Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M506551200 on August 23, 2005 Originally published In Press as doi:10.1074/jbc.M506551200 on August 23, 2005 Originally published In Press as doi:10.1074/jbc.M506551200 on August 18, 2005

J. Biol. Chem., Vol. 280, Issue 42, 35217-35227, October 21, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/42/35217    most recent
M506551200v3
M506551200v2
M506551200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rahmani, M.
Right arrow Articles by Grant, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rahmani, M.
Right arrow Articles by Grant, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Apoptosis Induced by the Kinase Inhibitor BAY 43-9006 in Human Leukemia Cells Involves Down-regulation of Mcl-1 through Inhibition of Translation*

Mohamed Rahmani{ddagger}, Eric Maynard Davis{ddagger}, Cheryl Bauer{ddagger}, Paul Dent§, and Steven Grant{ddagger}§1

From the Departments of {ddagger}Medicine, §Biochemistry, and Pharmacology, Virginia Commonwealth University, School of Medicine, Richmond, Virginia 23298

Received for publication, June 16, 2005 , and in revised form, August 15, 2005.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
BAY 43-9006 is a kinase inhibitor that induces apoptosis in a variety of tumor cells. Here we report that treatment with BAY 43-9006 results in marked cytochrome c and AIF release into the cytosol, caspase-9, -8, -7, and -3 activation, and apoptosis in human leukemia cells (U937, Jurkat, and K562). Pronounced apoptosis was also observed in blasts from patients with acute myeloid leukemia. These events were accompanied by ERK1/2 inactivation and caspase-independent down-regulation of Mcl-1. Inducible expression of a constitutively active MEK1 construct did not prevent Mcl-1 down-regulation, suggesting that this event is not related to MEK/ERK pathway inactivation. Furthermore, BAY 43-9006 did not induce major changes in Mcl-1 mRNA levels monitored by real-time PCR or Mcl-1 promoter activity demonstrated by luciferase reporter assays, but it did enhance Mcl-1 down-regulation in actinomycin D-treated cells. Inhibition of protein synthesis by cycloheximide or proteasome function with MG132 and pulse-chase studies with [35S]methionine demonstrated that BAY 43-9006 did not diminish Mcl-1 protein stability, nor did it enhance Mcl-1 ubiquitination, but instead markedly attenuated Mcl-1 translation in association with the rapid and potent dephosphorylation of the eIF4E translation initiation factor. Finally, ectopic expression of Mcl-1 in leukemic cells markedly inhibited BAY 43-9006-mediated cytochrome c cytosolic release, caspase-9, -7, and -3 activation, as well as cell death, indicating that Mcl-1 operates upstream of cytochrome c release and caspase activation. Together, these findings demonstrate that BAY 43-9006 mediates cell death in human leukemia cells, at least in part, through down-regulation of Mcl-1 via inhibition of translation.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The Ras/Raf/mitogen-activated protein kinase (MEK)2/extracellular-signal-regulated kinase (ERK) cascade plays a critical role in relaying signals from cell surface receptors to various cytoplasmic and nuclear proteins involved in diverse biological process such as cell growth, transformation, differentiation, and apoptosis (1). Aberrant activation of this pathway has been implicated in the development of many tumor types, and constitutive activation of this pathway has been observed in ~30% of all human cancer. The serine/threonine Raf kinase family, which consists of three proteins, C-Raf (also referred to as Raf-1), B-Raf, and A-Raf, is an essential component of this pathway (1, 2). Strikingly, B-Raf-activating mutations have been observed in ~70% of malignant melanomas (3, 4) and at lower frequencies in a number of other human cancer types, including colorectal (3, 5), ovarian, and papillary thyroid carcinomas (3, 6, 7). Moreover, overexpression of constitutively active c-Raf is sufficient to induce transformation of NIH 3T3 cells (8). Increased Raf/MEK/ERK activity has also been observed in a variety of leukemias, including acute myeloid leukemia (AML) and chronic myeloid leukemia (9, 10). In addition, constitutive activation of this pathway diminishes apoptosis in hematopoietic cells (11) and abrogates the cytokine dependence of several human and murine cytokine-dependent hematopoietic cells lines (e.g. TF-1, FDC-P1, and FL5.12) (12). Conversely, inhibition of this pathway by pharmacologic MEK inhibitors such as PD98059 or U0126 enhances apoptosis induction by a variety of agents, including paclitaxel (13) UCN01 (14), STI571 (15), proteasome inhibitors (16), and lovastatin (17). For these reasons, disrupting the Ras/Raf/MEK/ERK pathway represents an attractive anticancer strategy, particularly in leukemia cells.

BAY 43-9006, a novel bi-aryl urea, has shown promising preclinical activity against a variety of tumor cell types and is currently undergoing phase II/III clinical evaluation (1820). Although it was initially developed as a specific inhibitor of C-Raf and B-Raf, subsequent studies revealed that this compound also inhibits several other important tyrosine kinases involved in tumor progression, including vascular epidermal growth factor receptor-2, vascular epidermal growth factor receptor-3, platelet-derived growth factor receptor-{beta}, Flt3, and c-Kit (21). Interestingly, BAY 43-9006 has been shown to inhibit C-Raf and wild type as well as mutant V600E B-Raf kinase activities in vitro and to diminish MEK/ERK activation in various tumor cell lines, including those harboring mutant Ras or B-Raf (2123).

Several studies have shown that myeloid cell leukemia-1 (Mcl-1), a Bcl-2 family member, plays a pivotal role in cell survival, particularly in hematopoietic cells. For example, depletion of Mcl-1 using antisense oligonucleotides rapidly triggers apoptosis in U937 cells (24). Moreover, inducible deletion of Mcl-1 in mice resulted in loss of early bone marrow progenitor populations, including hematopoietic stem cells (25). Deletion of Mcl-1 during early lymphocyte differentiation also increased apoptosis and arrested development at the pro-B-cell and double-negative T-cell stages. In addition, specific ablation of Mcl-1 in peripheral B- and T-cell populations resulted also in their rapid loss (26). On the other hand, selective overexpression of Mcl-1 in hematopoietic tissues of transgenic mice promotes the survival of hematopoietic cells and enhances the outgrowth of myeloid cell lines (27). Finally, overexpression of Mcl-1 protects cells from apoptosis induced by a variety of agents, including UV, tumor necrosis factor-related apoptosis-inducing ligand, etoposide, staurosporine, actinomycin D, among others (2831). Such evidence suggests that Mcl-1 may play a critical role in the survival of leukemia and possibly other malignant hematopoietic cells. Interestingly, expression of Mcl-1 has been shown to be dependent upon an intact MEK/ERK pathway in both hematopoietic (32) and nonhematopoietic cells (33).

Currently, the one or more mechanisms by which BAY 43-9006 induces cell death in human leukemia cells remain to be fully elucidated. Here we report that BAY 43-9006 potently induces mitochondrial injury and apoptosis in these cells in association with a pronounced and MEK/ERK-independent reduction in Mcl-1 expression. Moreover, prevention of BAY 43-9006-mediated Mcl-1 down-regulation by ectopic expression of an Mcl-1 construct substantially diminishes BAY 43-9006-induced mitochondrial injury and apoptosis. Finally, the present results indicate that BAY 43-9006 down-regulates Mcl-1 expression through inhibition of translation, rather than through a transcriptional, post-translational, or caspase-dependent mechanism.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cells—The human leukemia U937, Jurkat, and K562 cells were cultured as previously reported (34). U937 cells stably overexpressing Mcl-1 were kindly provided by Dr. Ruth Craig (Dartmouth Medical School, Hanover). These cells were obtained by transfecting U937 cells with a pCEP4-Mcl-1construct that encodes for the 40-kDa Mcl-1 protein. Stable single cell clones were selected in the presence of 400 µg/ml hygromycin. Thereafter, cells from each clone were analyzed for Mcl-1 expression by Western blot. A Tet-On Jurkat cell line inducibly expressing constitutively active MEK1 under doxycycline control was previously described (34).

Isolation of Patient-derived Leukemic Blasts—Leukemic blasts were obtained with informed consent from the peripheral blood of several patients with acute myeloblastic leukemia (AML), FAB subtype M2. These studies have been sanctioned by the Investigational Review Board of Virginia Commonwealth University/Medical College of Virginia, and all patients provided informed consent. In each case, the percentage of blasts in the peripheral blood was >70%. Blood was collected into heparinized syringes, diluted 1:3 with RMPI 1640 medium, and transferred as an overlayer to centrifuge tubes containing 10 ml of Ficoll-Hypaque (specific gravity, 1.077–1.081). After centrifugation at room temperature for 30 min, the interface layer, containing predominantly leukemic blasts, was extracted with a sterile Pasteur pipette, suspended in RPMI medium, and washed three times. Leukemic blasts, which displayed >90% viability by trypan blue exclusion, were then diluted into RPMI medium containing 10% fetal calf serum at a concentration of 106 cells/ml, and exposed to drugs as described in the case of continuously cultured cell lines.

Reagents—BAY 43-9006 (Bayer, West Haven, CT) was provided by Dr. John Wright, Cancer Treatment and Evaluation Program, NCI, National Institutes of Health (Bethesda, MD). It was dissolved in Me2SO, and aliquots were maintained at –80 °C. MG132 was purchased from Calbiochem; cycloheximide and actinomycin D were purchased from Sigma. SB202190 was purchased from Alexis Corp. (San Diego, CA). Rapamycin and U0126 were purchased from Cell Signaling Technology (Beverly, MA). The broad spectrum cell-permeable caspase inhibitor, z-VAD-FMK was purchased from Enzyme Systems Products (Livermore, CA). All reagents were prepared and used as recommended by their suppliers.

Assessment of Apoptosis—Apoptotic cells were routinely identified by Annexin V-fluorescein isothiocyanate staining as previously described (35). Briefly, 105 cells were collected, washed in cold phosphate-buffered saline, and then resuspended in binding buffer (10 mM Hepes/NaOH, pH 7.4, 140 mM NaCl, 2.5 mM CaCl2) containing fluorescein-labeled annexin V (BD Pharmingen) and propidium iodide. Samples were incubated for 15 min and then analyzed by flow cytometer (BD Biosciences FACScan).

Quantitative Real-time PCR—U937 cells were left untreated or treated with 10 µM BAY 43-9006 for the indicated period after which they were lysed and total RNA was extracted using the RNeasy mini kit (Qiagen). Quantitative real-time PCR analysis was carried out on the ABI Prism® 7900 Sequence Detection System (Applied Biosystems, Foster City, CA) using the TaqMan® One Step PCR Master Mix Reagents Kit (polynucleotide: 4309169) as recommended by the manufacturer. The cycling conditions were: 48 °C/30 min; 95 °C/10 min; and 40 cycles of 95 °C/15 s and 60 °C/1 min. The cycle threshold was determined to provide the optimal standard curve values (0.98–1.0). The probes (5'-TCAAGTGTTTAGCCACAAAGGCACCAAAAG-3') and Mcl-1-specific primers (forward, GGGCAGGATTGTGACTCTCATT; reverse, 5'-GATGCAGCTTTCTTGGTTTATGG-3') were designed using the Primer Express® 2.0 version. The probes were labeled at the 5'-end with 6-carboxyfluoresceine and at the 3'-end with 6-carboxytetramethylrhodamine. Ribosomal RNA (18 S rRNA) was used as endogenous control. Each sample was tested in triplicate, and the Mcl-1 mRNA level was normalized to that of 18 S rRNA.

Transient Transfection and Reporter Gene Assay—K562 cells were transiently transfected using Amaxa nucleofectorTM (Koeln, Germany) as previously described (36). Constitutively active MNK1 T332D and eIF4E (wild type) were kindly provided by Dr. J. A. Cooper (Fred Hutchinson Cancer Research Center, Seattle, WA) (37). PcDNA3.1-Mcl-1 was a generous gift from Dr. R. W. Craig. Empty vector pcDNA3.1 was purchased from Invitrogen. Reporter gene assays were carried out as previously described (38). Briefly, cells were cotransfected with a –203/+10-Mcl-1-pGL2 plasmid (39) in which firefly luciferase is driven by the –203 to +10 element of the Mcl-1 gene promoter, or the pGL2-basic empty vector (Promega, Madison, WI) and pRL-TK-luc plasmid encoding for Renilla luciferase. Cells were incubated for 6 h and then treated with BAY 43-9006 for an additional 20 h, after which the activity of firefly and Renilla luciferases was measured using the Dual-Luciferase reporter assay system (Promega). Values for firefly luciferase activity were normalized to those obtained for Renilla luciferase activity.

Immunoprecipitation and Immunoblotting—For immunoprecipitation, cells were lysed in buffer containing 20 mM Tris (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, antiproteases (10 µg/ml of leupeptin and aprotinin, 1 mM phenylmethylsulfonyl fluoride), and 1% Triton X-100 after which 500 µg of protein lysate was subjected to immunoprecipitation using the designated antibodies. Immunoblotting was performed using the immunoprecipitates or the whole cells lysates as previously described in detail (35). The primary antibodies used in this study were as follows: caspase-3, Bax, caspase-7, Bcl-2, and Mcl-1 (BD Pharmingen); Caspase-8 (Alexis Corp.); poly(ADP-ribose) polymerase (PARP, Biomol%20Research%20Laboratories">Biomol Research Laboratories, Plymouth Meeting, PA); Bcl-xL XIAP, total and Phospho-ERK1/2 (Thr-202/Tyr-204), ubiquitin, cleaved caspase-9, cleaved caspase-3, phospho-4EBP1 (Ser-65), phospho-eIF4E (Ser-209), phospho-eIF4G (Ser-1108), phospho-p90RSK (Ser-380), phospho-p70S6K (Thr-389), phospho-p38 (Thr-180/Tyr-182), and phospho-JNK1 (Thr-183/Tyr-185) (Cell Signaling Technology); eIF4G (BD Transduction Laboratories); Bim, HA, cytochrome c, AIF, total and phosphorylated Bcr-abl, eIF4E, p70S6K, myc, JNK1, and p38 (Santa Cruz Biotechnology, Santa Cruz, CA); and Bak and {alpha}-tubulin (Calbiochem).

Mcl-1 Protein Stability—U937 cells were washed in phosphate-buffered saline and cultured at a density of 5 x 106 cells, in methionine-free RPMI for 15 min, then labeled with 100 µCi/ml [35S]methionine (ICN, Biomedicals, Inc., Irvine, CA) for 60 min. Cells were then washed in phosphate-buffered saline and cultured in complete RPMI containing fetal bovine serum and excess of cold methionine (10 mM) and cysteine (5 mM) for the indicated periods in the presence or absence of BAY 43-9006 with or without the proteasome inhibitor MG132. At the end of the indicated intervals, 107 cells were collected and subsequently subjected to immunoprecipitation using Mcl-1 antibodies as described above. The immunoprecipitates were subjected to SDS-PAGE followed by autoradiography.

m7-GTP-Sepharose Chromatography—Following stimulation, cells were lysed in lysis buffer as indicated above. 500 µg of protein lysates was incubated with 50 µl of m7-GTP-Sepharose beads (Amersham Biosciences) for 2 h at 4°C after which the beads were washed three times and boiled in Laemmli buffer for 5 min, and following centrifugation, the supernatants containing the proteins were subjected to Western blot analysis.

Subcellular Fractionation—Leukemic cells (4 x 106) were lysed using digitonin buffer (35), after which cytosolic and membrane fractions were separated by centrifugation, solubilized in Laemmli buffer, and boiled for 5 min. Proteins were analyzed by Western blot to evaluate cytochrome c release into the cytosol.

Statistical Analysis—The significance of differences between experimental conditions was determined using the Student's t test for unpaired observations.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Treatment with BAY 43-9006 Results in a Marked Induction of Mitochondrial Injury and Apoptosis in Human Leukemia Cells—To characterize the effects of BAY 43-9006 in U937 cells, dose-response and time-course studies were performed (Fig. 1). As shown in Fig. 1A, exposure of U937 cells to increasing concentrations of BAY 43-9006 for 24 h revealed a moderate induction of apoptosis at concentration as low as 5 µM as indicated by annexin V analysis. Higher concentration of BAY 43-9006 resulted in more pronounced cell death (e.g. 80% at 15 µM). Virtually identical results were obtained in Jurkat lymphoid leukemia cells (Fig. 1B). Exposure of U937 cells to 10 µM BAY 43-9006 at varying intervals resulted in induction of apoptosis that was detected as early as 4 h after drug treatment. Longer exposure intervals resulted in a marked increase in cell death (e.g. 55 and 70% at 24 and 48 h, respectively). Essentially equivalent findings were observed when Jurkat cells were examined (data not shown). Furthermore, exposure to BAY 43-9006 resulted in a release of cytochrome c and AIF into the cytosol (Fig. 1D) accompanied by cleavage of caspases-7, -8, -9, and -3 as well as PARP (Fig. 1E). These events were readily apparent after 8 h of treatment and became more pronounced after 20 h. Together, these findings indicate that BAY 43-9006 results in a striking induction of caspase activation, mitochondrial injury, and apoptosis in human myeloid and lymphoid leukemic cells.

Exposure of U937 Cells to BAY 43-9006 Is Associated with a Decrease in ERK Phosphorylation—Dose-response studies (Fig. 2) revealed that exposure of U937 cells to BAY 43-9006 at concentration as low as 5 µM resulted in a discernable decrease in ERK phosphorylation as early as half an hour after beginning of exposure, and this decrease persisted at 4 and 8 h of drug administration. Exposure to 7.5 and 10 µM BAY 43-9006 produced even more pronounced reductions in ERK phosphorylation. In contrast, total levels of ERK were unchanged. These findings confirm that, as previously described in other cell types (21, 22) BAY 43-9006 inactivates ERK in human leukemia cells.



View larger version (55K):
[in this window]
[in a new window]
 
FIGURE 1.
Treatment with BAY 43-9006 results in a striking mitochondrial damage, caspase activation, and apoptosis in human leukemia cells. U937 (A) and Jurkat (B) cells were exposed to the designated concentration of BAY 43-9006 for 24 h after which the percentage of apoptotic cells was determined by annexin V analysis as described under "Materials and Methods." C, U937 cells were exposed to 10 µM BAY 43-9006 for the designated period after which apoptosis was determined as above. D, U937 cells were treated with BAY 43-9006 for the designated period, after which mitochondria-free cytosolic fractions were obtained as described under "Materials and Methods" and subjected to Western blot analysis to monitor release of cytochrome c and AIF. Alternatively, whole cell lysates were obtained, and subjected to Western blot analysis to monitor expression of procaspase-3, caspase-8, caspase-7, cleaved caspase-9 (c-casp-9), and PARP. The blots were subsequently re-probed with anti-tubulin (Tub) antibodies to document equivalent loading and transfer. The results of a representative study are shown; two additional experiments yielded equivalent results.

 



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 2.
Treatment with BAY 43-9006 resulted in a dose-dependent dephosphorylation of ERK1/2. U937 cells were exposed to BAY 43-9006 for 0.5, 4, and 8 h, after which protein lysates were prepared and subjected to Western blot analysis to monitor ERK1/2 phosphorylation. Each lane was loaded with 20 µg of protein; the blots were subsequently reprobed with antibody directed against tubulin to control for equal loading and transfer of proteins. Two additional experiments yielded similar results.

 
Treatment of U937 Cells with BAY 43-9006 Results in Rapid Decrease in Mcl-1 Protein Level and Late Bcl-2, Bax, and XIAP Cleavage—In view of the critical role that Bcl-2 family proteins play in apoptosis regulation (40, 41), expression of these proteins was monitored in U937 cells following treatment of cells with BAY 43-9006 (10 µM) for varying intervals (Fig. 3A). After 20 h of treatment, a decline in protein levels of Bcl-xL, Bak, Bim, as well as cleavage of Bcl-2, Bax, and XIAP were detected, however, no major changes were observed at earlier intervals. The finding that these changes were detected after caspase activation argues against the possibility of a primary role for these phenomena in BAY 43-9006-mediated cell death. In addition, no change in Bid protein level was noted. In striking contrast, levels of the anti-apoptotic protein Mcl-1 protein declined rapidly (e.g. over 2 h) following treatment with BAY 43-9006, and by 8 h expression was essentially absent (Fig. 3A). Further analysis revealed that treatment with BAY 43-9006 for 4 h resulted in the dose-dependent down-regulation of Mcl-1, which roughly paralleled the extent of lethality (Fig. 3B). Furthermore, the pan-caspase inhibitor z-VAD-FMK was ineffective in preventing down-regulation of Mcl-1 protein following 4 or 8 h of treatment with BAY 43-9006. In contrast, late changes in expression of other Bcl-2 family members in cells exposed to BAY 43-9006 were clearly diminished by z-VAD-FMK (data not shown). Similar results were obtained in Jurkat cells (data not shown). Together, these findings demonstrate that BAY 43-9006 induces the rapid and dose-dependent down-regulation of Mcl-1 protein through a mechanism independent of caspase activation.



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 3.
BAY 43-9006 caused a time- and dose-dependant but caspase-independent down-regulation of Mcl-1. A, U937 cells were exposed to 10 µM BAY 43-9006 for the indicated periods after which protein lysates were prepared and subjected to Western blot analysis as described under "Materials and Methods" using the indicated antibodies. B, U937 cells were treated with BAY 43-9006 at the designated concentration for 4 h, after which cells lysates were prepared and subjected to Western blot analysis using anti-Mcl-1 antibodies. C, U937 cells were treated with 10 µM BAY 43-9006 in the presence or absence of 25 µM z-VAD-FMK for 4 and 8 h, after which Mcl-1 protein level was monitored by Western blot analysis. For all studies, each lane was loaded with 20 µg of protein; the blots were subsequently reprobed with antibody directed against tubulin to control for equal loading and transfer of proteins. Arrows indicate cleavage fragments (CF). Two additional experiments yielded similar results.

 
Treatment with BAY 43-9006 Enhances Cell Death in Bcr-abl+ Cells as Well as in Human Leukemia Blasts in Association with ERK Dephosphorylation and Mcl-1 Down-regulation—To determine whether BAY 43-9006-mediated lethality could be extended to include human Bcr-Abl+ leukemia cells, parallel studies were performed in K562 cells. As shown in Fig. 4A, 24-h exposure to BAY 43-9006 resulted in a dose-dependent cell death as monitored by annexin V staining assay. Apoptosis was initially detected at BAY 43-9006 concentrations ≥ 2.5 µM, and at 10 µM, the large majority of cells was apoptotic (~75%). Time-course studies revealed a time-dependent cleavage of PARP that was first detected at 4 h of treatment and became more apparent at later exposure intervals (8, 16, and 24 h) (Fig. 4B). Notably, a rapid decline in ERK phosphorylation and Mcl-1 protein levels were also observed, analogous to results in U937 cells. In contrast, no major changes were noted in Bcr-abl expression or phosphorylation until considerably later intervals (e.g. 24 h) when the large majority of cells were apoptotic (Fig. 4B).

Lastly, attempts were made to determine whether BAY 43-9006 also triggered cell death in primary human leukemia blasts, or whether this phenomenon was restricted to continuously cultured cell lines. Significantly, treatment with BAY 43-9006 resulted in a marked dose-dependent increase in cell death in human leukemia blasts isolated from 2 patients with AML (FAB classification M2; Fig. 4C). An increase in apoptosis at 24 h was detected at a BAY 43-9006 concentration as low as 2.5 µM (35–45%) and further increases in cell death were observed at higher concentrations. For example, at 10 µM BAY 43-9006 induced 60 and 80% apoptosis in blasts from patient #1 and patient #2, respectively. Studies involving blasts from two additional patients yielded essentially identical results (data not shown). These events were accompanied by pronounced PARP cleavage (Fig. 4D). Notably, a marked decrease in Mcl-1 protein levels and in ERK phosphorylation was also observed in both samples, whereas the total ERK1/2 level remained unaffected. Thus, exposure to BAY 43-9006 leads to a marked increase in lethality in primary human AML blasts in association with diminished ERK phosphorylation and Mcl-1 down-regulation, analogous to findings in continuously cultured leukemia cell lines.



View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 4.
Exposure to BAY 43-9006 results in a marked increase in apoptosis in association with down-regulation of Mcl-1 and inactivation of ERK1/2 in K562 cells as well as in primary human leukemia blasts. A, K562 cells were exposed to the indicated concentrations of BAY 43-9006 for 24 h after which the extent of apoptosis was determined using annexin V staining. B, K562 cells were treated with 6 µM BAY 43-9006 for the designated intervals after which cell lysates were prepared and subjected to Western blot analysis using the indicated antibodies. C, leukemia blasts were isolated as described under "Materials and Methods" from the peripheral blood of two patients with AML (FAB classification M2), exposed to the designated concentration of BAY 43-9006 for 24 h, after which the extent of apoptosis was determined using annexin V analysis. Each sample was performed in duplicate, and the means ± S.D. were calculated. D, alternatively, blasts were lysed after 6 h of treatment and subjected to Western blot analysis to monitor the level of phosphorylated ERK1/2, total ERK1/2, and Mcl-1 proteins. The protein lysates were also prepared after 24 h of exposure to monitor PARP cleavage by Western blot analysis. Total ERK in these experiments also serves as control for loading and transfer of proteins.

 
Mcl-1 Down-regulation by BAY 43-9006 Is Independent of MEK/ERK, p90RSK, mTOR, and p70S6K Inactivation—Previous studies have indicated that interruption of the Raf/MEK/ERK pathway by the MEK inhibitor PD98059 decreases basal levels of Mcl-1 (42) and attenuates Mcl-1 protein accumulation in response to various cytokines, including epidermal growth factor, interleukin-5, and stem cell factor (33). Consequently, the possibility that BAY 43-9006 down-regulates Mcl-1 through inhibition of the Raf/MEK/ERK pathway appeared plausible. To test this possibility, Jurkat cells (MT6) inducibly expressing a constitutively active MEK1 under the control of a doxycycline-responsive promoter was employed. Western blot analysis revealed that addition of doxycycline resulted in a substantial increase in expression of constitutively active MEK1 and phospho-ERK1/2 in both control and BAY 43-9006-treated cells (Fig. 5A). However, exposure to BAY 43-9006 resulted in equivalent decreases in Mcl-1 expression in the absence or the presence of doxycycline. Similar results were obtained in two additional MEK1-inducible clones and in U937 cells stably expressing constitutively active MEK1 (43) (data not shown). Effects of BAY 43-9006 on p90RSK and p70S6K were also examined. As shown in Fig. 5B, a time-course study revealed that BAY 43-9006 did not have a major effect on p90RSK phosphorylation. Expression and phosphorylation of p70S6K were also unperturbed by treatment with BAY 43-9006. Consistent with these findings, induction of constitutively active MEK1 resulted in increased phosphorylation of p90RSK (Fig. 5C), whereas BAY 43-9006 continued to down-regulate Mcl-1 (Fig. 5A). In addition, pretreatment of cells with the MEK inhibitor U0126 (10 µM), which clearly decreased ERK and p90RSK phosphorylation, resulted in only a very modest decline in Mcl-1 protein levels (Fig. 5D). Notably, treatment of cells with the mTOR inhibitor rapamycin (20 nM) also failed to decrease Mcl-1 protein levels despite markedly diminishing phosphorylation of p70S6 kinase (Fig. 5E). Together, these findings argue against the possibility that BAY 43-9006 down-regulates Mcl-1 through inhibition of Raf/MEK/ERK1/2, p90RSK, mTOR, or p70S6K.



View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 5.
Mcl-1 down-regulation by BAY 43-9006 is independent of MEK/ERK, p90RSK, mTOR, and p70S6K inactivation. A and C, Jurkat cells (MT6) inducibly expressing constitutively active HA-tagged MEK1 were left untreated or treated for 24 h with 2 µg/ml doxycycline and then exposed to 10 µM BAY 43-9006 for an additional 4 h. Cells were then analyzed for HA-MEK1, phospho-ERK1/2, phospho-p90RSK, and Mcl-1 expression by Western blot. B, D, E, and F, U937 cells were treated with 10µM BAY 43-9006 (B and F), U0126 (D), or 20 nM rapamycin (E) for the designated intervals after which protein lysates were prepared and subjected to Western blot using indicated antibodies. For each experiment, at least two additional studies yielded equivalent results.

 
Finally, activation of the stress-activated protein kinases p38 and JNK were examined. Consistent with previous studies (19), BAY 43-9006 induced a marked decrease in p38 phosphorylation without affecting total protein levels. This was associated with an increase in JNK phosphorylation (Fig. 5F). However, inhibition of p38 or JNK activation with SB202190 or SP600125, respectively, did not result in major change in Mcl-1 protein levels (data not shown), arguing against the possibility that BAY 43-9006 down-regulates Mcl-1 through a p38- or JNK-dependent mechanism.

Mcl-1 Down-regulation by BAY 43-9006 Is Largely Independent of TranscriptionMcl-1 is known to be regulated at the transcriptional level by a variety of transcription factors, including E2F1, CREB, and ETS (4446). Consequently, Mcl-1 promoter activity was monitored using a reporter gene assay. As shown in Fig. 6A, treatment with BAY 43-9006 had no significant effect on luciferase driven by an Mcl-1 promoter (p > 0.05). Essentially equivalent results were obtained in K562 cells (data not shown). These findings argue against the possibility that BAY 43-9006 inhibits Mcl-1 transcription. Next, Mcl-1 mRNA was quantified using real-time PCR. Notably, treatment of U937 cells with BAY 43-9006 resulted in a very modest and transient decline in Mcl-1 mRNA levels after 2 h of treatment (Fig. 6B). After 4 h of treatment, Mcl-1 mRNA returned to near basal levels. In addition, inhibition of transcription using actinomycin D (5 µg/ml) resulted in a decrease in Mcl-1 protein levels, and co-treatment with BAY 43-9006 resulted in a further decline (Fig. 6C), suggesting an alternative, transcription-independent mechanism of Mcl-1 down-regulation by this agent. Collectively, these and the preceding findings are most consistent with the notion that BAY 43-9006 down-regulates Mcl-1 protein at either the translational or at the post-translational level.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 6.
BAY 43-9006 does not substantially diminish Mcl-1 mRNA levels or Mcl-1 promoter activity. A, Jurkat cells were cotransfected with (–203/+10-Mcl-1-pGL2) or pGL2-Basic and pRL-TK-luc plasmids. Cells were incubated for 6 h and then treated with BAY 43-9006 for an additional 20 h after which activity of firefly and Renilla luciferase was monitored as described under "Materials and Methods." Values for firefly luciferase activity were normalized to those obtained for Renilla luciferase activity, after which values obtained for (–203/+10-Mcl-1-pGL2) transfected cells were divided by the corresponding values obtained for pGL2-Basic transfected cells. The graph shown represents the average of four experiments performed in triplicate ± S.D. *, not significantly different from values for the control (p > 0.05). B, U937 cells were treated with BAY 43-9006 at the designated intervals, after which total RNA were isolated and Mcl-1 mRNA were quantified using real-time PCR as described under "Materials and Methods." Values represent the means ± S.D. for three separate experiments performed in triplicate and are expressed as a -fold increase relative to the non-treated cells. C, U937 cells were treated with 5 µg/ml actinomycin D (Act D) in the presence or absence of BAY 43-9006 (10 µM) for 2 and 4 h, after which cells lysates were prepared and subjected to Western blot analysis to monitor Mcl-1 protein level. Each lane was loaded with 20 µg of protein; blots were subsequently reprobed with antibodies directed against tubulin to control for equal loading and transfer of proteins; two additional experiments yielded similar results.

 
BAY 43-9006 Down-regulates Mcl-1 through Inhibition of Translation—Because Mcl-1 protein has a short half-life and is known to be degraded by the proteasome system (47, 48), we first investigated whether Mcl-1 ubiquitination was modified by treatment with BAY 43-9006. Immunoprecipitation followed by Western blot analysis (Fig. 7A) revealed no major changes in Mcl-1 ubiquitination in BAY 43-9006-treated U937 cells after 30 min, 1 h, or 4 h, whereas the total level of Mcl-1 protein displayed a progressive decline. In contrast, 1 µM MG132 resulted in a profound increase in Mcl-1 ubiquitination. These findings suggest, albeit indirectly, that Mcl-1 degradation by the proteasome system may not be enhanced by BAY 43-9006. To test in a more direct way whether BAY 43-9006 decreases Mcl-1 stability, we hypothesized that if this were the case, then BAY 43-9006 should accelerate Mcl-1 elimination under conditions in which translation is blocked by a protein synthesis inhibitor such as cycloheximide. As shown in Fig. 7B, although cycloheximide by itself reduced Mcl-1 protein levels, there was no discernible effect on the rate or extent of Mcl-1 down-regulation following the addition of BAY 43-9006. In contrast, cycloheximide, either alone or in combination with BAY 43-9006, had no effect on tubulin protein levels. Consistent with these findings, the stability of Mcl-1 protein in cells prelabeled with [35S]methionine was not diminished following treatment with BAY 43-9006 (Fig. 7C). More importantly, and consistent with previous studies, including ours (47, 48), blockade of proteasome system by 1 µM MG132 resulted in a time-dependent accumulation of Mcl-1. However, this phenomenon was completely abrogated by concomitant addition of 10 µM BAY 43-9006 (Fig. 8A). Furthermore, consistent with blockade of Mcl-1 protein synthesis by BAY 43-9006, 1 µM MG132 was unable to prevent Mcl-1 down-regulation in U937 cells pretreated for 30 min with BAY 43-9006 (Fig. 8B). In addition, measurement of protein synthesis by [35S]methionine incorporation (Fig. 8C) revealed that BAY 43-9006 inhibited Mcl-1 protein synthesis in a dose-dependent manner, whereas no major changes were observed in protein synthesis of the housekeeping genes hsp90 and tubulin.



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 7.
Treatment with BAY 43-9006 does not decrease Mcl-1 protein stability in U937 cells. A, U937 cells were treated with 10 µM BAY 43-9006 for the designated periods after which cells were lysed and subjected to immunoprecipitation using anti-Mcl-1 antibodies. The immunoprecipitates were then subjected to Western blot analysis using anti-ubiquitin or Mcl-1 antibodies. B, U937 cells were pretreated with 10 µg/ml cycloheximide (CHX) for 30 min then exposed to 10 µM BAY 43-9006 for the designated periods, after which protein lysates were prepared and subjected to Western blot analysis to monitor Mcl-1 protein level. C, U937 cells were labeled with [35S]methionine as described in detail under "Materials and Methods" and chased for the designated periods in the presence or absence of BAY 43-9006. At the end of the indicated intervals, cells were lysed and Mcl-1 protein was immunoprecipitated using Mcl-1 antibodies. The immunoprecipitates were subjected to SDS-PAGE followed by autoradiography. Alternatively, the immunoprecipitates were subjected to Western blot analysis using Mcl-1 antibodies. For each experiment, the blots shown are representative of three separate experiments.

 
Finally, the effects of BAY 43-9006 on Mcl-1 protein synthesis were examined under conditions in which proteasome function was inhibited by MG132. These studies yielded several findings. First, BAY 43-9006 markedly decreased the extent of [35S]methionine incorporation into Mcl-1 in the presence of MG132, arguing against the possibility that proteasomal degradation was responsible for diminished methionine uptake (Fig. 8D). Moreover, in the absence of MG132, BAY 43-9006 largely down-regulated total Mcl-1 levels, whereas MG132 resulted in a clear increase, presumably by opposing proteasomal degradation. However, co-administration of BAY 43-9006 and MG132 resulted in no change in total Mcl-1 levels, consistent with the concepts that (a) BAY 43-9006 blocks MG132-mediated Mcl-1 accumulation by preventing new synthesis and (b) MG132 opposes BAY 43-9006-mediated Mcl-1 down-regulation by preventing degradation of already synthesized Mcl-1. Together, these findings argue strongly that BAY 43-9006-mediated Mcl-1 down-regulation stems from a blockade of protein synthesis rather than diminished Mcl-1 protein stability. Taken in conjunction with the observation that BAY 43-9006 exerted minimal effects on Mcl-1 promoter activity and mRNA levels, these findings indicate that this compound primarily inhibits Mcl-1 translation.

Treatment with BAY 43-9006 Results in Striking Dephosphorylation of the eIF4E Protein—Protein synthesis is primarily controlled at the initiation phase in which assembly of eIF4F represents a critical step (49, 50). To investigate further mechanisms by which BAY 43-9006 might inhibit Mcl-1 translation, we examined the status of the initiation complex eIF4F, which consists of eIF4E (a mRNA cap-binding protein), eIF4G (a scaffolding protein), and eIF4A (an ATP-dependent RNA helicase). As shown in Fig. 9A, treatment with BAY 43-9006 resulted in a rapid and striking suppression of eIF4E protein phosphorylation, which persisted over the entire treatment interval. On the other hand, levels of total eIF4E protein remained unchanged following BAY 43-9006 treatment. In contrast to eIF4E, levels of both total and phosphorylated eIF4G were increased following treatment with BAY 43-9006, whereas phosphorylation of the eIF4E-binding protein 1 exhibited no major changes over the initial 4 h of treatment, although phosphorylation declined slightly at later intervals.

To test whether BAY 43-9006 has an effect on the eIF4F assembly and cap structure recognition process, eIF4E and associated factors were isolated with m7-GTP-Sepharose and subjected to Western blot analysis. As shown in Fig. 9B, BAY 43-9006 did not affect the ability of eIF4E to recognize m7-GTP, which mimics the mRNA cap structure, nor did it modify eIF4E and eIF4G binding. This observation is in agreement with previous studies demonstrating that eIF4E dephosphorylation does not diminish its ability to recognize the mRNA cap structure (51).

It has been shown recently that phosphorylation of eIF4E enhances the expression of cyclin D1 by potentiating cyclin D1 mRNA nucleocytoplasmic transport (52). Consequently, attempts were made to determine whether dephosphorylation of eIF4E might be involved in Mcl-1 down-regulation. As shown in Fig. 9C, transfection of K562 cells with constitutively active MNK1 (CA-MNK1), an eIF4E kinase, alone or together with eIF4E resulted in a pronounced increase in phosphorylated eIF4E protein levels. Interestingly, treatment with BAY 43-9006 potently inhibited eIF4E phosphorylation in cells in which phosphorylation of eIF4E was enforced by ectopic expression of CA-MNK1 and/or eIF4E. Notably, induction of constitutively active MEK1 failed to prevent BAY 43-9006 mediated eIF4E dephosphorylation (Fig. 9D). Finally, BAY 43-9006 continued to suppress eIF4E phosphorylation in the presence of the phosphatase inhibitor okadaic acid (data not shown), arguing against the possibility that BAY 43-9006 accelerates eIF4E dephosphorylation by activating PP2A, a protein phosphatase that has been implicated in eIF4E dephosphorylation (53). Together these observations suggest that BAY 43-9006 potently suppresses eIF4E phosphorylation through a MEK/ERK-independent mechanism, and raise the possibility that this phenomenon may be involved in inhibition of Mcl-1 translation. Whether BAY 43-9006 directly inhibits the activity of MNK1 or other unknown eIF4E kinases remains to be determined.



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 8.
Treatment with BAY 43-9006 inhibits Mcl-1 translation in U937 cells. A, U937 cells were exposed to 1 µM MG132 in the presence or absence of 10 µM BAY 43-9006 for the designated periods, after which protein lysates were prepared and subjected to Western blot analysis to monitor Mcl-1 protein level. B, U937 cells were exposed to 1 µM MG132 alone, MG132, and BAY 43-9006 (Bay) added simultaneously or treated for 30 min with BAY 43-9006 before adding MG132. After 4 h of treatment, cells were lysed, and Western blot performed as above. In all cases, lanes were loaded with 20 µg of protein, and the blots were reprobed with anti-tubulin antibodies to ensure equivalent loading and transfer. C, U937 cells were treated with the designated concentrations of BAY 43-9006 for 1 h, then radiolabeled with [35S]methionine for 2 h. At the end of the indicated intervals cells were lysed and Mcl-1, tubulin, and hsp90 proteins were immunoprecipitated. The immunoprecipitates were subjected to SDS-PAGE followed by autoradiography. D, U937 cells were treated with 10 µM BAY 43-9006 and 1 µM MG132 individually or in combination for 2 h, and then pulsed with [35S]methionine for an additional 2 h. The cells were subsequently lysed, and protein lysates were subjected to immunoprecipitation using Mcl-1 antibodies followed by electrophoresis and autoradiography. Alternatively the immunoprecipitates were subjected to Western blot analysis using Mcl-1 antibodies. The blots shown are representative of three separate experiments.

 



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 9.
Exposure to BAY 43-9006 is associated with the potent dephosphorylation of the eIF4E translation initiation factor. A, U937 cells were exposed to 10 µM BAY 43-9006 for the indicated periods after which protein lysates were prepared and subjected to Western blot analysis using the indicated antibodies (CF = cleavage fragment). B, U937 cells were treated with 10µM BAY 43-9006 for 2 or 4 h after which eIF4E was pulled down using m7-GTP-Sepharose column as described under "Materials and Methods," and subjected to Western blot analysis using eIF4E and eIF4G antibodies. C, K562 cells were transiently transfected with pSR{alpha} empty vector, HA-eIF4E, or myc-CA-MNK1 plasmids, cultured for 20 h, and then treated with 6 µM BAY 43-9006 for 4 h, after which protein lysates were prepared and subjected to Western blot analysis using designated antibodies. D, Jurkat cells inducibly expressing constitutively active MEK1 were left untreated or treated for 24 h with 2 µg/ml doxycycline and then exposed to 10 µM BAY 43-9006 for an additional 4 h, after which cells were lysed and a Western blot was performed to monitor phospho-eIF4E levels. The blots were subsequently reprobed with antibody directed against {alpha}-tubulin to control for equal loading and transfer of proteins. The blots shown are representative of three separate experiments.

 
Enforced Expression of Mcl-1 Substantially Blocks BAY 43-9006-mediated Mitochondrial Injury, Caspase Activation, and Apoptosis in Human Leukemia Cells—To determine whether down-regulation of Mcl-1 protein plays a functional role in BAY 43-9006-induced apoptosis, U937 cells were stably transfected with an Mcl-1 construct. Two separate clones, Mcl-14 and Mcl-16, which displayed 2- to 3-fold increases in Mcl-1 protein levels compared with empty vector control cells (pCEP4, Fig. 10A), were employed. Significantly, apoptosis monitored after 24- and 48-h exposure to 10 µM BAY 43-9006 was substantially attenuated in both Mcl-14 and Mcl-16 cells compared with their empty vector counterpart (pCEP4) (p < 0.001 in each case; Fig. 10B). Western blot analysis revealed that, although BAY 43-9006 reduced protein levels of Mcl-1 in both clones, as one would expect of an inhibitor of translation, Mcl-1 expression in treated mutant cells was comparable to that of untreated empty vector cells (Fig. 10C).



View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 10.
Enforced expression of Mcl-1 blocks BAY 43-9006-mediated apoptosis in U937 cells. A, protein lysates were prepared from two clones (Mcl-14 and Mcl-16) of U937 cells ectopically expressing Mcl-1 or an empty vector (pCEP4), and subjected to Western blot analysis using Mcl-1 antibody. B, Mcl-14, Mcl-16, and the empty vector pCEP4 cells were exposed to 10 µM BAY 43-9006 for 24 and 48 h, after which the extent of apoptosis was determined using annexin V staining assay. Values represent the means for three separate experiments ± S.D. *, significantly lower than values for empty vector pCEP4 cells (p < 0.001 in each case). Alternatively, total cells lysates (C) were prepared after 4 h of treatment and subjected to Western blot analysis to monitor Mcl-1 protein level. D, K562 cells were transiently transfected with pcDNA3.1 or pcDNA3.1-Mcl-1 plasmids, cultured for 20 h, then treated with 6 µM BAY 43-9006 for 4 and 8 h, after which protein lysate were prepared and subjected to Western blot analysis using Mcl-1 antibody as above. The blots were subsequently reprobed with antibodies directed against {alpha}-tubulin to control for equal loading and transfer of proteins. The blots shown are representative of three separate experiments. Annexin V staining was also performed at 24 h of treatment to determine the extent of cell death (E). Values represent the means for three separate experiments ± S.D. *, significantly lower than values for empty vector pcDNA3.1 cells (p < 0.001). F and G, Mcl-14, Mcl-16, and pCEP4 cells were exposed to 10 µM BAY 43-9006 for 24 h (F) or the designated intervals (G), after which cytosolic fractions (F) or total cell lysates (G) were prepared and subjected to Western blot analysis. Each lane was loaded with 20 µg of protein. Blots were subsequently reprobed with antibody directed against tubulin to control for equal loading and transfer of proteins. Two additional experiments yielded similar results.

 
To investigate whether Mcl-1 down-regulation also plays a functional role in BAY 43-9006-mediated lethality in Bcr-abl+ cells, transient and stable transfection approaches were employed. First, K562 cells were transiently transfected with an Mcl-1 construct. As shown in Fig. 10D, cells transfected with Mcl-1 construct displayed a robust increase in Mcl-1 protein level compared with controls transfected with the empty vector (pcDNA3.1). Analogous to results obtained in U937 cells, exposure to BAY 43-9006 resulted in a marked decrease in Mcl-1 protein level in empty vector cells; however, levels of Mcl-1 in Mcl-1-transfected cells remained higher than those of untreated empty vector controls. Notably, a significant reduction in BAY 43-9006-mediated lethality was observed in Mcl-1-transfected cells (Fig. 10E, p < 0.02). Parallel studies were carried out in K562 cells stably transfected with an Mcl-1 construct, and virtually identical protection from BAY 43-9006-mediated lethality was noted (data not shown). Finally, an attempt was made to investigate whether Mcl-1 overexpression prevents BAY 43-9006-mediated mitochondrial injury and caspase activation. As shown in Fig. 10F, release of cytochrome c into the cytosol was completely abrogated in Mcl-1-overexpressing U937 cells. In addition, exposure to BAY 43-9006 for 8, 16, and 24 h failed to promote caspase-9 cleavage and resulted only in minimal cleavage of caspase-3 and -7, and PARP degradation in these cells (Fig. 10G). In contrast, pronounced cytochrome c release, and marked cleavage of caspase-7, -9, and -3 as well as PARP degradation were observed in empty vector controls (pCEP4). Together, these findings support the notion that elimination of Mcl-1 is required for BAY 43-9006 to promote mitochondrial injury, caspase activation, and apoptosis in human leukemia cells.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The results of the present study indicate that treatment with BAY 43-9006, an agent currently undergoing phase II/III clinical evaluation (1820), results in a striking increase in mitochondrial injury, caspase activation, and apoptosis in human leukemia cells, events that are associated with inactivation of the MEK/ERK pathway. Furthermore, this agent was effective in inducing cell death in multiple leukemia cell lines, including those expressing the Bcr-abl oncogene, as well as in primary AML blasts. Notably, the present studies demonstrate that treatment of such cells with BAY 43-9006 results in a marked decrease in Mcl-1 protein levels through inhibition of translation and that this event plays an important functional role in BAY 43-9006-mediated lethality.

In view of extensive evidence that Mcl-1 plays a critical role in the survival of malignant hematopoietic cells, including leukemia and myeloma cells (24, 25), the development of compounds that diminish Mcl-1 protein levels has been the focus of intense interest. Indeed, a number of studies have documented down-regulation of Mcl-1 protein during apoptosis induced by a variety of agents, including, UV, {gamma}-irradiation, etoposide, staurosporine, STI-571, and growth factor withdrawal (28, 31, 54, 55) among others. Interestingly, several cyclin-dependent kinase inhibitors, such as flavopiridol and roscovitine, also down-regulate Mcl-1 expression in leukemia and myeloma cells (56, 57). This phenomenon may reflect the capacity of these agents to inhibit RNA polymerase II, and thus to act as transcriptional repressors (56, 58). The present results reveal that BAY 43-9006 induces a rapid and sharp decline in Mcl-1 protein levels. A critical question then arises regarding the mechanism by which Mcl-1 down-regulation occurs. In this regard, Mcl-1 protein levels are known to be regulated through several different mechanisms, including those operating at the transcriptional, translational, and post-translational levels.

It has been shown that Mcl-1, like other Bcl-2 family members, can be the target of degradation by caspase-3 (29, 59). However, the findings, that decreases in Mcl-1 protein levels substantially preceded activation of caspases and that Mcl-1 down-regulation was not attenuated by caspase inhibition, argue strongly against this possibility. It has also been reported that interruption of the MEK/ERK pathway by pharmacologic MEK inhibitors (e.g. PD98059) diminish Mcl-1 basal levels (42) and attenuate Mcl-1 protein accumulation in response to various cytokines (32, 33). Consequently, the possibility that BAY 43-9006 down-regulates Mcl-1 protein levels through MEK/ERK inactivation appeared plausible. However, the inability of enforced activation of MEK/ERK to prevent Mcl-1 down-regulation suggests that BAY 43-9006 down-regulates Mcl-1 protein levels through a MEK/ERK-independent pathway.

Several studies have implicated diverse transcriptional factors in the control of Mcl-1 gene expression. For example, E2F1 binds to and represses Mcl-1 promoter activity (46). It has also been reported that activation of Mcl-1 gene transcription in response to interleukin-3 is mediated through CREB and ETS transcription factors (44, 45). In the present study, using real-time PCR, we found that BAY 43-9006 failed to decrease substantially Mcl-1 mRNA levels. Furthermore, results of actinomycin D studies, in which BAY 43-9006 decreased Mcl-1 expression despite inhibition of transcription, as well as luciferase gene reporter assays, were most compatible with transcription-independent effects. Collectively, these findings argue against the possibility that BAY 43-9006 down-regulates Mcl-1 protein through promoter activity repression or mRNA destabilization.

Another major mechanism by which Mcl-1 protein level can be regulated is degradation by the proteasome system (28, 47, 48). Consistent with these findings, pharmacologic inhibition of the proteasome function by MG132 resulted in marked Mcl-1 protein accumulation. Significantly, however, MG132 failed to induce Mcl-1 accumulation in the presence of BAY 43-9006. Moreover, MG132 was unable to prevent down-regulation of Mcl-1 in U937 cells when these cells were pretreated with BAY 43-9006. Notably, treatment with BAY 43-9006 did not accelerate the clearance of Mcl-1 protein after inhibition of protein synthesis by cycloheximide, nor did BAY 43-9006 enhance the degradation/loss of pre-existing Mcl-1 protein in cells pre-labeled with [35S]methionine, suggesting that BAY 43-9006 does not affect the stability of already synthesized Mcl-1. Consistent with this notion, BAY 43-9006 prevented the accumulation of Mcl-1 in cells exposed to the proteasome inhibitor MG132, presumably by blocking new synthesis. Thus, in cells co-exposed to BAY 43-9006 and MG132, the effects of concomitant inhibition of protein synthesis and proteasomal degradation effectively counteracted each other, resulting in no change in total protein levels. Collectively, these findings argue strongly against the possibility that BAY 43-9006 acts at the post-translational level to diminish Mcl-1 protein stability. This interpretation is also consistent with the failure of BAY 43-9006 to significantly enhance Mcl-1 ubiquitination, a phenomenon that precedes degradation by the proteasome system (54).

Having ruled out a significant role for altered Mcl-1 transcription, the stability of mRNA, or the stability of the protein, the major remaining possibility is that translation of Mcl-1 must decrease in cells exposed to BAY 43-9006. Indeed, as noted above, assessment of protein synthesis revealed a marked inhibition of Mcl-1 translation following exposure to BAY 43-9006. Diminished Mcl-1 translation has been implicated in Mcl-1 down-regulation in several systems, including HeLa cells exposed to UV (28) and Jurkat cells exposed to salicylate (54), although the precise mechanism underlying these actions remains to be elucidated. In general, translation is primarily regulated at the initiation phase, a multistep process orchestrated by a several initiation factors. Translation of most of mRNAs is dependent upon the cap structure m7-GTP which is found at the 5' terminus of all cellular eukaryotic mRNAs. The initiation complex eIF4F, a heterotrimeric protein composed of eIF4E, eIF4G, and eIF4A, plays a critical role in the translation of these mRNAs. eIF4E, also known as the cap-binding protein, represents the rate-limiting member of the eIF4F complex and binds directly to the 5'-terminal m7-GTP cap, resulting in recruitment of ribosomes to the 5'-end of mRNA transcripts. In addition, emerging evidence indicates that eIF4E is an important target of translation regulation through several functional post-translational modifications, including phosphorylation and ubiquitination (61, 62). Increased expression of eIF4E has been observed in various human cancer cells (63) and is associated with increased translation of several mRNAs, including Bcl-xL, ornithine decarboxylase, and c-myc, among others (64). Although the role of eIF4E phosphorylation in translation initiation is incompletely understood, it has recently been shown to enhance expression of cyclin D1 by increasing mRNA nucleocytoplasmic transport (65), suggesting that, for at least some mRNAs, eIF4E phosphorylation promotes translation. In this context, it is noteworthy that BAY 43-9006 rapidly and potently suppressed phosphorylation of eIF4E, although no apparent effect on eIF4F assembly or m7-GTP affinity could be detected. A clearer characterization of the functional role of eIF4E dephosphorylation in disruption of Mcl-1 translation by BAY 43-9006, as well as the possible participation of additional translation initiation factors (e.g. eIF2{alpha}), await further study.

The control of translation has also been linked to various signal transduction cascades. For example, eIF4E is known to be phosphorylated by MAP kinase-interacting kinases MNK1 and MNK2, factors that lie downstream of MEK/ERK1–2 and p38 MAP kinases (37, 66). Interestingly, enforced expression of constitutively active MEK1 or MNK1 failed to prevent BAY 43-9006-mediated suppression of eIF4E phosphorylation. Significantly, enforced activation of these kinases also failed to block BAY 43-9006-induced Mcl-1 down-regulation. Although the mechanism by which BAY 43-9006 suppresses eIF4E phosphorylation and the functional role of this phenomenon in Mcl-1 down-regulation remain to be determined, these data suggest that in addition to its well characterized role in Raf/MEK/ERK inhibition, BAY 43-9006 may also modify translation initiation factors independently of its effects on this signaling cascade to disrupt Mcl-1 translation. It should be noted that such translation initiation factors are not selective for Mcl-1 translation. However, because the half-lives of Mcl-1 mRNA and protein are relatively short (e.g. 2.5 h and 30 min, respectively) (67, 68), interference with Mcl-1 synthesis is likely to have a major effect on protein levels. Finally, other signaling cascades (e.g. p90RSK, mTOR, and p70S6K), including those related to stress responses (e.g. p38), have been linked to the regulation of protein synthesis (6971). However, the data presented here argue that these factors are unlikely to be primarily involved in BAY 43-9006 mediated Mcl-1 down-regulation. Nevertheless, the possibility that other stress-related pathways (e.g. PKR-like endoplasmic reticulum kinase) may be implicated in the inhibition of Mcl-1 translation by BAY 43-9006 cannot be completely excluded, and such pathways are currently the subject of ongoing investigation.

It is significant that enforced expression of Mcl-1 markedly diminished BAY 43-9006-mediated lethality in both U937 and K562 cells, arguing that down-regulation of this protein played a critical functional role in BAY 43-9006 lethality. In accord with this notion, Mcl-1 overexpression largely inhibited caspase activation and release of cytochrome c into the cytosol. These findings are consistent with the studies described by Nijhawan et al. (28), who demonstrated that Mcl-1 operates upstream of Bax and Bcl-xL translocation to the mitochondria, cytochrome c release, and caspase activation in UV-treated HeLa cells. Interestingly, in this study, a decline in Mcl-1 protein was not sufficient by itself to induce apoptosis, suggesting that one or more additional perturbations are involved in lethality. Similar results have been observed in Jurkat cells (54). However, other studies have demonstrated that down-regulation of Mcl-1 through the use of antisense oligonucleotides or small interference RNA is sufficient to induce apoptosis in U937 (24) and myeloma cells (30, 72, 60). In the present study, it should be noted that Mcl-1 overexpression did not completely block BAY 43-9006-induced lethality. Consequently, the possibility that other BAY 43-9006-mediated actions contribute to induction of apoptosis cannot be completely excluded. In summary, the present findings indicate that the Raf inhibitor BAY 43-9006 effectively induces cell death in Bcr/Abl+ or Bcr/Abl human leukemia cells, as well as in primary AML blasts. Furthermore, these events occur in association with the rapid down-regulation of Mcl-1 primarily through inhibition of translation, rather than through a transcriptional or post-translational mechanism. Moreover, this phenomenon is associated with the rapid and potent dephosphorylation of the eIF4E translation initiation factor, which has been implicated in protein synthesis regulation. Significantly, enforced expression of Mcl-1 was able to block cytochrome c release, caspase activation, and apoptosis in U937 and K562 cells exposed to BAY 43-9006, arguing that down-regulation of this anti-apoptotic protein plays a critical functional role in the lethality of this agent. Although previous studies have focused on the inhibitory effects of BAY 43-9006 on the Raf/MEK/ERK pathway as the possible basis of action of this compound (2), the finding that BAY 43-9006 promotes apoptosis through the MEK/ERK-independent inhibition of Mcl-1 translation suggests an additional dimension to its mode of cell killing, at least in human leukemia cells. Further efforts to elucidate the mechanism(s) by which BAY 43-9006 inhibits translation of anti-apoptotic protein Mcl-1, and the possible role of disruption of translation initiation factors in this process, could provide a more rational basis for developing this compound either alone or in combination with established chemotherapeutic agents in leukemia and potentially other hematologic malignancies.


    FOOTNOTES
 
* This work was supported by Public Health Service Grants CA-63753, CA-93738, CA-100866, and CA-88906 from NCI, National Institutes of Health (NIH), Grant DK52825 from NIH, Award 6045-03 from the Leukemia and Lymphoma Society of America, Award DAMD 17-03-1-0209 from the Department of Defense, and a Translational Research award from the V-foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Division of Hematology/Oncology, MCV Station Box 230, VA Commonwealth University, Richmond, VA 23298. Tel.: 804-828-5211; Fax: 804-828-8079; E-mail: stgrant{at}hsc.vcu.edu.

2 The abbreviations used are: MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase; ERK, extracellular signal-regulated kinase; AML, acute myeloid leukemia; Mcl-1, myeloid cell leukemia-1; PARP, poly(ADP-ribose) polymerase; z-VAD-FMK, benzyloxycarbonyl-VAD-fluoromethyl ketone; HA, hemagglutinin; JNK, c-Jun N-terminal kinase; mTOR, mammalian target of rapamycin; CA, constitutively active; AIF, apoptosis inducing factor; FAB, French-American-British. Back


    ACKNOWLEDGMENTS
 
We thank Dr. Ruth Craig for providing the Mcl-1-overexpresing U937 cells and the pcDNA3.1-Mcl-1 plasmid, Drs. Mark Lynch (Bayer) and John Wright (Cancer Treatment and Evaluation Program, NCI, National Institutes of Health) for critical reading of the manuscript and providing us with BAY 43-9006, Dr. J. A. Cooper for providing us with CA-MNK1 and eIF4E constructs, and Dr. Douglas Cress (H. Lee Moffitt Cancer Center) for providing us with the (–203/+10) Mcl-1-pGL2 plasmid.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Chang, F., Steelman, L. S., Lee, J. T., Shelton, J. G., Navolanic, P. M., Blalock, W. L., Franklin, R. A., and McCubrey, J. A. (2003) Leukemia 17, 1263–1293[CrossRef][Medline] [Order article via Infotrieve]
  2. Sridhar, S. S., Hedley, D., and Siu, L. L. (2005) Mol. Cancer Ther. 4, 677–685[Abstract/Free Full Text]
  3. Davies, H., Bignell, G. R., Cox, C., Stephens, P., Edkins, S., Clegg, S., Teague, J., Woffendin, H., Garnett, M. J., Bottomley, W., Davis, N., Dicks, E., Ewing, R., Floyd, Y., Gray, K., Hall, S., Hawes, R., Hughes, J., Kosmidou, V., Menzies, A., Mould, C., Parker, A., Stevens, C., Watt, S., Hooper, S., Wilson, R., Jayatilake, H., Gusterson, B. A., Cooper, C., Shipley, J., Hargrave, D., Pritchard-Jones, K., Maitland, N., Chenevix-Trench, G., Riggins, G. J., Bigner, D. D., Palmieri, G., Cossu, A., Flanagan, A., Nicholson, A., Ho, J. W., Leung, S. Y., Yuen, S. T., Weber, B. L., Seigler, H. F., Darrow, T. L., Paterson, H., Marais, R., Marshall, C. J., Wooster, R., Stratton, M. R., and Futreal, P. A. (2002) Nature 417, 949–954[CrossRef][Medline] [Order article via Infotrieve]
  4. Pollock, P. M., Harper, U. L., Hansen, K. S., Yudt, L. M., Stark, M., Robbins, C. M., Moses, T. Y., Hostetter, G., Wagner, U., Kakareka, J., Salem, G., Pohida, T., Heenan, P., Duray, P., Kallioniemi, O., Hayward, N. K., Trent, J. M., and Meltzer, P. S. (2003) Nat. Gene 33, 19–20[CrossRef][Medline] [Order article via Infotrieve]
  5. Rajagopalan, H., Bardelli, A., Lengauer, C., Kinzler, K. W., Vogelstein, B., and Velculescu, V. E. (2002) Nature 418, 934[CrossRef][Medline] [Order article via Infotrieve]
  6. Singer, G., Oldt, R., III, Cohen, Y., Wang, B. G., Sidransky, D., Kurman, R. J., and Shih, I. (2003) J. Natl. Cancer Inst. 95, 484–486[Abstract/Free Full Text]
  7. Cohen, Y., Xing, M., Mambo, E., Guo, Z., Wu, G., Trink, B., Beller, U., Westra, W. H., Ladenson, P. W., and Sidransky, D. (2003) J. Natl. Cancer Inst. 95, 625–627[Abstract/Free Full Text]
  8. Kerkhoff, E., and Rapp, U. R. (1997) Mol. Cell. Biol. 17, 2576–2586[Abstract]
  9. Kang, C. D., Yoo, S. D., Hwang, B. W., Kim, K. W., Kim, D. W., Kim, C. M., Kim, S. H., and Chung, B. S. (2000) Leuk. Res. 24, 527–534[CrossRef][Medline] [Order article via Infotrieve]
  10. Okuda, K., Matulonis, U., Salgia, R., Kanakura, Y., Druker, B., and Griffin, J. D. (1994) Exp. Hematol. 22, 1111–1117[Medline] [Order article via Infotrieve]
  11. Hoyle, P. E., Moye, P. W., Steelman, L. S., Blalock, W. L., Franklin, R. A., Pearce, M., Cherwinski, H., Bosch, E., McMahon, M., and McCubrey, J. A. (2000) Leukemia 14, 642–656[CrossRef][Medline] [Order article via Infotrieve]
  12. Blalock, W. L., Pearce, M., Steelman, L. S., Franklin, R. A., McCarthy, S. A., Cherwinski, H., McMahon, M., and McCubrey, J. A. (2000) Oncogene 19, 526–536[CrossRef][Medline] [Order article via Infotrieve]
  13. Poruchynsky, M. S., Giannakakou, P., Ward, Y., Bulinski, J. C., Telford, W. G., Robey, R. W., and Fojo, T. (2001) Biochem. Pharmacol. 62, 1469–1480[CrossRef][Medline] [Order article via Infotrieve]
  14. Dai, Y., Yu, C., Singh, V., Tang, L., Wang, Z., McInistry, R., Dent, P., and Grant, S. (2001) Cancer Res. 61, 5106–5115[Abstract/Free Full Text]
  15. Yu, C., Krystal, G., Varticovksi, L., McKinstry, R., Rahmani, M., Dent, P., and Grant, S. (2002) Cancer Res. 62, 188–199[Abstract/Free Full Text]
  16. Orlowski, R. Z., Small, G. W., and Shi, Y. Y. (2002) J. Biol. Chem. 277, 27864–27871[Abstract/Free Full Text]
  17. Wu, J., Wong, W. W., Khosravi, F., Minden, M. D., and Penn, L. Z. (2004) Cancer Res. 64, 6461–6468[Abstract/Free Full Text]
  18. Strumberg, D., and Seeber, S. (2005) Onkologie 28, 101–107[Medline] [Order article via Infotrieve]
  19. Ahmad, T., and Eisen, T. (2004) Clin. Cancer Res. 10, 6388S–6392S[Abstract/Free Full Text]
  20. Kramer, B. W., Gotz, R., and Rapp, U. R. (2004) BMC Cancer 4, 24[CrossRef][Medline] [Order article via Infotrieve]
  21. Wilhelm, S. M., Carter, C., Tang, L., Wilkie, D., McNabola, A., Rong, H., Chen, C., Zhang, X., Vincent, P., McHugh, M., Cao, Y., Shujath, J., Gawlak, S., Eveleigh, D., Rowley, B., Liu, L., Adnane, L., Lynch, M., Auclair, D., Taylor, I., Gedrich, R., Voznesensky, A., Riedl, B., Post, L. E., Bollag, G., and Trail, P. A. (2004) Cancer Res. 64, 7099–7109[Abstract/Free Full Text]
  22. Karasarides, M., Chiloeches, A., Hayward, R., Niculescu-Duvaz, D., Scanlon, I., Friedlos, F., Ogilvie, L., Hedley, D., Martin, J., Marshall, C. J., Springer, C. J., and Marais, R. (2004) Oncogene 23, 6292–6298[CrossRef][Medline] [Order article via Infotrieve]
  23. Sharma, A., Trivedi, N. R., Zimmerman, M. A., Tuveson, D. A., Smith, C. D., and Robertson, G. P. (2005) Cancer Res. 65, 2412–2421[Abstract/Free Full Text]
  24. Moulding, D. A., Giles, R. V., Spiller, D. G., White, M. R., Tidd, D. M., and Edwards, S. W. (2000) Blood 96, 1756–1763[Abstract/Free Full Text]
  25. Opferman, J. T., Iwasaki, H., Ong, C. C., Suh, H., Mizuno, S., Akashi, K., and Korsmeyer, S. J. (2005) Science 307, 1101–1104[Abstract/Free Full Text]
  26. Opferman, J. T., Letai, A., Beard, C., Sorcinelli, M. D., Ong, C. C., and Korsmeyer, S. J. (2003) Nature 426, 671–676[CrossRef][Medline] [Order article via Infotrieve]
  27. Zhou, P., Qian, L., Bieszczad, C. K., Noelle, R., Binder, M., Levy, N. B., and Craig, R. W. (1998) Blood 92, 3226–3239[Abstract/Free Full Text]
  28. Nijhawan, D., Fang, M., Traer, E., Zhong, Q., Gao, W., Du, F., and Wang, X. (2003) Genes Dev. 17, 1475–1486[Abstract/Free Full Text]
  29. Weng, C., Li, Y., Xu, D., Shi, Y., and Tang, H. (2005) J. Biol. Chem. 280, 10491–10500[Abstract/Free Full Text]
  30. Zhang, B., Gojo, I., and Fenton, R. G. (2002) Blood 99, 1885–1893[Abstract/Free Full Text]
  31. Zhou, P., Qian, L., Kozopas, K. M., and Craig, R. W. (1997) Blood 89, 630–643[Abstract/Free Full Text]
  32. Huang, H. M., Huang, C. J., and Yen, J. J. (2000) Blood 96, 1764–1771[Abstract/Free Full Text]
  33. Leu, C. M., Chang, C., and Hu, C. (2000) Oncogene 19, 1665–1675[CrossRef][Medline] [Order article via Infotrieve]
  34. Rahmani, M., Yu, C., Reese, E., Ahmed, W., Hirsch, K., Dent, P., and Grant, S. (2003) Oncogene 22, 6231–6242[CrossRef][Medline] [Order article via Infotrieve]
  35. Rahmani, M., Dai, Y., and Grant, S. (2002) Exp. Cell Res. 277, 31–47[CrossRef][Medline] [Order article via Infotrieve]
  36. Dai, Y., Rahmani, M., Corey, S. J., Dent, P., and Grant, S. (2004) J. Biol. Chem. 279, 34227–34239[Abstract/Free Full Text]
  37. Waskiewicz, A. J., Johnson, J. C., Penn, B., Mahalingam, M., Kimball, S. R., and Cooper, J. A. (1999) Mol. Cell. Biol. 19, 1871–1880[Abstract/Free Full Text]
  38. Rahmani, M., Reese, E., Dai, Y., Bauer, C., Kramer, L. B., Huang, M., Jove, R., Dent, P., and Grant, S. (2005) Mol. Pharmacol. 67, 1166–1176[Abstract/Free Full Text]
  39. Croxton, R., Ma, Y., and Cress, W. D. (2002) Oncogene 21, 1563–1570[CrossRef][Medline] [Order article via Infotrieve]
  40. Chao, D. T., and Korsmeyer, S. J. (1998) Annu. Rev. Immunol. 16, 395–419[CrossRef][Medline] [Order article via Infotrieve]
  41. Gross, A., McDonnell, J. M., and Korsmeyer, S. J. (1999) Genes Dev. 13, 1899–1911[Free Full Text]
  42. Selzer, E., Thallinger, C., Hoeller, C., Oberkleiner, P., Wacheck, V., Pehamberger, H., and Jansen, B. (2002) Mol. Med 8, 877–884[Medline] [Order article via Infotrieve]
  43. Rahmani, M., Reese, E., Dai, Y., Bauer, C., Payne, S. G., Dent, P., Spiegel, S., and Grant, S. (2005) Cancer Res. 65, 2422–2432[Abstract/Free Full Text]
  44. Wang, J. M., Lai, M. Z., and Yang-Yen, H. F. (2003) Mol. Cell. Biol. 23, 1896–1909[Abstract/Free Full Text]
  45. Wang, J. M., Chao, J. R., Chen, W., Kuo, M. L., Yen, J. J., and Yang-Yen, H. F. (1999) Mol. Cell. Biol. 19, 6195–6206[Abstract/Free Full Text]
  46. Croxton, R., Ma, Y., Song, L., Haura, E. B., and Cress, W. D. (2002) Oncogene 21, 1359–1369[CrossRef][Medline] [Order article via Infotrieve]
  47. Dai, Y., Rahmani, M., and Grant, S. (2003) Oncogene 22, 7108–7122[CrossRef][Medline] [Order article via Infotrieve]
  48. Derouet, M., Thomas, L., Cross, A., Moots, R. J., and Edwards, S. W. (2004) J. Biol. Chem. 279, 26915–26921[Abstract/Free Full Text]
  49. Richter, J. D., and Sonenberg, N. (2005) Nature 433, 477–480[CrossRef][Medline] [Order article via Infotrieve]
  50. Proud, C. G. (2005) Cell Death. Differ. 12, 541–546[CrossRef][Medline] [Order article via Infotrieve]
  51. Knauf, U., Tschopp, C., and Gram, H. (2001) Mol. Cell. Biol. 21, 5500–5511[Abstract/Free Full Text]
  52. Topisirovic, I., Ruiz-Gutierrez, M., and Borden, K. L. (2004) Cancer Res. 64, 8639–8642[Abstract/Free Full Text]
  53. Xu, Z., and Williams, B. R. (2000) Mol. Cell. Biol. 20, 5285–5299[Abstract/Free Full Text]
  54. Iglesias-Serret, D., Pique, M., Gil, J., Pons, G., and Lopez, J. M. (2003) Arch. Biochem. Biophys. 417, 141–152[CrossRef][Medline] [Order article via Infotrieve]
  55. Aichberger, K. J., Mayerhofer, M., Krauth, M. T., Skvara, H., Florian, S., Sonneck, K., Akgul, C., Derdak, S., Pickl, W. F., Wacheck, V., Selzer, E., Monia, B. P., Moriggl, R., Valent, P., and Sillaber, C. (2005) Blood 105, 3303–3311[Abstract/Free Full Text]
  56. Gojo, I., Zhang, B., and Fenton, R. G. (2002) Clin. Cancer Res. 8, 3527–3538[Abstract/Free Full Text]
  57. Alvi, A. J., Austen, B., Weston, V. J., Fegan, C., Maccallum, D., Gianella-Borradori, A., Lane, D. P., Hubank, M., Powell, J. E., Wei, W., Taylor, A. M., Moss, P. A., and Stankovic, T. (2005) Blood 105, 4484–4491[Abstract/Free Full Text]
  58. Chao, S. H., Fujinaga, K., Marion, J. E., Taube, R., Sausville, E. A., Senderowicz, A. M., Peterlin, B. M., and Price, D. H. (2000) J. Biol. Chem. 275, 28345–28348[Abstract/Free Full Text]
  59. Han, J., Goldstein, L. A., Gastman, B. R., Froelich, C. J., Yin, X. M., and Rabinowich, H. (2004) J. Biol. Chem. 279, 22020–22029[Abstract/Free Full Text]
  60. Le Gouill, S., Podar, K., Amiot, M., Hideshima, T., Chauhan, D., Ishitsuka, K., Kumar, S., Raje, N., Richardson, P. G., Harousseau, J. L., and Anderson, K. C. (2004) Blood 104, 2886–2892[Abstract/Free Full Text]
  61. Graff, J. R., and Zimmer, S. G. (2003) Clin. Exp. Metastasis 20, 265–273[CrossRef][Medline] [Order article via Infotrieve]
  62. Othumpangat, S., Kashon, M., and Joseph, P. (2005) J. Biol. Chem. 280, 25162–25169[Abstract/Free Full Text]
  63. De Benedetti, A., and Harris, A. L. (1999) Int. J. Biochem. Cell Biol. 31, 59–72[CrossRef][Medline] [Order article via Infotrieve]
  64. Mamane, Y., Petroulakis, E., Rong, L., Yoshida, K., Ler, L. W., and Sonenberg, N 23, 3172–3179
  65. Rousseau, D., Kaspar, R., Rosenwald, I., Gehrke, L., and Sonenberg, N. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 1065–1070[Abstract/Free Full Text]
  66. Ueda, T., Watanabe-Fukunaga, R., Fukuyama, H., Nagata, S., and Fukunaga, R. (2004) Mol. Cell. Biol. 24, 6539–6549[Abstract/Free Full Text]
  67. Moulding, D. A., Akgul, C., Derouet, M., White, M. R., and Edwards, S. W. (2001) J. Leukoc. Biol. 70, 783–792[Abstract/Free Full Text]
  68. Chao, J. R., Wang, J. M., Lee, S. F., Peng, H. W., Lin, Y. H., Chou, C. H., Li, J. C., Huang, H. M., Chou, C. K., Kuo, M. L., Yen, J. J., and Yang-Yen, H. F. (1998) Mol. Cell. Biol. 18, 4883–4898[Abstract/Free Full Text]
  69. Martin, K. A., and Blenis, J. (2002) Adv. Cancer Res. 86, 1–39[Medline] [Order article via Infotrieve]
  70. Wang, X., Li, W., Williams, M., Terada, N., Alessi, D. R., and Proud, C. G. (2001) EMBO J. 20, 4370–4379[CrossRef][Medline] [Order article via Infotrieve]
  71. Hirasawa, K., Kim, A., Han, H. S., Han, J., Jun, H. S., and Yoon, J. W. (2003) J. Virol. 77, 5649–5656[Abstract/Free Full Text]
  72. Derenne, S., Monia, B., Dean, N. M., Taylor, J. K., Rapp, M. J., Harousseau, J. L., Bataille, R., and Amiot, M. (2002) Blood 100, 194–199[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
T. Kurosu, M. Ohki, N. Wu, H. Kagechika, and O. Miura
Sorafenib Induces Apoptosis Specifically in Cells Expressing BCR/ABL by Inhibiting Its Kinase Activity to Activate the Intrinsic Mitochondrial Pathway
Cancer Res., May 1, 2009; 69(9): 3927 - 3936.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Y. H. Hallaert, A. Jaspers, C. J. van Noesel, M. H. J. van Oers, A. P. Kater, and E. Eldering
c-Abl kinase inhibitors overcome CD40-mediated drug resistance in CLL: implications for therapeutic targeting of chemoresistant niches
Blood, December 15, 2008; 112(13): 5141 - 5149.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
F. Yang, T. E. Van Meter, R. Buettner, M. Hedvat, W. Liang, C. M. Kowolik, N. Mepani, J. Mirosevich, S. Nam, M. Y. Chen, et al.
Sorafenib inhibits signal transducer and activator of transcription 3 signaling associated with growth arrest and apoptosis of medulloblastomas
Mol. Cancer Ther., November 1, 2008; 7(11): 3519 - 3526.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
S. M. Wilhelm, L. Adnane, P. Newell, A. Villanueva, J. M. Llovet, and M. Lynch
Preclinical overview of sorafenib, a multikinase inhibitor that targets both Raf and VEGF and PDGF receptor tyrosine kinase signaling
Mol. Cancer Ther., October 1, 2008; 7(10): 3129 - 3140.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
M. A. Park, G. Zhang, C. Mitchell, M. Rahmani, H. Hamed, M. P. Hagan, A. Yacoub, D. T. Curiel, P. B. Fisher, S. Grant, et al.
Mitogen-activated protein kinase kinase 1/2 inhibitors and 17-allylamino-17-demethoxygeldanamycin synergize to kill human gastrointestinal tumor cells in vitro via suppression of c-FLIP-s levels and activation of CD95
Mol. Cancer Ther., September 1, 2008; 7(9): 2633 - 2648.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. Zhang, M. A. Park, C. Mitchell, H. Hamed, M. Rahmani, A. P. Martin, D. T. Curiel, A. Yacoub, M. Graf, R. Lee, et al.
Vorinostat and Sorafenib Synergistically Kill Tumor Cells via FLIP Suppression and CD95 Activation
Clin. Cancer Res., September 1, 2008; 14(17): 5385 - 5399.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
L. Dal Lago, V. D'Hondt, and A. Awada
Selected Combination Therapy with Sorafenib: A Review of Clinical Data and Perspectives in Advanced Solid Tumors
Oncologist, August 1, 2008; 13(8): 845 - 858.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. R. Shoemaker, M. J. Mitten, J. Adickes, S. Ackler, M. Refici, D. Ferguson, A. Oleksijew, J. M. O'Connor, B. Wang, D. J. Frost, et al.
Activity of the Bcl-2 Family Inhibitor ABT-263 in a Panel of Small Cell Lung Cancer Xenograft Models
Clin. Cancer Res., June 1, 2008; 14(11): 3268 - 3277.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
S. Hu, H. Niu, P. Minkin, S. Orwick, A. Shimada, H. Inaba, G. V.H. Dahl, J. Rubnitz, and S. D. Baker
Comparison of antitumor effects of multitargeted tyrosine kinase inhibitors in acute myelogenous leukemia
Mol. Cancer Ther., May 1, 2008; 7(5): 1110 - 1120.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S.-H. Kim, M. S. Ricci, and W. S. El-Deiry
Mcl-1: A Gateway to TRAIL Sensitization
Cancer Res., April 1, 2008; 68(7): 2062 - 2064.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
W. Zhang, M. Konopleva, Y.-x. Shi, T. McQueen, D. Harris, X. Ling, Z. Estrov, A. Quintas-Cardama, D. Small, J. Cortes, et al.
Mutant FLT3: A Direct Target of Sorafenib in Acute Myelogenous Leukemia
J Natl Cancer Inst, February 6, 2008; 100(3): 184 - 198.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
E. F. Lee, P. E. Czabotar, M. F. van Delft, E. M. Michalak, M. J. Boyle, S. N. Willis, H. Puthalakath, P. Bouillet, P. M. Colman, D. C.S. Huang, et al.
A novel BH3 ligand that selectively targets Mcl-1 reveals that apoptosis can proceed without Mcl-1 degradation
J. Cell Biol., January 28, 2008; 180(2): 341 - 355.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
N. Chetoui, K. Sylla, J.-V. Gagnon-Houde, C. Alcaide-Loridan, D. Charron, R. Al-Daccak, and F. Aoudjit
Down-Regulation of Mcl-1 by Small Interfering RNA Sensitizes Resistant Melanoma Cells to Fas-Mediated Apoptosis
Mol. Cancer Res., January 1, 2008; 6(1): 42 - 52.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
H.-G. Wendel, R. L.A. Silva, A. Malina, J. R. Mills, H. Zhu, T. Ueda, R. Watanabe-Fukunaga, R. Fukunaga, J. Teruya-Feldstein, J. Pelletier, et al.
Dissecting eIF4E action in tumorigenesis
Genes & Dev., December 15, 2007; 21(24): 3232 - 3237.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. W. Meng, S.-H. Lee, H. Dai, D. Loegering, C. Yu, K. Flatten, P. Schneider, N. T. Dai, S. K. Kumar, B. D. Smith, et al.
MCL-1 as a Buffer for Proapoptotic BCL-2 Family Members during TRAIL-induced Apoptosis: A MECHANISTIC BASIS FOR SORAFENIB (BAY 43-9006)-INDUCED TRAIL SENSITIZATION
J. Biol. Chem., October 12, 2007; 282(41): 29831 - 29846.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. P. Plastaras, S.-H. Kim, Y. Y. Liu, D. T. Dicker, J. F. Dorsey, J. McDonough, G. Cerniglia, R. R. Rajendran, A. Gupta, A. K. Rustgi, et al.
Cell Cycle Dependent and Schedule-Dependent Antitumor Effects of Sorafenib Combined with Radiation
Cancer Res., October 1, 2007; 67(19): 9443 - 9454.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. R. Rosato, J. A. Almenara, S. Coe, and S. Grant
The Multikinase Inhibitor Sorafenib Potentiates TRAIL Lethality in Human Leukemia Cells in Association with Mcl-1 and cFLIPL Down-regulation
Cancer Res., October 1, 2007; 67(19): 9490 - 9500.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. Rahmani, T. K. Nguyen, P. Dent, and S. Grant
The Multikinase Inhibitor Sorafenib Induces Apoptosis in Highly Imatinib Mesylate-Resistant Bcr/Abl+ Human Leukemia Cells in Association with Signal Transducer and Activator of Transcription 5 Inhibition and Myeloid Cell Leukemia-1 Down-Regulation
Mol. Pharmacol., September 1, 2007; 72(3): 788 - 795.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Rahmani, E. M. Davis, T. R. Crabtree, J. R. Habibi, T. K. Nguyen, P. Dent, and S. Grant
The Kinase Inhibitor Sorafenib Induces Cell Death through a Process Involving Induction of Endoplasmic Reticulum Stress
Mol. Cell. Biol., August 1, 2007; 27(15): 5499 - 5513.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. Dasmahapatra, N. Yerram, Y. Dai, P. Dent, and S. Grant
Synergistic Interactions between Vorinostat and Sorafenib in Chronic Myelogenous Leukemia Cells Involve Mcl-1 and p21CIP1 Down-Regulation
Clin. Cancer Res., July 15, 2007; 13(14): 4280 - 4290.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S.-R. A. Hussain, C. M. Cheney, A. J. Johnson, T. S. Lin, M. R. Grever, M. A. Caligiuri, D. M. Lucas, and J. C. Byrd
Mcl-1 Is a Relevant Therapeutic Target in Acute and Chronic Lymphoid Malignancies: Down-Regulation Enhances Rituximab-Mediated Apoptosis and Complement-Dependent Cytotoxicity
Clin. Cancer Res., April 1, 2007; 13(7): 2144 - 2150.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. W. Adams and G. M. Cooper
Rapid Turnover of Mcl-1 Couples Translation to Cell Survival and Apoptosis
J. Biol. Chem., March 2, 2007; 282(9): 6192 - 6200.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
R. R. Rosato, J. A. Almenara, S. S. Kolla, S. C. Maggio, S. Coe, M. S. Gimenez, P. Dent, and S. Grant
Mechanism and functional role of XIAP and Mcl-1 down-regulation in flavopiridol/vorinostat antileukemic interactions
Mol. Cancer Ther., February 1, 2007; 6(2): 692 - 702.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Liu, Y. Cao, C. Chen, X. Zhang, A. McNabola, D. Wilkie, S. Wilhelm, M. Lynch, and C. Carter
Sorafenib Blocks the RAF/MEK/ERK Pathway, Inhibits Tumor Angiogenesis, and Induces Tumor Cell Apoptosis in Hepatocellular Carcinoma Model PLC/PRF/5
Cancer Res., December 15, 2006; 66(24): 11851 - 11858.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
E. P. Jane, D. R. Premkumar, and I. F. Pollack
Coadministration of Sorafenib with Rottlerin Potently Inhibits Cell Proliferation and Migration in Human Malignant Glioma Cells
J. Pharmacol. Exp. Ther., December 1, 2006; 319(3): 1070 - 1080.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. A. Sitailo, S. S. Tibudan, and M. F. Denning
The Protein Kinase C{delta} Catalytic Fragment Targets Mcl-1 for Degradation to Trigger Apoptosis
J. Biol. Chem., October 6, 2006; 281(40): 29703 - 29710.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
N. Gao, L. Kramer, M. Rahmani, P. Dent, and S. Grant
The Three-Substituted Indolinone Cyclin-Dependent Kinase 2 Inhibitor 3-[1-(3H-Imidazol-4-yl)-meth-(Z)-ylidene]-5-methoxy-1,3-dihydro-indol-2-one (SU9516) Kills Human Leukemia Cells via Down-Regulation of Mcl-1 through a Transcriptional Mechanism
Mol. Pharmacol., August 1, 2006; 70(2): 645 - 655.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. K. Nguyen, M. Rahmani, N. Gao, L. Kramer, A. S. Corbin, B. J. Druker, P. Dent, and S. Grant
Synergistic interactions between DMAG and mitogen-activated protein kinase kinase 1/2 inhibitors in Bcr/abl+ leukemia cells sensitive and resistant to imatinib mesylate.
Clin. Cancer Res., April 1, 2006; 12(7 Pt 1): 2239 - 2247.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
D. A. Sica
Angiogenesis Inhibitors and Hypertension: An Emerging Issue
J. Clin. Oncol., March 20, 2006; 24(9): 1329 - 1331.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/42/35217    most recent
M506551200v3
M506551200v2
M506551200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rahmani, M.
Right arrow Articles by Grant, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rahmani, M.
Right arrow Articles by Grant, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement