30, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/39/33669    most recent
M501701200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Meiling-Wesse, K.
Right arrow Articles by Thumm, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Meiling-Wesse, K.
Right arrow Articles by Thumm, M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Trs85 (Gsg1), a Component of the TRAPP Complexes, Is Required for the Organization of the Preautophagosomal Structure during Selective Autophagy via the Cvt Pathway*

Khuyen Meiling-Wesse{ddagger}, Ulrike D. Epple{ddagger}, Roswitha Krick{ddagger}, Henning Barth{ddagger}, Anika Appelles{ddagger}, Christiane Voss{ddagger}, Eeva-Liisa Eskelinen§, and Michael Thumm{ddagger}1

From the {ddagger}Center of Biochemistry and Molecular Cell Biology, Georg-August-University, Heinrich-Dueker-Weg 12, D-37073 Goettingen, Germany and §Institute of Biochemistry, University of Kiel, Otto Hahn Platz 9, D-24118 Kiel, Germany

Received for publication, February 14, 2005 , and in revised form, July 11, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Autophagosomes and Cvt vesicles are limited by two membrane layers. The biogenesis of these unconventional vesicles and the origin of their membranes are hardly understood. Here we identify in Saccharomyces cerevisiae Trs85, a nonessential component of the TRAPP complexes, to be required for the biogenesis of Cvt vesicles. The TRAPP complexes function in endoplasmic reticulum-to-Golgi and Golgi trafficking. Growing trs85{Delta} cells show a defect in the organization of the preautophagosomal structure. Although proaminopeptidase I is normally recruited to the preautophagosomal structure, the recruitment of green fluorescent protein-Atg8 depends on Trs85. Autophagy proceeds in the absence of Trs85, albeit at a reduced rate. Our electron microscopic analysis demonstrated that the reduced autophagic rate of trs85{Delta} cells does not result from a reduced size of the autophagosomes. Growing and starved cells lacking Trs85 did not show defects in vacuolar biogenesis; mature vacuolar proteinase B and carboxypeptidase Y were present. Also vacuolar acidification was normal in these cells. It is known that mutations impairing the integrity of the ER or Golgi block both autophagy and the Cvt pathway. But the phenotypes of trs85{Delta} cells show striking differences to those seen in mutants with defects in the early secretory pathway. This suggests that Trs85 might play a direct role in the Cvt pathway and autophagy.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Starvation-induced autophagy is an unselective, degradative pathway that delivers cytosolic material to the lysosome (vacuole) (1-3). It is well conserved between eukaryotes such as fungi, plants, and mammals. During the last decade work initially using the model eukaryote Saccharomyces cerevisiae led to the identification of a set of more than 20 ATG genes essential for the autophagic process (4-7). Studies on the mammalian counterparts of the yeast ATG genes uncovered the importance of autophagy in the development of severe diseases such as cancer, cardiomyopathy, Huntington and Parkinson disease (8). Autophagy also plays an important role in the removal of intracellular pathogens (9), and increasing evidence points to a relationship between autophagy and aging (10, 11).

Autophagy starts at the preautophagosomal structure (PAS),2 a perivacuolar organelle where numerous Atg proteins colocalize (12, 13). Out of the PAS double membrane-layered transport vesicles, the autophagosomes are formed (14, 15). The outer membrane of the autophagosome then fuses with the vacuolar membrane, and the inner part of the vesicle is released as a still membrane-limited autophagic body into the vacuole. Within the vacuole the autophagic bodies are lysed dependent on the putative lipase Atg15 (16), and the cytosolic material is degraded by the various vacuolar hydrolases.

The use of transport vesicles limited by two membrane layers distinguishes autophagy from other transport pathways. Consistently, the molecular mechanisms used for the biogenesis of these vesicles are also unconventional. For example, the homotypic membrane fusion event during the sealing of autophagosomes does not involve the action of the yeast NSF Sec18; also, none of the yeast t-SNAREs has been localized to the PAS (17, 18).

In S. cerevisiae the Cvt (cytoplasm to vacuole targeting) pathway was discovered as a variant of the starvation-induced unselective autophagy. In contrast to the degradative autophagic pathway, the constitutive Cvt pathway acts under nutrient-rich conditions as a biosynthetic route selectively delivering specific cargo proteins such as proaminopeptidase I to the vacuole. The Cvt pathway and autophagy share most of their molecular components, albeit the function of some Atg proteins is restricted to one of the pathways. The most striking difference between autophagy and the Cvt pathway is the size of their transport intermediates. Cvt vesicles are smaller than autophagosomes and do not enclose cytosolic material.

Pexophagy, the selective autophagic degradation of dispensable peroxisomes, is another variant of autophagy. It takes place when yeast cells are shifted from a medium inducing the proliferation of peroxisomes to a medium containing glucose (19).

Biogenesis of Cvt vesicles and autophagosomes requires the sorting of large amounts of membranes to the PAS. The origin of these membranes remains elusive, but recent work demonstrated that a functional ER and Golgi is essential for both the biogenesis of Cvt vesicles and autophagosomes (17), (18). Accordingly, mutations affecting the early secretory pathway block both autophagy and the Cvt pathway.

Here, we identify Trs85 as an essential component for the biogenesis of Cvt vesicles. Trs85 is a subunit of the TRAPP complexes, which act in ER-to Golgi and Golgi trafficking (20). One might, therefore, expect that defects at the ER or Golgi in trs85{Delta} cells might be responsible for the autophagic defects. Our experiments, however, point to differences in the phenotypes between trs85{Delta} cells and cells with defects in the early secretory pathway. First of all, in contrast to components of the early secretory pathway, Trs85 is not needed for the viability of yeast cells. Furthermore, our experiments did not show defects in vacuolar biogenesis in trs85{Delta} cells. Early secretory mutants are blocked in autophagy, and they fail to recruit proaminopeptidase I to their PAS (17). Here we show that autophagy proceeds in trs85{Delta} cells with half of the wild-type rate. Furthermore, trs85{Delta} cells can recruit proaminopeptidase I to their PAS but fail to recruit green fluorescent protein (GFP)-Atg8 in rich media. This differences support the idea that Trs85 might play a specific role during the Cvt pathway and autophagy.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Strains, Media, Antibodies, and Reagents—Standard media were used (21). Starvation medium was either SD(-N) (1.7% yeast nitrogen base without amino acids and ammonium sulfate, 2% glucose) or 1% potassium acetate as indicated. Antibodies were anti-3-phosphoglycerate kinase, anti-carboxypeptidase Y, anti-green fluorescent protein (Molecular Probes, Leiden, The Netherlands); horseradish peroxidase (HRPO)-conjugated goat anti-rabbit (Medac, Hamburg, Germany) and HRPO-conjugated goat anti-mouse (Dianova, Hamburg, Germany); anti-proaminopeptidase I (22) and anti-Atg8 (23). Fox3 antibodies were supplied by R. Erdmann, Bochum, Germany.

Chemicals—PMSF was from Sigma, oligonucleotides were from MWG-Biotech, Ebersberg, Germany and Operon, Germany; other analytical grade chemicals were from Sigma or Merck. For immunoblots the ECL detection kit (Amersham Biosciences) was used. Strains used are listed in TABLE ONE.


View this table:
[in this window]
[in a new window]
  		TABLE ONE
Strains used

 
GSG1/TRS85 Chromosomal Deletion—A PCR fragment with the kanamycin resistance gene flanked with TRS85 sequences was generated from a-GSG1, 5'-CTTTATTCAGTCGGCTTTACAGATACTGAGGTAACTTATAcagctgaagcttcgtacgc-3', and as-GSG1, 5'-TACGTATAATTTATACTCAAAACATGAATTTTCCATAAAGgcataggccactagtggatctg-3', and the plasmid pUG6 carrying the kanamycin resistance marker (24). Chromosomal replacement of TRS85 with this fragment in WCG4a yielded YKMW1 and in SEY6211 the strain YKMW28. Deletions were confirmed with Southern blot analysis (not shown).

YPT7 Chromosomal Deletion—YPT7 deletion strains were constructed using the plasmid pBSKS+ ypt7::HIS3 (D. Gallwitz, Goettingen), which was digested with XhoI and PacI and transformed into YKMW1 yielding YKMW18 (gsg1{Delta}::KAN ypt7{Delta}::HIS3). The chromosomal replacement of the YPT7 gene was confirmed by Southern blotting (not shown).

PHO8 Chromosomal Deletion—The PHO8 gene in the following strains was replaced with the LEU2 gene using the deletion plasmid pGF10 (pho8{Delta}::LEU2) (25). In YKMW1 (trs85{Delta}) the deletion yielded YKMW21 (trs85{Delta}::KAN pho8{Delta}::LEU2).

Plasmids—Plasmid pJH1 (pRS313-API-RFP) was generated by homologue recombination in yeast. A PCR fragment containing mRFP was amplified using primers API-RFP up (GGAGATCAGTCTACGATGAATTCGGCGAGTTGTCCCGGGTAgcctcctccgaggacgtcatc), RFP-Vector down (TCGACGGTATCGATAAGCTTGATATCGAATTCTAGAGTCGCttaggcgccggtggagtggcg), and pmRFP-KanMX (26) as template. pKMW13 was cut with AgeI/NotI, and the resulting 6.8-kilobase fragment was cotransformed with the mRFP-containing PCR fragment in the yeast strain Y36953 (Euroscarf). The recombinant plasmid was rescued from transformants able to grow on SC medium lacking histidine, and the correct recombination was confirmed.

For pKMW13 (Ape1-YFP), the eYFP fluorescent protein was excised from pEYFP (BD Clontech) with XmaI and EcoRI and inserted into the pRS313 vector at the same sites. This vector (pKMW1) was cut with KspI and XmaI and combined with the PCR fragment containing APE1 with its native promoter and the added KspI and XmaI incision sites, yielding the plasmid pKMW13. The PCR fragment was constructed with the primer KSPI-APEI (AGGGCCGCGGCTACTTTAGGGTATAGGTTG) and XMAI-APEI (AGGGCCCGGGACAACTCGCCGAATTCATCG) and the plasmid pRN1 (27). The following plasmids were described elsewhere: pGFP-Atg8 (12), pMet25::GFP-Atg9 (28), and pGFP-Atg19 (29). Cell lysis, SDS-PAGE, and immunoblotting was done as described previously (16).



View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 1.
Trs85 is essential for the Cvt pathway. A, when grown to the logarithmic (log) or stationary (stat) growth phase trs85{Delta} cells are impaired in maturation of proaminopeptidase I. Starvation for the indicated times in 1% potassium acetate (KAc) rescued this defect. Cells were harvested and processed for immunoblotting with antibodies to proaminopeptidase I. As a control, wild-type cells (WCG) and cells defective in autophagy (atg1{Delta}) and lacking vacuolar proteinase A (pep4{Delta}) or proaminopeptidase I (ape1{Delta}) are included. pApe1, proaminopeptidase I; mApe1, mature aminopeptidase I. B, stationary grown trs85{Delta} cells fail to transport a fusion protein of proaminopeptidase I with the monomeric "red fluorescent protein" (proApe1-RFP) to the vacuole. Cells expressing proApe1-RFP from a centromeric plasmid were visualized with a Zeiss Axioscope 2 fluorescence microscope. Nomarski optics (upper row) and fluorescence (lower row) are shown. Bar, 10 µm. atg19{Delta} cells are defective in vacuolar targeting of proaminopeptidase I via the Cvt pathway (29, 32). Proaminopeptidase I forms a large cytosolic complex (the Cvt complex) before vacuolar uptake; therefore, fluorescent puncta are visible in the cytosol. In wild-type cells aminopeptidase I is dispersed within the vacuole. C, trs33{Delta} and trs65{Delta} cells mature proaminopeptidase I. Cells grown to the stationary growth phase or starved for 4 h in nitrogen-free SD(-N) medium were analyzed in immunoblots with antibodies to proaminopeptidase I. WT, wild type.

 
Alkaline Phosphatase Assay—The pho8{Delta}::LEU2 deletion strains were transformed with the Pho8{Delta}60 expression plasmid pCC5 (30). Enzymatic activity was measured as described (31) with the following modifications. Logarithmically grown cells were washed with water and resuspended in SD(-N) medium. One A600 unit of cells was harvested at each time point and washed once with water. The cells were then suspended in 0.2 ml of assay buffer (250 mM Tris/HCl, pH 9.0, 10 mM MgSO4, 10 µM ZnSO4) and disrupted by vortexing with glass beads. After centrifugation, 50 µl of the supernatant was added to 0.5 ml of assay buffer and 50 µl of 55 mM potassium naphthyl phosphate. After incubation for 15 min at 30 °C, 0.5 ml of 2 M glycine/NaOH, pH 11.0, was added to stop the reaction. Fluorescence intensity was measured with excitation at 345 nm and emission at 472 nm. Protein concentration was determined with the BCA method (Pierce).

Measurement of Pexophagy—Following the protocol of Hutchins et al. (19), logarithmically growing cells were shifted to synthetic glycerol medium (0.67% yeast nitrogen base without amino acids, 50 mM Mes, 50 mM Mops, 3% glycerol, 0.1% glucose, pH 5.5) for 12 h at 30 °C. Then a 10x yeast extract/peptone solution was added to a final concentration of 1% yeast extract and 2% peptone, and the cells were incubated for 4 h. The cells were then washed and transferred to YTO (0.67% yeast nitrogen base without amino acids, 0.1% Tween 40, 0.1% oleic acid) for 19 h for peroxisome induction. To induce peroxisome degradation cells were shifted to SD(-N). Aliquots were taken at the indicated times and prepared for immunoblot analysis using antibodies against Fox3p (R. Erdmann, Bochum, Germany).

Probing Vacuolar Acidification—Cells were resuspended in 1 ml of quinacrine buffer (10 mM HEPES, 2% glucose, pH 7.4). 1 µl of 1 mM quinacrine stock was added, and the mixture was incubated for 10 min at room temperature. The cells were washed twice with buffer and observed with a Zeiss Axioscope2 microscope equipped with an Axiocam digital camera.

Protease Protection Assay—The protease protection experiment was done according to Scott et al. (32) with the following modifications. Forty A600 units of early stationary or starved cells were harvested, washed twice with water, and incubated for 20 min in 4 ml of buffer A (100 mM Tris/H2SO4, pH 9.4) containing 20 mM dithiothreitol. The cells were then pelleted, resuspended in 4 ml of oxalyticase buffer (1 M sorbitol, 50 mM NaH2PO4, pH 7.4) containing 50 µg/ml oxalyticase, and spheroplasted for 30 min at 30 °C. The spheroplasts were harvested and hypotonically lysed in PS200 (200 mM sorbitol, 20 mM PIPES, 5 mM MgCl2, pH 6.8). The lysis solution was repeatedly precleared at 500 x g and 4 °C, and the supernatant was divided into three 300-µl aliquots. The aliquots were mixed with 300 µl of PS200, PS200 with 100 µg/ml proteinase K, and PS200 with 100 µg/ml proteinase K and 0.4% Triton X-100. After 15 min on ice, the digestion was halted through trichloroacetic acid precipitation. The pellets were dissolved in 100 µl of Laemmli buffer.

GFP-Atg8 Degradation—Early logarithmically grown cells expressing GFP-Atg8 from a centromeric plasmid (12) were harvested, washed twice with water, and resuspended in SD(-N) medium. Samples were harvested hourly for 4 h and processed for immunoblotting.

Accumulation of Autophagic Bodies—Cells grown to the stationary phase were washed twice with water and then shifted to SD(-N) with and without 10 mM phenylmethylsulfonyl fluoride. Photos were taken using Nomarski optics and a Zeiss Axioscope2 microscope.



View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 2.
The autophagic rate is reduced in trs85{Delta} cells. A, lower row. Starvation for 4 h in nitrogen-free SD(-N) medium in the presence of the proteinase B inhibitor PMSF leads to the accumulation of autophagic bodies in the vacuole. This opens an easy way to monitor autophagy under the light microscope. Autophagic bodies were detectable in the vacuoles of trs85{Delta} cells under these conditions. Compared with wild-type cells, the number of autophagic bodies seemed to be reduced. Autophagy-deficient atg3{Delta} cells are included. Upper row, starvation of the cells in the absence of PMSF did not lead to accumulation of autophagic bodies in the vacuole of trs85{Delta} cells, confirming their ability to break down autophagic bodies. B, during autophagy GFP-Atg8 is selectively enclosed in autophagosomes and targeted to the vacuole. Its vacuolar break-down releases a rather proteolysis-resistant GFP. The amount of GFP generated during starvation, therefore, allows the estimation of the autophagic rate. Cells expressing GFP-Atg8 from a centromeric plasmid (pGFP-Atg8) were starved in SD(-N) medium, and aliquots were taken at the indicated times. Immunoblots probed with antibodies to GFP are shown. Compared with wild-type cells (WCG) the amount of GFP generated during autophagy is significantly reduced in trs85{Delta} cells. atg18{Delta} cells are defective in autophagy. As a loading control the immunoblot was reprobed with antibodies against cytosolic 3-phosphoglycerate kinase (PGK). C, autophagy can be quantitatively measured using a truncated alkaline phosphatase Pho8{Delta}60. Because of the lack of its membrane domain, the protein stays in the cytosol and is targeted via autophagy to the vacuole, where it is proteolytically matured to an enzymatically active phosphatase. Cells chromosomally deleted for their endogenous PHO8 gene were transformed with a Pho8{Delta}60 expression plasmid (see "Experimental Procedures"). After shifting to SD(-N) starvation medium, aliquots were taken, and their phosphatase activity was measured. The enzymatic activity of the wild-type (wt) cells after 4 h of starvation was set to 100%. mon1{Delta} and ccz1{Delta} cells are defective in autophagy.

 
Electron Microscopy—For electron microscopy the cells were fixed with permanganate and Epon embedded as described previously (16). A Zeiss EM 900 transmission electron microscope was used to take photographs at 12,000x magnification. The area of autophagosome profiles was determined by point counting from these photographs.

Cell Fractionation—Eighty A600 units of late stationary cells were harvested, washed once with water, and incubated at 30 °C for 15 min in buffer A (100 mM Tris/H2SO4, pH 9.4) containing 20 mM dithiothreitol. Cells were resuspended in oxalyticase buffer containing 50 µg/ml oxalyticase, spheroplasted at 30 °C for 30 min, and then hypotonically lysed in ice-cold PS200 buffer (200 mM sorbitol 20 mM potassium-PIPES, pH 6.8, with 5 mM MgCl2) containing 1 mg/ml leupeptin, 1 mg/ml chymo-statin, 1 mg/ml antipain, 1 mg/ml pepstatin, 1 mM phenylmethylsulfonyl fluoride, and Complete® protease inhibitor mix (Roche Diagnostics). Cell debris was removed by centrifugation at 1000 x g, and the supernatant was transferred to a fresh tube three times. 300 µl of supernatant was taken for total, and the proteins were precipitated with trichloroacetic acid on ice. 700 µl was transferred to a fresh tube and centrifuged for 20 min at 4 °C and 10,000 x g. 300 µl of supernatant was kept as S13, and 400 µl of the supernatant was centrifuged for 1 h at 4°C and 100,000 x g. The pellet fraction (P13) was resuspended in Laemmli buffer with 1% {beta}-mercaptoethanol. After high speed centrifugation, 300 µl of supernatant (S100) was precipitated with trichloroacetic acid, and the pellet (P100) was resuspended in Laemmli buffer with 1% {beta}-mercaptoethanol. The trichloroacetic acid-precipitated proteins were centrifuged and resuspended in Laemmli buffer with 1% {beta}-mercaptoethanol.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Growing trs85{Delta} (gsg1{Delta}) Cells Are Defective in the Cvt Pathway—In the yeast deletion project each nonessential yeast gene has been chromosomally deleted, resulting in a collection of ~5000 yeast deletion strains. To identify novel components of the autophagic machinery, we screened this strain collection for mutants sensitive to nitrogen limitation, a phenotype common to autophagy mutants. Starvation-sensitive mutants can easily be scored by incubating colonies for some days on Phloxin plates lacking a nitrogen source (5, 33). Phloxin is a red dye that stains dead cells but is unable to enter living cells. Because on these plates colonies of starvation-sensitive mutants contain more dead cells, they appear dark red. This initial screen identified more than 1300 strains, which were further analyzed in Western blots for their ability to mature proaminopeptidase I. Here we report the identification of trs85{Delta} (gsg1{Delta}) in this screen. Trs85 is an 85-kDa component of both the TRAPP I and TRAPP II complex (20, 34). The TRAPP complexes function in ER-to-Golgi and Golgi transport (20). Diploid cells lacking Trs85 fail to sporulate; based on this phenotype TRS85 has also been termed GSG1 (general sporulation gene 1) (35).



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 3.
The selective pexophagic degradation of peroxisomes is retarded in trs85{Delta} cells. Cells were grown in medium containing oleic acid to proliferate peroxisomes. Pexophagy was then induced by shifting the cells to SD(-N) medium. At the indicated time points aliquots were taken and analyzed in immunoblots with antibodies to the peroxisomal marker protein Fox3 (A) using a Fuji LAS3000 imaging system with the AIDA program package. Quantification is shown in B. As a control autophagy deficient atg1{Delta} cells were included. WCG, wild-type cells.

 
For further analysis we chromosomally deleted TRS85 in our laboratory wild-type strain WCG (see "Experimental procedures"). In contrast to wild-type cells non-starved trs85{Delta} cells fail to mature proaminopeptidase I (Fig. 1A, lanes 20 and 21). Starvation induction of autophagy rescues this maturation defect (Fig. 1A, lanes 22-26). This suggests that Trs85 is required for the selective Cvt pathway but not for autophagy. To confirm that a defect in the targeting of proaminopeptidase I to the vacuole is responsible for the maturation defect, we generated a pApe1-RFP fusion protein of proaminopeptidase I with the red fluorescent protein (26). Fluorescence microscopy confirmed vacuolar targeting of this fusion protein via the Cvt pathway in non-starved wild-type cells (Fig. 1B). In non-starved trs85{Delta} cells pApe1-RFP is retained in the cytosol (Fig. 1B), demonstrating a vacuolar targeting defect. As a control we included atg19{Delta} cells, which are defective in vacuolar targeting of proaminopeptidase I.

The two TRAPP complexes consist of 10 proteins; 3 of them (Trs33, Trs65, and Trs85) are dispensable for the vitality of yeast cells (20). As shown in Fig. 1C, cells lacking Trs33 or Trs65 do not show defects in the Cvt pathway or autophagy.

Autophagy Takes Place in Starved trs85{Delta} cells but with a Reduced Rate—Maturation of proaminopeptidase I in starved trs85{Delta} cells suggests that autophagy may not be affected. To further address this question, we checked cells starved in the presence of the proteinase B inhibitor PMSF under the light microscope. PMSF is known to inhibit the intravacuolar breakdown of autophagic bodies (36), allowing their direct visualization. trs85{Delta} cells clearly showed the accumulation of autophagic bodies within their vacuoles after 2 h in nitrogen-free medium (Fig. 2A). Compared with wild-type cells the number of autophagic bodies seemed reduced. To estimate the autophagic capacity more quantitatively, we then followed the generation of GFP from the GFP-Atg8 fusion protein. During formation of autophagosomes, Atg8 as well as GFP-Atg8 is specifically enclosed in these vesicles and transported to the vacuole, where it is degraded. Because GFP is rather resistant against proteolytic attack in the vacuole, the amount of generated GFP correlates with the autophagic rate. As shown in Fig. 2B, compared with wild-type cells, generation of GFP is significantly reduced but not completely blocked in starving trs85{Delta} cells. As a control, atg18{Delta} cells, which are completely blocked in autophagy, are included. As an alternative method to quantify autophagy, we used Pho8{Delta}60, a truncated version of the vacuolar alkaline phosphatase Pho8 (31). The Pho8{Delta}60 protein does not contain a membrane domain and is, therefore, retained in the cytosol. After autophagic transport of Pho8{Delta}60 to the vacuole, the protein is proteolytically matured yielding an enzymatically active phosphatase. We chromosomally deleted PHO8 in trs85{Delta} cells and expressed Pho8{Delta}60 from a plasmid. Measurement of the phosphatase activity in lysates of cells starved for nitrogen demonstrated that the autophagic rate of trs85{Delta} cells is approximately half that of the wild-type rate (Fig. 2C).



View larger version (65K):
[in this window]
[in a new window]
  		FIGURE 4.
The reduced autophagic capacity of starving trs85{Delta} cells is not caused by defects in vacuolar biogenesis but due to reduced autophagic transport. A, mature vacuolar carboxypeptidase Y (mCPY) and mature vacuolar proteinase B (mPrB) are present in trs85{Delta} cells. Cells of the logarithmic (log) and stationary growth phase (stat) and cells starved for the indicated times in nitrogen-free 1% potassium acetate were analyzed in immunoblots with antibodies to proaminopeptidase I (pApe1). The blots were then reprobed with antisera against carboxypeptidase Y and proteinase B. As a loading control cytosolic 3-phosphoglycerate-kinase was detected. KAc, potassium acetate. WCG, wild-type cells. B, the vacuoles of trs85{Delta} cells are acidic. As described under "Experimental Procedures," cells of the stationary growth phase (left panel) or starved for 4 h in 1% potassium acetate (right) were stained with the fluorescent dye quinacrine, which only accumulates in acidic vacuoles. Bar, 10 µm. vma1{Delta} cells are defective in vacuolar acidification; therefore, quinacrine does not accumulate in their vacuoles. C, vacuolar targeting of GFP-Atg8 via autophagy is retarded in starved trs85{Delta} cells. Cells expressing GFP-Atg8 from a centromeric plasmid were starved for 4 h in nitrogen-free SD(-N) medium and visualized with a Zeiss Axioscope2 fluorescence microscope. Bar, 10 µm. In wild-type cells the selective autophagic cargo GFP-Atg8 is targeted to the vacuole, where proteolysis resistant GFP is proteolytically released (compare with Fig. 2B). GFP-Atg8 is further seen at the perivacuolar PAS. atg1{Delta} cells are defective in autophagy.

 
Pexophagy Is Significantly Retarded in trs85{Delta} Cells—We were next interested in whether Trs85 also plays a role during pexophagy, a selective variant of autophagy. Growth of S. cerevisiae cells in media containing oleic acid leads to a massive proliferation of peroxisomes. A subsequent shift of these cells to SD(-N) medium containing glucose but lacking a nitrogen source induces the selective removal of peroxisomes in an autophagic process termed pexophagy (19). As a marker protein to score peroxisomal degradation, we used the 3-ketoacyl-CoA thiolase Fox3. Autophagy deficient atg1{Delta} cells were included as a control in our analysis. As shown in Fig. 3, A and B, peroxisomal breakdown was severely affected in the absence of Trs85.

The Autophagic Defects in the Absence of Trs85 Are Not Due to Defects in Vacuolar Biogenesis—The function of the TRAPP complexes is needed for normal vacuolar biogenesis (20). One might, therefore, speculate that the observed reduced rate in autophagy and pexophagy might be caused by a lack of proteolytic capacity of the vacuole. To address this possibility we analyzed the steady state levels of vacuolar proteinase B and vacuolar carboxypeptidase Y in trs85{Delta} cells grown in rich medium and starved for nitrogen. Under both conditions significant amounts of mature proteinase B and carboxypeptidase Y were detectable (Fig. 4A); unprocessed precursor forms of the proteinases were almost completely absent. This argues against a reduced proteolytic capacity of trs85{Delta} vacuoles. Impaired vacuolar acidification has also been reported to affect breakdown of autophagic bodies inside the vacuole, thus mimicking autophagic defects (37). We confirmed vacuolar acidification of growing (Fig. 4B, left) and starved trs85{Delta} cells (Fig. 4B, right) using quinacrine staining. Quinacrine is a fluorescent dye that is known to accumulate only inside acidic vacuoles (38). vma1{Delta} cells exhibiting a defect in vacuolar acidification were included as a control. To further demonstrate that starving trs85{Delta} cells indeed show defects in the autophagic transport from the cytosol to the vacuole rather than a defect in vacuolar breakdown, we checked in fluorescence microscopy the localization of GFP-Atg8, which is specifically targeted to the vacuole via autophagy (39). As expected, wild-type cells showed a green fluorescent vacuole due to the transport of GFP-Atg8 to the vacuole and the subsequent release of proteolysis-resistant GFP (Fig. 4C; compare with Fig. 2B). In autophagy-deficient atg1{Delta} cells GFP-Atg8 and, thus, GFP is absent from the vacuolar lumen. Consistent with a reduced autophagic rate, starved trs85{Delta} cells showed no significant green fluorescence within their vacuoles (Fig. 4C), since the amounts of GFP-Atg8, which are targeted by the residual autophagic rate (compare Fig. 2B), are hard to visualize. Altogether our experiments demonstrate that the reduced autophagic rate in trs85{Delta} cells is caused by a slower autophagic transport.



View larger version (44K):
[in this window]
[in a new window]
  		FIGURE 5.
Trs85 is required for the biogenesis of Cvt vesicles. A, ypt7{Delta} cells are impaired in vacuolar fusion of Cvt vesicles and, therefore, accumulate these vesicles in their cytosol. Stationary grown cells were spheroplasted and hypotonically lysed, leaving Cvt vesicles intact. Centrifugation of the total cell lysate (T) at 13,000 x g yielded a pellet (P13) and supernatant fraction (S13). The S13 supernatant was further separated at 100,000 x g in a P100 pellet and S100 supernatant fraction. The fractions were then analyzed in immunoblots with antibodies to proaminopeptidase I (pApe1). Proaminopeptidase I-containing Cvt vesicles sedimented in the 13,000 x g pellet (lane 3). atg1{Delta} ypt7{Delta} cells are impaired in Cvt vesicle formation; consistent pApe1 is absent in the P13 pellet (lane 8). As controls the blots were reprobed with antibodies to the 100-kDa subunit of vacuolar membrane ATPase (vATPase) and cytosolic 3-phosphoglycerate kinase (PGK). B and C, proaminopeptidase I accumulates in proteinase-sensitive form in growing trs85{Delta} ypt7{Delta} (B) and trs85{Delta} (C) cells. As above, a spheroplastlysate of stationary cells was incubated with buffer (B), proteinase K (K), or proteinase K with the detergent Triton X-100 (K+T). As expected in ypt7{Delta} cells, proaminopeptidase I accumulated in membrane-protected form (lane 2). In atg3{Delta} ypt7{Delta} cells defective in biogenesis of Cvt vesicles, proaminopeptidase I was proteinase-sensitive in the absence of detergent. It should be noted that proaminopeptidase I as a resident vacuolar peptidase is not broken down by proteinase K but converted to a pseudomature form (m*Ape1). D, in trs85{Delta} cells proaminopeptidase I is recruited to the PAS. Cells expressing GFP-Atg9 (28) and pApe1-RFP from plasmids were visualized with a Zeiss Axioscope2 fluorescence microscope and an Axiocam camera. Bar, 10 µm. Nom, Nomarski optics. 90% of wild-type cells (236 cells analyzed) and 89% of trs85{Delta} cells (361 cells) showed colocalization of the integral membrane PAS protein Atg9 with proaminopeptidase I. Atg19 acts as a receptor recruiting proaminopeptidase I to the PAS; consistently in atg19{Delta} cells, only 21% of 193 cells showed colocalization. WCG, wild-type cells.

 
Trs85 Is Essential for the Formation of Proaminopeptidase I-containing Cvt Vesicles—We next wanted to determine at which step the Cvt pathway is blocked in the absence of Trs85. The Rab GTPase Ypt7 is essential for the fusion of Cvt vesicles with the vacuole (40). Cells lacking Ypt7, therefore, accumulate proaminopeptidase I-containing Cvt vesicles in the cytosol. We converted non-starved cells to spheroplasts and lysed them under mild hypoosmotic conditions, leaving the Cvt vesicles intact. After removing non-lysed cells by low speed centrifugation, we separated the total lysate (Fig. 5A, lane T) in a 13,000 x g supernatant (S13) and pellet fraction (P13). Subsequent 100,000 x g centrifugation of the 13,000 x g supernatant fraction yielded a S100 supernatant and P100 pellet fraction. Consistent with previous work, the Cvt vesicles of non-starved ypt7{Delta} cells are found in the P13 fraction (Fig. 5A, lane 3). In atg1{Delta} ypt7{Delta} cells the biogenesis of Cvt vesicles is blocked; proaminopeptidase I is, therefore, absent from the P13 pellet fraction (Fig. 5A, lane 8). The absence of proaminopeptidase I in the P13 fraction of non-starved trs85{Delta} ypt7{Delta} cells (Fig. 5A, lane 13) suggests that no proaminopeptidase I-containing Cvt vesicles are formed in these cells. The absence of cytosolic 3-phosphoglycerate kinase (PGK) in the P13 fractions (Fig. 5A, lanes 3, 8, and 13) excludes the possibility that unlysed whole cells interfere with the detection of Cvt vesicles.

To evaluate whether proaminopeptidase I accumulates in membrane-enclosed form or not, we next performed a proteinase protection experiment. In lysates of spheroplasts from non-starved ypt7{Delta} cells, proaminopeptidase I was protected against exogenously added proteinase K (Fig. 5B, lane 2). Treatment with proteinase K in the presence of the detergent Triton X-100 resulted in the conversion of proaminopeptidase I into a pseudomatured form (lane 3). This is consistent with the accumulation of proaminopeptidase I inside Cvt vesicles in ypt7{Delta} cells. In atg1{Delta} ypt7{Delta} cells, defective in the biogenesis of Cvt vesicles, proaminopeptidase I was proteinase sensitive even in the absence of detergent (Fig. 5B, lane 5). In non-starved trs85{Delta} ypt7{Delta} cells proaminopeptidase I was proteinase-accessible (Fig. 5B, lane 8). This points to an essential function of Trs85 in formation of proaminopeptidase I-containing Cvt vesicles. We further confirmed this finding using non-starved trs85{Delta} cells (Fig. 5C); as expected, proaminopeptidase I also accumulated in a proteinase-sensitive form in these cells.



View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 6.
In logarithmically growing cells Trs85 is needed for the recruitment of GFP-Atg8 to the PAS. A, the preautophagosomal structure appears in fluorescence microscopy as a perivacuolar dot, where many Atg proteins colocalize. Cells expressing either GFP-Atg8, GFP-Atg9, or GFP-Atg19 from a plasmid were grown to the logarithmic phase (filled bars) or starved 4 h in SD(-N) medium (hatched bars). The cells showing a fluorescent PAS were then counted. Growing trs85{Delta} cells failed to recruit GFP-Atg8 to the PAS (upper row). In the lower row typical microscopic images of growing cells are shown (bar, 10 µm). atg1{Delta} cells are defective in autophagy; WCG, wild-type. B, Atg8 covalently coupled to phosphatidylethanolamine (Atg8-PE) is detectable in trs85{Delta} cells. Cells of the logarithmic growth phase (log) or starved 4 h in SD(-N) were prepared for immunoblotting with antibodies to Atg8. To allow separation of Atg8 from its lipidated form, SDS gels containing 6 M urea were used. Because starvation induced Atg8 is hard to detect in growing cells, two different genetic backgrounds were used. SEY and WCG, wild-type cells. atg7{Delta} and atg3{Delta} cells are defective in the lipidation of Atg8.

 
Before vacuolar targeting, proaminopeptidase I aggregates in the cytosol and forms a Cvt complex (41). The Cvt complex is then recruited by Atg19, a receptor-like protein to the PAS (29, 32), where it is incorporated into forming Cvt vesicles. Is Trs85 required for the recruitment of proaminopeptidase I to the PAS? To answer this we analyzed growing cells coexpressing GFP-Atg9 and pApe1-RFP under the fluorescence microscope. Atg9 is an integral membrane protein that localizes to the PAS (13). In wild-type cells, Atg9 and proaminopeptidase I colocalized in 90% of the cells (236 cells were analyzed). As expected, cells lacking Atg19 showed a colocalization in only 21% of the cells (193 cells analyzed), (Fig. 5D). In non-starved trs85{Delta} cells 89% of the cells (361 cells analyzed) showed colocalization. This demonstrates that Trs85 is not needed for the recruitment of proaminopeptidase I to the PAS, but for the formation of Cvt vesicles.

Trs85 Is Required for Proper Organization of the Preautophagosomal Structure during the Cvt Pathway—The PAS is believed to be the donor compartment for formation of Cvt vesicles and autophagosomes (14, 15). The inability of trs85{Delta} cells to form Cvt vesicles, therefore, prompted us to analyze the organization of the PAS in these cells. In S. cerevisiae the PAS is visible in fluorescence microscopy as a dot near the vacuolar membrane, where many of the Atg proteins colocalize (12), (13). Typically, only a fraction of the cells in a culture show a clearly visible PAS. We determined under the fluorescence microscope in logarithmically growing and starved cells the percentage of cells with a PAS-like punctate structure using biologically active fusion proteins of Atg proteins with the GFP. In trs85{Delta} cells expressing GFP-Atg19 or GFP-Atg9, the percentage of cells with a PAS was not altered compared with wild-type cells (Fig. 6A). Most interestingly, logarithmically growing trs85{Delta} cells failed almost completely to recruit GFP-Atg8 to the PAS (Fig. 6A). Starvation induction of autophagy rescued this phenotype, resulting in a wild-type-like number of cells exhibiting a PAS (Fig. 6A).

During autophagy and the Cvt pathway Atg8 is covalently coupled via a ubiquitin-like system to the membrane lipid phosphatidylethanolamine (42). Our Western blot analyses suggest that in growing trs85{Delta} cells the lipidation reaction is not blocked (Fig. 6B). During starvation the Atg8 level is induced, but our analysis did not point to a significantly altered level of Atg8 in trs85{Delta} cells compared with wild-type cells.

In Starved trs85{Delta} Cells Autophagosomes Are Normally Sized—The reduced autophagic rate in trs85{Delta} cells might be attributed to a decreased size of the autophagosomes. In wild-type cells autophagosomes are rarely detectable in the cytosol due to their rapid fusion with the vacuole. Ypt7 is essential for the vacuolar fusion of autophagosomes. To determine the size of autophagosomes, we therefore used trs85{Delta} ypt7{Delta} cells. We prepared cells starved for nitrogen for electron microscopy and estimated the mean area of the autophagosome profiles. Quantifying the area of autophagosome profiles is more accurate than measuring their diameter, since all autophagosomes are not round. The autophagosomes in trs85{Delta} ypt7{Delta} cells had an average area of 0.152 µm2 (S.D. = 0.094) (Fig. 7, A and C), which is similar to autophagosomes in ypt7{Delta} cells (0.164 µm2; S.D. = 0.079) (Fig. 7, A and B). Assuming a spherical shape for autophagosomes, the measured area corresponds to an ~450-nm diameter, which is in agreement with previous work on autophagosomal size (36). This finding argues against a role of Trs85 in the expansion step of autophagosomes.

Localization of Trs85-GFP—In a genome-wide approach, yeast cells chromosomally expressing GFP fusion proteins were generated (43). In this study Trs85-GFP was detected in the cytosol. We reprobed this finding and detected besides a cytosolic localization the recruitment of Trs85-GFP to a punctate structure (Fig. 8). In Bet3-GFP and Trs120-GFP-expressing cells multiple dot-like structures were visible, whereas Trs85-GFP-expressing cells showed only one punctum per cell (Fig. 8). This supports the idea that Trs85 does not colocalize with all Bet3- and Trs120-containing structures. Unfortunately, the fluorescence intensity of Trs85-GFP was not strong enough to allow colocalization with proaminopeptidase I-RFP, a marker of the preautophagosomal structure. Growing cells expressing Trs85-GFP were able to mature proaminopeptidase I, assuming biological activity of the fusion protein (data not shown).



View larger version (76K):
[in this window]
[in a new window]
  		FIGURE 7.
Trs85 does not affect the membrane expansion step during biogenesis of autophagosomes. ypt7{Delta} (B) and ypt7{Delta} trs85{Delta} (C) cells were starved 4 h in SD(-N) medium, fixed with permanganate, and then prepared for electron microscopy. The mean area of autophagosomes was determined by point counting (A) and found identical in both strains. The inset in C is 2.5-fold enlarged. Due to the lack of Ypt7, the vacuoles are fragmented in these cells. N, nucleus; V, vacuole; A, autophagosome. Bar, 600 nm. Av, autophagosome.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
The formation of double membrane-layered Cvt vesicles and autophagosomes out of the PAS seems to require novel mechanistic features, since none of the yeast t-SNAREs has been located to the PAS (17). Also, the yeast NSF Sec18 is not involved in the biogenesis of these vesicles (18). To learn more about the unconventional biogenesis of Cvt vesicles and autophagosomes, we aimed to identify novel components of this process and here identify Trs85. Our experiments demonstrate that Trs85 is essential for the biogenesis of Cvt vesicles. For formation of autophagosomes Trs85 is dispensable, but its absence reduces the autophagic rate to approximately half that of the wild-type rate (Fig. 2). The biogenesis of Cvt vesicles and autophagosomes requires a massive membrane flux whose origin remains elusive. Recent work demonstrated that mutations disturbing the early secretory pathway by either affecting the exit from the ER or trafficking through the Golgi lead to a block in both the Cvt pathway and autophagy (17, 18). Trs85 is a substoichiometric component of the TRAPP I complex, which is required for the ER to Golgi transport (20). Trs85 furthermore is a stoichiometric subunit of the TRAPP II complex acting in Golgi trafficking (20). Seen in light of the studies reporting an essential function of the early secretory pathway for the Cvt pathway and autophagy (17, 18), the finding of trs85{Delta} cells in our screen seems trivial at first glance. However, our detailed analysis uncovered striking differences between the phenotypes of trs85{Delta} cells and mutants of the early secretory pathway. This supports the idea that a lack of Trs85 does not simply interfere with the fidelity of the ER and Golgi but has a more specific function during the Cvt pathway and autophagy itself.



View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 8.
Localization of Trs85-GFP. Cells expressing the indicated GFP fusion proteins under control of their native promotor from the chromosome were grown to the logarithmic growth phase and visualized under the fluorescence microscope (upper row) and with Nomarski optics (lower row). Bar, 10 µm. Bet3-GFP- and Trs120-GFP-expressing cells showed multiple dots; cells expressing Trs85-GFP showed a single punctate structure beside a cytosolic pool.

 
First of all, proteins functioning in trafficking through the ER and Golgi typically are essential for growth. This is also true for 7 of the 10 components of the TRAPP complexes (20). Trs33, Trs65, and Trs85, the further three subunits of the TRAPP complexes, are not essential for growth, however, and their absence does not block the early secretory pathway (20). Under temperature stress conditions (37 °C), however, trs85{Delta} cells showed slower growth and an ER to Golgi transport defect (20). Our analysis demonstrated that in trs85{Delta} cells grown at 30 °C mature vacuolar proteinases are present, and vacuolar acidification is normal (Fig. 4). Although early secretory mutants show a block in both the Cvt pathway and autophagy (17), trs85{Delta} cells are only blocked in the Cvt pathway. The autophagic rate is reduced in these cells (Fig. 2), but enough autophagosomes are formed to rescue the proaminopeptidase I maturation defect during starvation (Fig. 1). TRS85 in this respect is a typical member of a subset of ATG genes such as ATG21 (23, 44) and VAC8 (45), which are only essential for the Cvt pathway.

In wild-type cells proaminopeptidase I forms a large cytosolic complex termed the Cvt complex, which is then recruited to the PAS, where it is enwrapped by forming Cvt vesicles. Sec12 is a GDP/GTP exchange factor required for exit from the ER (46). Temperature-sensitive sec12 mutant cells show at the non-permissive temperature a defect in the recruitment of the Cvt complex to the PAS (17). trs85{Delta} cells, in contrast, showed a normal recruitment of proaminopeptidase I to the PAS (Fig. 5). Taken together, the listed differences in the phenotypes observed in mutants of the early secretory pathway and in trs85{Delta} cells argue against the trivial explanation that a compromised function of the ER or Golgi is responsible for the defect in the Cvt pathway. This opens the possibility that Trs85 plays a more specific role in the Cvt pathway.

Our findings demonstrate that growing trs85{Delta} cells are defective in the biogenesis of Cvt vesicles (Fig. 5). To further dissect the molecular defects in trs85{Delta} cells, we analyzed the organization of the PAS. The integral membrane protein Atg9 and proaminopeptidase I colocalized at the PAS similar to wild-type cells (Fig. 5D). GFP-Atg8, in contrast, is not recruited to the PAS in growing trs85{Delta} cells as it is in growing wild-type cells. Although Atg8 coupled to the lipid phosphatidylethanolamine was still detectable in trs85{Delta} cells (Fig. 6B), this defect gives an easy explanation for the impaired biogenesis of Cvt vesicles, since previous studies have demonstrated the essential role of Atg8 during the formation of Cvt vesicles (23, 44). After starvation induction of autophagy, the failure in the PAS recruitment of GFP-Atg8 is rescued in trs85{Delta} cells (Fig. 6). But the autophagic rate of these cells is significantly reduced compared with wild-type cells (Figs. 2 and 3). The reduced autophagic rate might be due to either a reduced size or a reduced number of autophagosomes. Our electron microscopic study of starved trs85{Delta} ypt7{Delta} cells showed the formation of normally sized autophagosomes (Fig. 7). This argues against an involvement of Trs85 in the membrane expansion step of autophagosomes. Trs85 instead seems to act as a helper protein, increasing the rate of autophagosome formation.

Based on the absence of t-SNAREs at the PAS and the essential role of the ER and Golgi for autophagy and the Cvt pathway, Klionsky and co-workers (17) have proposed a maturation model for the formation of the PAS. In this model components of the PAS travel through the ER and Golgi and are segregated in a compartment, which finally matures into the PAS by the specific retrograde transport of proteins and lipids back to the donor compartment. A block of a retrograde transport step would then result in the generation of a premature PAS, which would probably be unable to recruit GFP-Atg8 and, thus, unable to fulfill its function. Because Trs85, in contrast to most components of the TRAPP complexes, is not essential for growth, one might speculate about the existence of a specific TRAPP complex acting in such a step during the generation of the PAS. This hypothesis is further supported by the observed differences in the localization of Trs85-GFP compared with Bet3-GFP and Trs120-GFP (Fig. 8).


   FOOTNOTES
 
* This work was supported by the Deutsche Forschungsgemeinschaft within the SFB 523 "Protein and Membrane Transport between Cellular Compartments." The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed. Fax: 49-551-39-5979; E-mail: mthumm{at}uni-goettingen.de.

2 The abbreviations used are: PAS, preautophagosomal structure; SNARE, soluble N-ethylmaleimide factor attachment protein receptor; Mes, 2-(N-morpholino)ethanesulfonic acid; Mops, 3-(N-morpholino)propanesulfonic acid; ER, endoplasmic reticulum; PMSF, phenylmethylsulfonyl fluoride; Pipes, 1,4-piperazinediethanesulfonic acid; GFP, green fluorescent protein. Back


   ACKNOWLEDGMENTS
 
We are grateful to R. Erdmann, M. Mazon, S. Nothwehr, and Y. Ohsumi for providing antibodies and plasmids. We thank Jan Hoennemann for technical help.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Klionsky, D. J. (2005) J. Cell Sci. 118, 7-18[Abstract/Free Full Text]
  2. Noda, T., Suzuki, K., and Ohsumi, Y. (2002) Trends Cell Biol. 12, 231-235[CrossRef][Medline] [Order article via Infotrieve]
  3. Thumm, M. (2002) Mol. Cell 10, 1257-1258[CrossRef][Medline] [Order article via Infotrieve]
  4. Klionsky, D. J., Cregg, J. M., Dunn, W. A., Emr, S. D., Sakai, Y., Sandoval, I. V., Sibirny, A., Subramani, S., Thumm, M., Veenhuis, M., and Ohsumi, Y. (2003) Dev. Cell 5, 539-545[CrossRef][Medline] [Order article via Infotrieve]
  5. Tsukada, M., and Ohsumi, Y. (1993) FEBS Lett. 333, 169-174[CrossRef][Medline] [Order article via Infotrieve]
  6. Thumm, M., Egner, R., Koch, B., Schlumpberger, M., Straub, M., Veenhuis, M., and Wolf, D. H. (1994) FEBS Lett. 349, 275-280[CrossRef][Medline] [Order article via Infotrieve]
  7. Harding, T. M., Hefner-Gravink, A., Thumm, M., and Klionsky, D. J. (1996) J. Biol. Chem. 271, 17621-17624[Abstract/Free Full Text]
  8. Shintani, T., and Klionsky, D. J. (2004) Science 306, 990-995[Abstract/Free Full Text]
  9. Levine, B. (2005) Cell 120, 159-162[Medline] [Order article via Infotrieve]
  10. Del Roso, A., Vittorini, S., Cavallini, G., Donati, A., Gori, Z., Masini, M., Pollera, M., and Bergamini, E. (2003) Exp. Gerontol. 38, 519-527[CrossRef][Medline] [Order article via Infotrieve]
  11. Melendez, A., Talloczy, Z., Seaman, M., Eskelinen, E. L., Hall, D. H., and Levine, B. (2003) Science 301, 1387-1391[Abstract/Free Full Text]
  12. Suzuki, K., Kirisako, T., Kamada, Y., Mizushima, N., Noda, T., and Ohsumi, Y. (2001) EMBO J. 20, 5971-5981[CrossRef][Medline] [Order article via Infotrieve]
  13. Kim, J., Huang, W. P., Stromhaug, P. E., and Klionsky, D. J. (2001) J. Biol. Chem. 277, 763-773[Medline] [Order article via Infotrieve]
  14. Shintani, T., Huang, W. P., Stromhaug, P. E., and Klionsky, D. J. (2002) Dev. Cell 3, 825-837[CrossRef][Medline] [Order article via Infotrieve]
  15. Suzuki, K., Kamada, Y., and Ohsumi, Y. (2002) Dev. Cell 3, 815-824[CrossRef][Medline] [Order article via Infotrieve]
  16. Epple, U. D., Eskelinen, E. L., and Thumm, M. (2003) J. Biol. Chem. 278, 7810-7821[Abstract/Free Full Text]
  17. Reggiori, F., Wang, C. W., Nair, U., Shintani, T., Abeliovich, H., and Klionsky, D. J. (2004) Mol. Biol. Cell 15, 2189-2204[Abstract/Free Full Text]
  18. Ishihara, N., Hamasaki, M., Yokota, S., Suzuki, K., Kamada, Y., Kihara, A., Yoshimori, T., Noda, T., and Ohsumi, Y. (2001) Mol. Biol. Cell 12, 3690-3702[Abstract/Free Full Text]
  19. Hutchins, M. U., Veenhuis, M., and Klionsky, D. J. (1999) J. Cell Sci. 112, 4079-4087[Abstract]
  20. Sacher, M., Barrowman, J., Wang, W., Horecka, J., Zhang, Y., Pypaert, M., and Ferro-Novick, S. (2001) Mol. Cell 7, 433-442[CrossRef][Medline] [Order article via Infotrieve]
  21. Ausubel, F. M., Brent, R., Kingston, R. E., and Moore, D. D. (1987) Current Protocols in Molecular Biology, Greene Publishing Associates, New York, NY
  22. Barth, H., Meiling-Wesse, K., Epple, U. D., and Thumm, M. (2002) FEBS Lett. 512, 173-179[CrossRef][Medline] [Order article via Infotrieve]
  23. Meiling-Wesse, K., Barth, H., Voss, C., Eskelinen, E. L., Epple, U. D., and Thumm, M. (2004) J. Biol. Chem. 279, 37741-37750[Abstract/Free Full Text]
  24. Güldener, U., Heck, S., Fielder, T., Beinhauer, J., and Hegemann, J. H. (1996) Nucleic Acids Res. 24, 2519-2524[Abstract/Free Full Text]
  25. Nothwehr, S. F., Conibear, E., and Stevens, T. H. (1995) J. Cell Biol. 129, 35-46[Abstract/Free Full Text]
  26. Campbell, R. E., Tour, O., Palmer, A. E., Steinbach, P. A., Baird, G. S., Zacharias, D. A., and Tsien, R. Y. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 7877-7882[Abstract/Free Full Text]
  27. Harding, T. M., Morano, K. A., Scott, S. V., and Klionsky, D. J. (1995) J. Cell Biol. 131, 591-602[Abstract/Free Full Text]
  28. Lang, T., Reiche, S., Straub, M., Bredschneider, M., and Thumm, M. (2000) J. Bacteriol. 182, 2125-2133[Abstract/Free Full Text]
  29. Leber, R., Silles, E., Sandoval, I. V., and Mazon, M. J. (2001) J. Biol. Chem. 276, 29210-29217[Abstract/Free Full Text]
  30. Campbell, C. L., and Thorsness, P. E. (1998) J. Cell Sci. 111, 2455-2464[Abstract]
  31. Noda, T., Matsuura, A., Wada, Y., and Ohsumi, Y. (1995) Biochem. Biophys. Res. Commun. 210, 126-132[CrossRef][Medline] [Order article via Infotrieve]
  32. Scott, S. V., Guan, J., Hutchins, M. U., Kim, J., and Klionsky, D. J. (2001) Mol. Cell 7, 1131-1141[CrossRef][Medline] [Order article via Infotrieve]
  33. Barth, H., and Thumm, M. (2001) Gene (Amst.) 274, 151-156[CrossRef][Medline] [Order article via Infotrieve]
  34. Sacher, M., Barrowman, J., Schieltz, D., Yates, J. R., III, and Ferro-Novick, S. (2000) Eur. J. Cell Biol. 79, 71-80[CrossRef][Medline] [Order article via Infotrieve]
  35. Kaytor, M. D., and Livingston, D. M. (1995) Yeast 11, 1147-1155[CrossRef][Medline] [Order article via Infotrieve]
  36. Takeshige, K., Baba, M., Tsuboi, S., Noda, T., and Ohsumi, Y. (1992) J. Cell Biol. 119, 301-311[Abstract/Free Full Text]
  37. Nakamura, N., Matsuura, A., Wada, Y., and Ohsumi, Y. (1997) J. Biochem. (Tokyo) 121, 338-344[Abstract/Free Full Text]
  38. Roberts, C. J., Raymond, C. K., Yamahiro, C. T., and Stevens, T. H. (1991) Methods Enzymol. 194, 644-661[Medline] [Order article via Infotrieve]
  39. Huang, W. P., Scott, S. V., Kim, J., and Klionsky, D. J. (2000) J. Biol. Chem. 275, 5845-5851[Abstract/Free Full Text]
  40. Kim, J., and Klionsky, D. J. (2000) Annu. Rev. Biochem. 69, 303-342[CrossRef][Medline] [Order article via Infotrieve]
  41. Baba, M., Osumi, M., Scott, S. V., Klionsky, D. J., and Ohsumi, Y. (1997) J. Cell Biol. 139, 1687-1695[Abstract/Free Full Text]
  42. Ohsumi, Y. (2001) Nat. Rev. Mol. Cell Biol. 2, 211-216[CrossRef][Medline] [Order article via Infotrieve]
  43. Huh, W. K., Falvo, J. V., Gerke, L. C., Carroll, A. S., Howson, R. W., Weissman, J. S., and O'Shea, E. K. (2003) Nature 425, 686-691[CrossRef][Medline] [Order article via Infotrieve]
  44. Stromhaug, P. E., Reggiori, F., Guan, J., Wang, C. W., and Klionsky, D. J. (2004) Mol. Biol. Cell 15, 3553-3566[Abstract/Free Full Text]
  45. Scott, S. V., Nice, D. C., Nau, J. J., Weisman, L. S., Kamada, Y., Keizer-Gunnink, I., Funakoshi, T., Veenhuis, M., Ohsumi, Y., and Klionsky, D. J. (2000) J. Biol. Chem. 275, 25840-25849[Abstract/Free Full Text]
  46. Barlowe, C., and Schekman, R. (1993) Nature 365, 347-349[CrossRef][Medline] [Order article via Infotrieve]
  47. Meiling-Wesse, K., Barth, H., and Thumm, M. (2002) FEBS Lett. 526, 71-76[CrossRef][Medline] [Order article via Infotrieve]
  48. Barth, H., Meiling-Wesse, K., Epple, U. D., and Thumm, M. (2001) FEBS Lett. 508, 23-28[CrossRef][Medline] [Order article via Infotrieve]
  49. Schlumpberger, M., Schaeffeler, E., Straub, M., Bredschneider, M., Wolf, D. H., and Thumm, M. (1997) J. Bacteriol. 179, 1068-1076[Abstract/Free Full Text]
  50. Straub, M., Bredschneider, M., and Thumm, M. (1997) J. Bacteriol. 179, 3875-3883[Abstract/Free Full Text]
  51. Meiling-Wesse, K., Barth, H., Voss, C., Barmark, G., Muren, E., Ronne, H., and Thumm, M. (2002) FEBS Lett. 530, 174-180[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Biol. CellHome page
R. Krick, Y. Muehe, T. Prick, S. Bremer, P. Schlotterhose, E.-L. Eskelinen, J. Millen, D. S. Goldfarb, and M. Thumm
Piecemeal Microautophagy of the Nucleus Requires the Core Macroautophagy Genes
Mol. Biol. Cell, October 1, 2008; 19(10): 4492 - 4505.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
T. Y. Nazarko, A. S. Polupanov, R. R. Manjithaya, S. Subramani, and A. A. Sibirny
The Requirement of Sterol Glucoside for Pexophagy in Yeast Is Dependent on the Species and Nature of Peroxisome Inducers
Mol. Biol. Cell, January 1, 2007; 18(1): 106 - 118.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/39/33669    most recent
M501701200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Meiling-Wesse, K.
Right arrow Articles by Thumm, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Meiling-Wesse, K.
Right arrow Articles by Thumm, M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement