Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M500918200 on August 23, 2005

J. Biol. Chem., Vol. 280, Issue 43, 35881-35889, October 28, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/43/35881    most recent
M500918200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kandel, S.
Right arrow Articles by Pinot, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kandel, S.
Right arrow Articles by Pinot, F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Cloning, Functional Expression, and Characterization of CYP709C1, the First Sub-terminal Hydroxylase of Long Chain Fatty Acid in Plants

INDUCTION BY CHEMICALS AND METHYL JASMONATE*

Sylvie Kandel{ddagger}1, Marc Morant§2, Irène Benveniste{ddagger}, Elizabeth Blée{ddagger}, Danièle Werck-Reichhart{ddagger}, and Franck Pinot{ddagger}3

From the {ddagger}Département Réponse Métabolique à l'Environnement Biotique, IBMP-CNRS, UPR 2357, 28 Rue Goethe, F-67083 Strasbourg Cedex, France and §Department of Plant Biology, The Royal Veterinary and Agricultural University, Thorvaldsensvej 40, Opgang 6-8, 2.Sal, DK-1871 Fredericksberg C, Copenhagen, Denmark

Received for publication, January 25, 2005 , and in revised form, July 7, 2005.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We cloned and characterized CYP709C1, a new plant cytochrome P450 belonging to the P450 family, that so far has no identified function except for clustering with a fatty acid metabolizing clade of P450 enzymes. We showed here that CYP709C1 is capable of hydroxylating fatty acids at the {omega}-1 and {omega}-2 positions. This work was performed after recoding and heterologous expression of a full-length cDNA isolated from a wheat cDNA library in an engineered yeast strain. Investigation on substrate specificity indicates that CYP709C1 metabolizes different fatty acids varying in their chain length (C12 to C18) and unsaturation. CYP709C1 is the first identified plant cytochrome P450 that can catalyze sub-terminal hydroxylation of C18 fatty acids. cis-9,10-Epoxystearic acid is metabolized with the highest efficiency, i.e. Km(app) of 8 µM and Vmax(app) of 328 nmol/min/nmol P450. This, together with the fact that wheat possesses a microsomal peroxygenase able to synthesize this compound from oleic acid, strongly suggests that it is a physiological substrate. Hydroxylated fatty acids are implicated in plant defense events. We postulated that CYP709C1 could be involved in plant defense by producing such compounds. This receives support from the observation that (i) sub-terminal hydroxylation of 9,10-epoxystearic acid is induced (15-fold after 3 h) in microsomes of wheat seedlings treated with the stress hormone methyl jasmonate and (ii) CYP709C1 is enhanced at the transcriptional level by this treatment. CYP709C1 transcript also accumulated after treatment with a combination of the safener naphthalic acid anhydride and phenobarbital. This indicates a possible detoxifying function for CYP709C1 that we discussed.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The products of the oxidative transformation of fatty acids are raising an increasing interest in all organisms because it appears that a very broad range of such derivatives can be generated, most of them having important biological activity (13). In mammals the products of the "arachidonic cascade" provide a good illustration of the diversity of structures and biological activities (1, 4).

In plants, a large number of fatty acid oxygenations are catalyzed by cytochrome P450 enzymes (2). The functions of the resulting products include different aspects of plant development, as well as wound and abiotic stress response and defense against insects and pathogens. Fatty acid hydroxylases belong to the cytochrome P450 superfamily, a highly diversified set of heme-containing proteins found in bacteria, fungi, plants, and animals (5). One can distinguish {omega}-hydroxylases that catalyze the hydroxylation of the terminal methyl of aliphatic acids ({omega} position) and sub-terminal or in-chain hydroxylases that oxidize carbon in the aliphatic chain ({omega}-n position). So far the majority of the work has addressed the study of {omega}-hydroxylases. Biochemical studies led to the characterization of cytochrome P450-dependent {omega}-hydroxylases in microsomal preparations from pea and Vicia sativa (68). A strategy based on the use of radiolabeled suicide substrates allowed us to clone CYP94A1 from V. sativa (9). This enzyme may play a role in plant defense events. Indeed, recombinant CYP94A1 catalyzes the in vitro formation of 9,10,18-trihydroxystearic and 18-hydroxy-9,10-epoxystearic acids (10). These two compounds are the major C18 monomers of cutin, a part of the cuticle that protects plant against different stress (11). Furthermore they are also potent elicitors of defense mechanisms (12, 13). The hypothesis of CYP94A1 participation in a plant defense event received support from the observation that this enzyme is induced at the transcriptional level by the stress hormone methyl jasmonate (14). Plant fatty acid hydroxylases could also be involved in catabolism like members of the CYP4 family in animals (15, 16) or like CYP52A3 and CYP52A4, which enable Candida maltosa to use aliphatic hydrocarbon as a source of carbon and energy (17). In a previous work (18), we proposed that the CYP94A5 that we cloned from tobacco could be involved in rapidly turning over free fatty acids liberated during oxidative stress and that they are harmful to the cell. Indeed, CYP94A5 is able to catalyze the complete set of reactions oxidizing the terminal methyl to the corresponding carboxyl.

Some fatty acid derivatives hydroxylated on {omega}-1 position involved in plant resistance have been described. Volicitin, which is an {omega}-1 hydroxy of linoleic acid coupled to L-glutamine, has a key role in plant resistance against herbivores (19, 20). Sub-terminal hydroxylation of jasmonates may be fundamental for reactions in the regulation of the signaling pathway for plant defense (21, 22). However, little information is available so far concerning sub-terminal hydroxylases despite the fact that they have been shown to be present in microsomes of different plants (23, 24). About 1 decade ago, we showed the presence in microsomes in wheat of a cytochrome P450-dependent system involved in sub-terminal hydroxylation of oleic and lauric acids (25). Biochemical studies suggested the presence of at least two cytochromes P450, and one of these cytochromes P450 was responsible for the resistance of wheat to diclofop (26).

Here we describe the cloning of a new plant cytochrome P450 classified as CYP709C1. Functional expression in an engineered yeast allowed us to show that CYP709C1 metabolizes fatty acids, and among all the fatty acids tested, cis-9,10-epoxystearic acid produced by a peroxygenase is hydroxylated at positions {omega}-1 and {omega}-2 with the highest efficiency. This is the first report of a sub-terminal hydroxylase of long chain fatty acid cloned in plant. CYP709C1 is up-regulated at the transcriptional level by a treatment of wheat seedlings with a combination of the safener naphthalic acid anhydride with phenobarbital or by the stress hormone methyl jasmonate. Its physiological meaning remains to be established, and we discuss its possible implication in the plant defense and detoxifying process.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chemicals—Radiolabeled [1-14C]lauric acid (45 Ci/mol) was from CEA (Gif sur Yvette, France). [1-14C]Myristic acid (55 Ci/mol), [1-14C]palmitic acid (54 Ci/mol), [1-14C]oleic acid (50 Ci/mol), [1-14C]linoleic acid (58 Ci/mol), and [1-14C]linolenic acid (52 Ci/mol) were from PerkinElmer Life Sciences. Racemic sample of cis-9,10-[1-14C]epoxystearic acid was synthesized from [1-14C]oleic acid using m-chloroperoxybenzoic acid.

The silylating reagent N,O-bistrimethylsilyltrifluoroacetamide containing 1% of trimethylchlorosilane was from Pierce. NADPH was from Sigma. Thin layer plates (Silica Gel G60 F254; 0.25 mm) were from Merck.

Probe Identification and Full-length cDNA Cloning—An 810-nucleotide-long P450 fragment was identified by PCR on the wheat {lambda}-ZipLox, NotI-SalI arms (Invitrogen)-oriented library (27). We used the primer RTAVGCRAAKKYTCHCCVAKRCAH, which is the reverse primer of the one described by Meijer et al. (28), with the primer T7 of the right border of our induced library. The PCR was carried out as described in Meijer et al. (28), and the different PCR products were cloned into pGEM-T vector (Promega) and sequenced. The putative P450 sequence was identified by a BLASTX of the NCBI plant sequence data base. This incomplete P450 fragment was 32P-labeled to screen 250,000 plateforming units of the induced library with the Ready-to-Go DNA labeling beads (Amersham Biosciences). A complete cDNA sequence was identified (GenBankTM accession number AY641449 [GenBank] ) and was named CYP709C1. For a better expression in yeast, the N-terminal part of this P450 was recoded according to the procedure described previously (29), with the following megaprimer: CGGGATCCATGGGTTTGGTTTGGATGGTTGCTGCTGCTGTTGCTGCTGTTTTGGCTTCTTGGGCTTTTGATGCTTTGGTTTATTTGGTTTGGAGACCAAGAGCTATTACTAGACAATTGAGAGCTCAAGGCGTCGGCGGTCCGGGCTACA.

Heterologous Expression of CYP709C1 in YeastCYP709C1 was heterologous expressed by using pYeDP60 and the Saccharomyces cerevisiae WAT11 strain (30). It was cloned BamHI-EcoRI in pYeDP60, and the sequence was verified by DNA sequencing after the cloning step in the yeast vector. Yeast cells were harvested and broken with glass beads (0.45 mm diameter) in 50 mM Tris-HCl buffer (pH 7.5) containing 1 mM EDTA and 600 mM sorbitol. The homogenate was centrifuged for 10 min at 10,000 x g. The resulting supernatant was centrifuged for 1 h at 100,000 x g. The pellet consisting of microsomal membranes was resuspended in 100 mM sodium phosphate (pH 7.4), 30% (v/v) glycerol, and 1.5 mM {beta}-mercaptoethanol with a Potter-Elvehjem homogenizer and stored at –30 °C. All procedures for microsomal preparation were carried out at 0–4 °C. The cytochrome P450 content was measured by the method of Omura and Sato (31).

Plant Material and Microsomal Preparation—Wheat seeds (Triticum aestivum L. cv. Etoile de Choisy) were soaked for 6 h and grown on moist paper at 25 °C for 48 h or coated with naphthalic acid anhydride (0.25% w/w) before germination. For control, ~100 g of etiolated seedlings were harvested and incubated in 2-liter Erlenmeyer flasks containing 1.5 liters of distilled water. For treatment, seedlings grown on naphthalic acid anhydride were harvested and incubated in 2-liter Erlenmeyer flasks containing 1.5 liters of distilled water with 8 mM phenobarbital. The incubation medium was bubbled for 65 h with a stream of air (5 liters/min) in the dark at 25 °C. Methyl jasmonate treatment was performed by incubating seedlings (48 h old) in methyl jasmonate solution aerated by a stream of air (5 liters/min). The time of treatment and the concentration are specified for each experiment.

Approximately 10 g of wheat seedlings were harvested and homogenized with an ultra-turrax (15,000 rpm, twice for 30 s) in 100 ml of 100 mM sodium phosphate buffer (pH 7.4) containing 1 mM EDTA, 250 mM sucrose, 40 mM sodium ascorbate, 10 mM {beta}-mercaptoethanol, and 1 mM phenylmethylsulfonyl fluoride. The homogenate was filtered through 50-µm blutex cloth and centrifuged for 15 min at 10,000 x g. The resulting supernatant was centrifuged for 1 h at 100,000 x g. The microsomal pellets were resuspended in 100 mM sodium phosphate buffer (pH 7.4), 30% (v/v) glycerol, with a Potter-Elvehjem homogenizer and stored at –30 °C. For peroxygenase activity measurement, the protocol of microsomal preparation was slightly modified. Wheat seedlings were harvested and homogenized with an ultra-turrax (15,000 rpm, twice for 30s) in 90 ml of 100 mM potassium phosphate buffer (pH 7.4), containing 250 mM sucrose, 1 mM diethylenetriaminepentaacetic acid. The homogenate was filtered through 50-µm blutex cloth and centrifuged for 15 min at 10,000 x g. The resulting supernatant was centrifuged for 45 min at 100,000 x g. The microsomal pellets were resuspended in 100 mM sodium acetate buffer (pH 5.5), and stored at 4 °C. All procedures for microsomal preparation were carried out at 0–4 °C. Microsomal protein content was estimated by a microassay procedure from Bio-Rad using bovine serum albumin as standard.

Northern Blot Analysis—Total RNAs were isolated from 1 g of root or 1 g of coleoptile. For Northern blot analysis, total RNAs (5 or 10 µg/lane) were denatured, subjected to electrophoresis on 1.2% agarose gel containing formaldehyde, and transferred onto a Hybond N+ membrane (Amersham Biosciences). The blot was hybridized with 32P-labeled cDNA corresponding to the coding region of CYP709C1 at 65 °C for 1 6 h in 5x SSC. After hybridization, the blot was washed twice with 2x SSC, 0.1% SDS at room temperature for 15 min, and twice with 0.2x SSC, 0.1% SDS at 55 °C for 30 min. The 25 S and 18 S ribosomic RNA from wheat were used as an internal control.

Enzyme Activities—All radiolabeled substrates were dissolved in ethanol that was evaporated before the addition of microsomes into the glass tube. Resolubilization of the substrates was confirmed by measuring the radioactivity of the incubation media.

Enzymatic activities of CYP709C1 or wheat microsomes were determined by following the formation rate of metabolites. The standard assay (0.1 ml) contained 20 mM sodium phosphate (pH 7.4), 1 mM NADPH, plus a regenerating system (consisting of a final concentration of 6.7 mM Glc-6-P and 0.4 units of Glc-6-P-dehydrogenase) and radiolabeled substrate (100 µM). The reaction was initiated by the addition of NADPH and was stopped by the addition of 20 µl of acetonitrile (0.2% acetic acid). The reaction products were resolved by HPLC4 or TLC as described below. Kinetic studies were performed for 7 min at 27 °C with 0.7 and 0.1 pmol of CYP709C1 for lauric acid and 9,10-epoxystearic acid, respectively. Determination of Km and Vmax values was based on six data points ranging from 3 to 150 µM for lauric acid and from 3 to 30 µM for 9,10-epoxystearic acid. Peroxygenase activity of wheat microsomes was measured as described previously using 100 µM of cumene hydroperoxide as cofactor (32).

Chromatographic Methods—Incubation media were directly spotted on TLC plates. For separation of hydroxy fatty acids from residual substrate (lauric and 9,10-epoxystearic acids), TLC were developed with a mixture of diethyl ether/light petroleum (boiling point, 40–60 °C)/formic acid (70:30:1 or 50:50:1 v/v/v, for lauric and 9,10-epoxystearic acids, respectively). For separation of 9,10-epoxystearic acid from residual oleic acid in peroxygenase measurement, TLC were developed with a mixture of diethyl ether/hexane/formic acid (50:50:1 v/v/v). The plates were scanned with a thin layer scanner (Berthold LB 2723). The area corresponding to the metabolites was scraped into counting vials and quantified by liquid scintillation, or they were eluted from the silica with 10 ml of the mixture diethyl ether/hexane (50:50, v/v), which was removed by evaporation. They were then subjected to GC/MS analysis.

For HPLC analysis reaction products were directly injected after incubations. The metabolites were resolved by RP-HPLC (Waters, equipped with two 600 pumps and a Packard 500 TR series radiodetector) on a 5-µm Ultrasphere C18 column (150 x 4.6 mm, Beckman Instruments, France) using isocratic solvent at a flow of 1 ml/min. A mixture of acetonitrile/water/acetic acid (40:60:0.2, v/v/v) was used to elute 18-, 17-, and 16-hydroxy-9,10-epoxystearic acids. A linear gradient (0–100%) of 80% acetonitrile in aqueous acetic acid was used to elute residual 9,10-epoxystearic acid.

Chiral Analysis—Chiral analyses were performed as described previously by using optically pure synthetic (9R,10S)-epoxystearate methyl ester as a standard (33). To determine the chirality of the residual epoxide after incubation with CYP709C1, the epoxide and the hydroxylated product were separated on TLC. The area corresponding to the epoxide was scraped, and the epoxide was eluted from the silica. The residual epoxide was dissolved in hexane (40 µl) after methylation with diazomethane and analyzed by HPLC (Waters equipped with two 600 pumps and a Packard 500 TR series radiodetector). Both enantiomers were resolved using a chiral column (Chiracel OB (4.6 x 250 mm) J. T. Baker Inc.) with an isocratic solvent hexane/propan-2-ol/acetic acid (99.7:0.2:0.1, v/v/v) at a flow rate of 0.8 ml/min. Under the present conditions of analysis, methyl esters of (9S,10R)- and (9R,10S)-epoxystearic acids have retention times of 31 and 40 min, respectively.

GC/MS Analysis—Metabolites generated during the incubations of lauric, oleic, and 9,10-epoxystearic acids with CYP709C1 or with wheat microsomes were eluted from silica with 10 ml of diethyl ether/hexane (50:50, v/v), methylated with diazomethane, and silylated with a mixture of pyridine and N,O-bistrimethylsilyltrifluoroacetamide containing 1% (v/v) trimethylchlorosilane (1:1, v/v).

GC/MS analysis was carried out on a gas chromatograph (Agilent 6890 Series) equipped with a 30-m capillary column with an internal diameter of 0.25 mm and a film thickness of 0.25 µm (HP-5MS). The gas chromatograph was combined with a quadrupole mass selective detector (Agilent 5973N). Mass spectra were recorded at 70 eV and analyzed as in Eglinton et al. (34). Yeast has only three cytochromes P450; they are expressed at a negligible rate under the growth conditions used, and none of these is able to oxidize fatty acids (30). This was confirmed by GC/MS analysis of incubations performed with microsomes of yeast transformed with void plasmid, which did not show any formation of metabolite.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 1.
Radiochromatographic resolution by TLC of metabolites generated in incubations of lauric acid with microsomes of yeast expressing CYP709C1. Microsomes were incubated with 100 µM [1-14C]lauric acid in the absence (A) or in the presence (B) of NADPH. Incubations were performed at 27 °C and contained 5.9 pmol of CYP709C1. They were stopped after 30 min by the addition of 20 µl of acetonitrile (containing 0.2% of acetic acid) and directly spotted on TLC. Peak S, lauric acid; peak 1, 11-hydroxylauric acid; peak 2, 10-hydroxylauric acid. C, experiment performed as in B but with microsomes of yeast transformed with void plasmid.

 

    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning of CYP709C1—In an attempt to clone all cytochromes P450 from wheat involved in xenobiotic metabolism, the screening of a cDNA library from wheat treated with cloquintocet-mexyl and phenobarbital led us to isolate and sequence a full-length cDNA of 1975 bp containing an open reading frame of 1545 bp. Sequence alignment and data base searching showed that the deduced protein was a new member of the CYP709 family of cytochromes P450. The peptide (514 amino acids) has a calculated mass of 57,484 Da and pI of 9.01. This new cytochrome P450 enzyme was classified as CYP709C1 by the cytochrome P450 nomenclature committee.

For a better expression in yeast, the N-terminal part of CYP709C1 was recoded according to the procedure already described (29). For our study we used microsomes from yeast strain WAT11 transformed with the recoded CYP709C1. Yeast has only three cytochromes P450; they are expressed at a negligible rate under our growth conditions (30). None of these is able to oxidize fatty acids, ensuring us that the metabolism studied in this work is because of the recombinant enzyme. Furthermore, WAT11 overexpresses a plant P450 reductase that allows excellent electron transfer and probably increases the stability of the plant P450 in the yeast endoplasmic reticulum.

Metabolism of Lauric Acid by CYP709C1—After incubation of lauric acid (C12:0) with microsomes of yeast expressing CYP709C1, incubation media were directly analyzed by TLC. Fig. 1 shows radiochromatograms obtained after incubation in the absence (Fig. 1A) or in the presence (Fig. 1B) of NADPH. Two polar metabolites were formed in the presence of NADPH (Fig. 1B, peaks 1 and 2). They were not produced in the incubation of boiled microsomes or in the incubation with microsomes of yeast transformed with a void plasmid (Fig. 1C). Taken together, these results demonstrate the involvement of CYP709C1 in their formation. We determined an optimum pH of 7.2. Metabolites of peaks 1 and 2 were purified, derivatized, and analyzed by GC/MS. Mass spectrum of the metabolite 1 of lauric acid after derivatization (Fig. 2A) showed ions at m/z (relative intensity %) 73 (43%) ((CH3)3Si+), 75 (25%) ((CH3)2Si+=O), 117 (base peak 100%), 146 (4%) (CH2=C+ (OSi(CH3)3–OCH3), 159 (10%) (CH3–O+=C+(OSi(CH3)3)CH=CH2), 201 (0.5%), 215 (2%), 255 (11%) (M – 47) (loss of methanol from the (M – 15) fragment), 271 (3%) (M – 31) (loss of OCH3 from the methyl ester), 287 (5%) (M – 15) (loss of a methyl from the TMSi group). This fragmentation pattern is characteristic of the derivative of 11-hydroxylauric acid (M = 302 g/mol) (Fig. 2A). Mass spectrum of the second metabolite of lauric acid after derivatization (Fig. 2B) showed ions at m/z (relative intensity %) 73 (75%) ((CH3)3Si+), 75 (33%) ((CH3)2Si+ =O), 131 (base peak 100%), 146 (5%) (CH2=C+(OSi(CH3)3–OCH3), 159 (8%) (CH3–O+=C+(OSi(CH3)3)CH=CH2), 201 (0.5%), 215 (1%), 255 (10%) (M – 47) (loss of methanol from the (M – 15) fragment), 271 (4%) (M – 31) (loss of OCH3 from the methyl ester), 273 (43%), 287 (2%) (M – 15) (loss of a methyl from the TMSi group). This fragmentation pattern is characteristic of the derivative of 10-hydroxylauric acid (Fig. 2B). These metabolites were not formed in incubation with boiled microsomes (not shown) or in incubation with microsomes of yeast transformed with a void plasmid (Fig. 1C). We performed kinetic studies to determine Km(app) and Vmax(app) values of 158 ± 6 µM and 132 ± 3 nmol/min/nmol P450, respectively.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 2.
CYP709C1 metabolizes lauric acid to 11- and 10-hydroxylauric acids. Mass spectra and drawings representing fragmentation scenarios for 11-hydroxylauric (A) and 10-hydroxylauric (B) acids methylated on carboxyl and silylated on hydroxyl.

 
Previous biochemical studies suggested that a cytochrome P450 fatty acid hydroxylase was responsible for the resistance of wheat to diclofop (26). Therefore, we incubated this herbicide with microsomes of transformed yeast, but we did not observe any metabolism of diclofop in these incubations.

Epoxidation of Oleic Acid in Wheat Microsomes—We incubated oleic acid (C18:1) with wheat microsomes in the presence of cumene hydroperoxide, and the incubation medium was directly analyzed by TLC. Radiochromatogram of Fig. 3 shows that one metabolite was formed (Fig. 3A, peak 1). It was not formed in incubation with boiled microsomes (Fig. 3B). After purification, this product was methylated with diazomethane and subjected to GC/MS analysis. We also methylated and analyzed by GC/MS authentic 9,10-epoxystearic acid. The mass spectrum obtained for the metabolite purified from peak 1 was identical to that of authentic 9,10-epoxystearate methyl ester (M = 312 g/mol) showing ions at m/z (relative intensity %) 155 (100%) (base peak, loss of (CH2)7COOCH3), 199 (14%) (loss of (CH2)7CH3), 281 (2%) (M – 31, loss of OCH3), and 294 (1%) (M – 18, loss of H2O). This mass spectrum is also identical to mass spectrum of methylated 9,10-epoxystearic acid produced by partially purified peroxygenase from soybean (32). This shows that wheat possesses a microsomal peroxygenase able to synthesize 9,10-epoxystearic acid using oleic acid as substrate.



View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 3.
Radiochromatographic resolution by TLC of metabolites generated in incubations of oleic acid with microsomes of wheat. A, microsomes (150 µg of protein) were incubated with 100 µM [1-14C]oleic acid in the presence of cumene hydroperoxide (100 µM). B, experiment performed as in A, but microsomes were boiled. Incubations were performed at 26 °C for 2 h and directly spotted on TLC. Peak S, oleic acid; peak 1, 9,10-epoxystearic acid.

 



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 4.
Radiochromatographic resolution by TLC of metabolites generated in incubations of 9,10-epoxystearic acid with microsomes of yeast expressing CYP709C1. Microsomes were incubated with 100 µM 9,10-[1-14C]epoxystearic acid in the absence (A) or in the presence (B) of NADPH. Incubations were performed at 27 °C and contained 5.9 pmol of CYP709C1. They were stopped after 15 min by the addition of 20 µl of acetonitrile (containing 0.2% of acetic acid) and directly spotted on TLC. Peak S, 9,10-epoxystearic acid; peak 1, 17-hydroxy-9,10-epoxystearic acid; peak 2, 16-hydroxy-9,10-epoxystearic acid. C, experiment performed as in B but with microsomes of yeast transformed with void plasmid.

 



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 5.
CYP709C1 metabolizes 9,10-epoxystearic acid to 17- and 16-hydroxy-9,10-epoxystearic acids. Mass spectra and drawings representing fragmentation scenarios for 17-hydroxy-9,10-epoxystearic (A) and 16-hydroxy-9,10-epoxystearic (B) acids methylated on carboxyl and silylated on hydroxyl.

 
Metabolism of cis-9,10-Epoxystearic Acid by CYP709C1—We incubated 9,10-epoxystearic acid with microsomes expressing CYP709C1 to test if it was substrate. No metabolite were formed in absence of NADPH (Fig. 4A). Addition of this cofactor to the incubation medium led to the formation of two metabolites (Fig. 4B, peaks 1 and 2). They were purified and analyzed by GC/MS. Mass spectrum of the metabolite 1 of cis-9,10-epoxystearic acid after derivatization (Fig. 5A) showed ions at m/z(relative intensity %) 73 (58%) ((CH3)3Si+), 75 (38%) ((CH3)2Si+ =O), 117 (base peak 100%), 146 (3%) (CH2=C+(OSi(CH3)3–OCH3), 159 (5%) (CH3–O+=C+(OSi(CH3)3)CH=CH2), 199 (8%), 213 (5%), 243 (3%), and 353 (0.5%) (M – 47) (loss of methanol from the (M – 15) fragment), 369 (0.5%) (M – 31) (loss of OCH3 from the methyl ester), and 385 (1%) (M – 15) (loss of a methyl from the TMSi group) (M = 400 g/mol). Holloway (35) performed fragmentation of the same derivative of synthetic 18-hydroxy-9,10-epoxystearic acid. As expected, Holloway (35) observed ions at m/z 199, 213, and 243 resulting from cleavage on both sides of the epoxide. He also observed ions at m/z 171, 185, and 215 coming from ions 199, 213, and 243, respectively (loss of 28). Mass spectrum of metabolite 1 also showed ions at m/z 171 (4%), 185 (3%), and 215 (3%). Its fragmentation pattern is characteristic of the derivative of 17-hydroxy-9,10-epoxystearic acid (Fig. 5A). Mass spectrum of the second metabolite of 9,10-epoxystearic acid after derivatization (Fig. 5B) showed ions at m/z (relative intensity %) 73 (90%) ((CH)3)3Si+), 75 (43%) ((CH3)2Si+ =O), 131 (base peak 100%), 146 (5%) (CH2=C+(OSi(CH3)3–OCH3), 159 (9%) (CH3–O+=C+(OSi(CH3)3)CH=CH2), 199 (3%), 213 (3%), 243 (2%), 353 (2%) (M – 47) (loss of methanol from the (M – 15) fragment), 371 (3%), and 385 (1%) (M – 15) (loss of a methyl from the TMSi group). Ions at m/z 171 (4%), 185 (6%), and 215 (3%) were also present. This fragmentation pattern is characteristic of the derivative of 16-hydroxy-9,10-epoxystearic acid (Fig. 5B). Similarly to lauric acid, 9,10-epoxystearic acid was hydroxylated at sub-terminal positions. Incubation with boiled microsomes (not shown) or with microsomes from yeast transformed with a void plasmid (Fig. 4C) confirmed that these compounds resulted from an enzymatic reaction catalyzed by CYP709C1. We determined by kinetic studies Km(app) and Vmax(app) values of 8 ± 1 µM and 328 ± 13 nmol/min/nmol P450, respectively. Minor metabolites that co-migrated with 16- and 17-hydroxy-9,10-epoxystearicacids on TLC were detected by HPLC analysis (not shown). These minor compounds have not yet been identified.



View larger version (10K):
[in this window]
[in a new window]
 
FIGURE 6.
Substrate specificity of CYP709C1. Microsomes of yeast expressing CYP709C1 were incubated with 100 µM of radiolabeled substrate. Incubations were performed 15 min at 27 °C and contained 1.1 pmol of CYP709C1. Activities were determined as described under "Materials and Methods" by following on TLC the formation rate of metabolites.

 



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 7.
Radiochromatographic resolution by HPLC of the residual enantiomers of 9,10-[1-14C]epoxystearic acid after incubation with microsomes of yeast expressing CYP709C1. Microsomes (0.8 pmol of CYP709C1) were incubated with 100 µM of racemic 9,10-epoxystearic acid. After 20% of the substrate was metabolized, the remaining 80% was purified by TLC, methylated with diazomethane, and subjected to chiral HPLC with hexane/propan-2-ol/acetic acid (99.7:0.2:0.1, v/v) at a flow rate of 0.8 ml/min.

 
Substrate Specificity of CYP709C1—We studied the capability of CYP709C1 to oxidize saturated and unsaturated fatty acids with chain length ranging from C12 to C18. All substrates were incubated at a concentration of 100 µM with microsomes of yeast expressing CYP709C1. All of them were metabolized, and Fig. 6 shows that it is the 9,10-epoxystearic acid that is turned over with the highest efficiency. As mentioned above, wheat possesses a microsomal peroxygenase able to epoxidize oleic acid. We purified 9,10-epoxystearic acid produced in the incubation of wheat microsomes with oleic acid and cumene hydroperoxide, and we determined its chirality by using a chiral column. The epoxide was not racemic and presented an enantiomeric excess in favor of the 9R,10S form: 9R,10S/9S,10R 70/30 (not shown). To test if CYP709C1 was enantioselective for this form, we incubated our substrate 9,10-epoxystearic acid, which is racemic, and we analyzed the chirality of the residual epoxide. The residual epoxide was still racemic (Fig. 7), showing that CYP709C1 was not enantioselective. The 9,10-epoxystearic acid that we used in this work has the cis configuration because it was made from oleic acid. Experiments of competition between cis and trans stereoisomers allowed us to show that CYP709C1 also recognized the trans stereoisomer.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 8.
Radiochromatographic resolution by RP-HPLC of metabolites generated in incubations of 9,10-[1-14C]epoxystearic acid with microsomes of wheat coleoptile treated with naphthalic acid anhydride and phenobarbital. Microsomes of treated wheat coleoptile (0.22 mg of protein) were incubated with 100 µM of 9,10-epoxystearic acid for 30 min at 27 °C in the absence (A) or in the presence (B) of NADPH. The reaction was stopped by the addition of 20 µl of acetonitrile (containing 0.2% of acetic acid), and the incubation was directly subjected to RP-HPLC analysis.

 
Metabolism of cis-9,10-Epoxystearic Acid in Wheat MicrosomesFig. 8 shows the radioactivity profiles obtained after incubation of 9,10-epoxystearic acid with microsomes from naphthalic acid anhydride and phenobarbital-treated wheat coleoptile. Two major metabolites (Fig. 8B, peaks 1 and 2) were generated only in presence of NADPH. They were not formed with boiled microsomes (not shown). Metabolites from peaks 1 and 2 were purified, derivatized, and subjected to GC/MS analysis. Their fragmentation patterns are identical to the ones of derivatized metabolites produced during incubation of 9,10-epoxystearic acid with microsomes of yeast expressing CYP709C1. Metabolites from peaks 1 and 2 were identified as 17- and 16-hydroxy-9,10-epoxystearic acids, respectively. The minor metabolite from peak 3 co-elutes in HPLC with 18-hydroxy-9,10-epoxystearic acid (not shown). Compared with control, treatment of wheat seedlings with naphthalic acid anhydride and phenobarbital increased the microsomal activity of 9,10-epoxystearic hydroxylation 150-fold to 45 pmol/min/g fresh weight. Northern blot analysis presented in Fig. 9 revealed that such treatment strongly induced accumulation of the transcript coding for CYP709C1. The highest induction was observed in the coleoptile. We also studied the effect of methyl jasmonate (500 µM) treatment of wheat seedling on 9,10-epoxystearic hydroxylation. As shown in Fig. 10, the activity was enhanced 15 times after 3 h of treatment, and the maximal activity was reached after 24 h of treatment (100-fold induction). Fig. 11 shows that even at the lowest concentration tested (20 µM), the activity was stimulated 2-fold compared with control (8 versus 4 pmol/min/mg protein in assay and control, respectively). Northern blot analysis showed that methyl jasmonate treatment also led to accumulation of the transcript coding for CYP709C1 (Fig. 12). The transcript accumulated in both root and coleoptile, with higher levels in coleoptile, and the maximum was reached at 3 h in root and 6 h in coleoptile.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 9.
Northern blot analysis of CYP709C1 expression in control and in naphthalic acid anhydride plus phenobarbital-treated wheat seedlings. Total RNAs were extracted from 1 g of root or 1 g of coleoptile, and 10 µg was subjected to RNA blot analysis. A 25 S- and an 18 S-ribosomic RNA from wheat was used as an internal standard. Lane C (control), RNAs from seedlings incubated in water; lane T (treated), RNAs from seedlings coated with naphthalic acid anhydride and incubated in a phenobarbital solution.

 



View larger version (10K):
[in this window]
[in a new window]
 
FIGURE 10.
Effect of time of treatment with methyl jasmonate on 9,10-epoxystearic acid hydroxylation in microsomes of wheat coleoptile. Hydroxylation was measured in microsomes of coleoptile from wheat seedlings (2 days old) induced for different periods in water (white bar) or in water containing 500 µM methyl jasmonate (black bar). Data are expressed as the mean with standard deviation of activity assays in triplicate.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In an attempt to clone all cytochromes P450 from wheat involved in xenobiotic metabolism, we isolated a full-length cDNA. Sequence alignment showed that the deduced protein was a new member of the CYP709 family of cytochrome P450 named CYP709C1. In the phylogenic tree of plant cytochromes P450 (36), CYP709 family belongs to the group non-A II, which contains the first cloned plant fatty acid {omega}-hydroxylases, CYP94A1 (9) and CYP86A1 (37). We transformed yeast with a recoded cDNA coding for CYP709C1 to get a better expression. By using microsomes of transformed yeast and the model substrate lauric acid, we showed that CYP709C1 is indeed a fatty acid hydroxylase. However, this new enzyme differs from CYP94A1 (9) and CYP86A1 (37) by its regiospecificity; it attacks exclusively {omega}-1 and {omega}-2 but not the {omega} position of fatty acids. We previously characterized CYP81B1 from Helianthus tuberosus, which also hydroxylates fatty acids in the chain (38). However, CYP81B1 does not recognize the most common C16 and C18 plant fatty acids. Furthermore, the position of hydroxylation depends on the fatty acid chain length. This suggests that fatty acids are not the physiological substrates of CYP81B1. On the contrary, CYP709C1 metabolizes common plant fatty acids, and the fact that the regiospecificity of CYP709C1 is independent of the aliphatic chain length suggests that sub-terminal hydroxylation is the real function of the enzyme.

Among all fatty acids tested, 9,10-epoxystearic acid is hydroxylated with the highest efficiency. The low Km(app) value (8 µM) determined together with the fact that this fatty acid is produced by a peroxygenase localized in the microsomes strongly suggest that it is a physiological substrate of CYP709C1. The physiological role of this enzyme remains to be established. A participation in cutin synthesis is not conceivable, and indeed it does not attack the {omega}-position, and to our knowledge {omega}-1 and {omega}-2 hydroxy fatty acids have not been reported in cutin so far. Polyhydroxy C18 fatty acids have been shown to be responsible for plant resistance against pathogens (3941). An epoxide hydrolase that transforms 9,10-epoxystearic acid to the corresponding diol has been described in wheat (42). Hydrolysis by this enzyme of 16- or 17-hydroxy-9,10-epoxystearic acids produced by CYP709C1 would lead to the formation of trihydroxy C18 fatty acids with chemical structures close to the structure of compounds mentioned above. This could give a role in plant defense to CYP709C1. The strong and rapid induction at the transcriptional level by the stress hormone methyl jasmonate corroborates this hypothesis. Induction was detectable at the lowest concentration tested (20 µM), which is physiological in wounded plant (43). Most interestingly, recent work describes the strong induction at the transcriptional level of CYP709C3, a member from the same family after fungal infection by Fusarium graminearum (44).



View larger version (10K):
[in this window]
[in a new window]
 
FIGURE 11.
Dose effect of methyl jasmonate on 9,10-epoxystearic acid hydroxylation in microsomes of wheat coleoptile. Hydroxylation was measured in microsomes of coleoptile from wheat seedlings (2 days old) induced for 24 h in a solution containing increasing concentration of methyl jasmonate. Data are expressed as the mean with standard deviation of activity assays in triplicate.

 



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 12.
Northern blot analysis of CYP709C1 expression in control and methyl jasmonate treated wheat seedlings. Total RNAs were extracted from 1 g of root or 1 g of coleoptile. RNAs of coleoptile (10 µg) and root (5 µg) were subjected to RNA blot analysis. A 25 S and an 18 S ribosomic RNA from wheat was used as an internal standard. Lane C (control), RNAs from seedlings incubated in water; lane T (treated), RNAs from seedlings incubated in a 500 µM methyl jasmonate solution.

 
CYP94A1 {omega}-hydroxylates 9,10-epoxystearic acid with a strong enantioselectivity for the 9R,10S enantiomer (10). By contrast, CYP709C1 does not exhibit any enantioselectivity and recognizes both cis and trans forms of the epoxide. This might just reflect the less hindered conformation of the substrate in the active site of CYP709C1 compared with CYP94A1. Indeed, to occur, the less thermodynamically favored hydroxylation of a terminal methyl requires strong steric constraints to retain the substrate in a tight position that allows the terminal methyl to approach the ferryl-oxo species (45, 46).

In the context of plant resistance, it is interesting to note that {omega}-1 hydroxy derivatives of fatty acids have been described. In response to elicitors present in the oral secretion of herbivores, plants produce and secrete volatile chemicals that attract natural enemies of the herbivore. Volicitin is responsible for the majority of elicitor activity in the oral secretion of caterpillar species (19). Volicitin is an {omega}-1 hydroxy of linolenic acid coupled to L-glutamine. Paré et al. (20), suggested that hydroxylation of linolenic acid occurred within the caterpillar, but it is conceivable that products of reactions catalyzed by CYP709C1 have eliciting properties or are a precursor of molecules with eliciting properties. Also studies on the metabolism of dihydrojasmonic and jasmonic acids showed that they are hydroxylated on the {omega} and {omega}-1 positions (21, 22). The {omega}-1 hydroxylation of a pollen suppressant has been described in wheat (47). The hydroxylating enzymes involved in these different reactions have not yet been characterized.

In animals, arachidonic acid (C20:4), the major fatty acid, is transformed to different metabolites through the arachidonic cascade composed of prostaglandin synthase, lipoxygenases, and cytochromes P450-dependent {omega} and {omega}-1 hydroxylases (48). The regulation of the hydroxylases by peroxisome proliferator-activated receptor-{alpha} suggested that these reactions contributed to fatty acid homeostasis (48). However, recent works attributed important physiological properties to the {omega}-1 hydroxy of C20:4 (19-hydroxyeicosatetraenoic acid) produced by the murine CYP2J9 (49) and the human CYP2U1 (50). The murine CYP2J9 is highly expressed in cerebellar Purkinje cells and synthesizes exclusively 19-hydroxyeicosatetraenoic acid, which can inhibit ionic channels involved in triggering neurotransmitter release (49). This compound is also involved in the regulation of the renal Na+,K+-ATPase (51) and has been reported to be a vasodilator (52). Therefore, hydroxylation of C20:4 cannot only be considered as catabolism. To our knowledge, no biological activities have been attributed to {omega}-1 or {omega}-2 hydroxy fatty acids in plant, and such a finding would give potential roles to CYP709C1.

We demonstrated previously that fatty acid hydroxylation is induced in microsomes of wheat treated with naphthalic acid anhydride and phenobarbital (25). Our results suggested the presence of distinct cytochrome P450-dependent hydroxylases in wheat. The finding of a mixture of 16-, 17-, and 18-hydroxy-9,10-epoxystearic acid produced by wheat microsomes, when CYP709C1 does not hydroxylate the last methyl, confirms the existence of at least two hydroxylating systems. In animals, gene induction by phenobarbital is well documented (53). Phenobarbital is the prototype for a large number of chemical inducers of cytochrome P450 (mainly the CYP2 family) and other enzymes involved in xenobiotic metabolism (54). In Drosophila melanogaster, CYP6A8 expression is inducible by phenobarbital (55). It was recently cloned and functionally expressed (56). CYP6A8 hydroxylates lauric acid on {omega}-1 position. This could be a key step in controlling the effect of lauric acid during development. Most interestingly, CYP6A8 is capable of metabolizing the insecticide aldrin. Induction of plant enzyme by phenobarbital and naphthalic acid anhydride is much less documented. However, the few known examples concern enzymes indeed implicated in xenobiotic metabolism. Hydroxylation of bentazon is induced in microsomes of corn treated with naphthalic acid anhydride (57). A member of the glutathione S-transferase family is induced in wheat treated by phenobarbital (58). Zimmerlin and Durst (26) showed that wheat resistance to diclofop was because of a cytochrome P450 inducible by phenobarbital and capable of hydroxylation of fatty acids. CYP709C1 described in the present work does not metabolize diclofop, but its induction by naphthalic acid anhydride and phenobarbital treatment indicates a possible detoxifying function.

Finally, assessment of the physiological role of CYP709C1 might be achieved through the study of its homologs in Arabidopsis thaliana. The complete sequencing of the A. thaliana genome reveals the presence of 272 cytochromes P450 including three members of the CYP709 family: CYP709B1, CYP709B2, and CYP709B3. The use of A. thaliana will allow the production of transgenic plants. It will be of great interest to investigate the effect of overexpression or extinction of these genes. Studies will be conducted in the context of plant resistance. This should help to investigate the participation of members of the CYP709 family in the plant-pathogen interaction and in the detoxifying process.


    FOOTNOTES
 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 Supported by the French Ministry of Research. Back

2 Supported by Bayer CropScience and the "Association Nationale de la Recherche Technique." Back

3 To whom correspondence should be addressed: IBMP-CNRS UPR 2357, Institut de Botanique, 28 Rue Goethe, F-67083 Strasbourg Cedex, France. Tel.: 33-3-90-24-18-37; Fax: 33-3-90-24-19-21; E-mail: franck.pinot{at}bota-ulp.u-strasbg.fr.

4 The abbreviations used are: HPLC, high pressure liquid chromatography; RP-HPLC, reverse phase-HPLC; GC/MS, gas chromatography/mass spectrometry; TMSi, trimethylsilyl. Back


    ACKNOWLEDGMENTS
 
We thank Dr. David Nelson (University of Tennessee, Memphis) for naming the new P450. The WAT11 yeast strain and pYeDP60 vector were provided by Dr. Denis Pompon (Gif-sur-Yvette, France).



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Funk, C. D. (2001) Science 294, 1871–1875[Abstract/Free Full Text]
  2. Blée, E. (2002) Trends Plant Sci. 7, 315–322[CrossRef][Medline] [Order article via Infotrieve]
  3. Noverr, M. C., Erb-Downward, J. R., and Huffnagle, G. B. (2003) Clin. Microbiol. Rev. 16, 517–533[Abstract/Free Full Text]
  4. Spector, A. A., Fang, X., Snyder, G. D., and Weintraub, N. L. (2004) Prog. Lipid Res. 43, 55–90[CrossRef][Medline] [Order article via Infotrieve]
  5. Werck-Reichhart, D., and Feyereisen, R. (2000) Genome Biol. 1, 3003.1–3003.9
  6. Benveniste, I., Salaün, J.-P., Simon, A., Reichhart, D., and Durst, F. (1982) Plant Physiol. 70, 122–126[Abstract/Free Full Text]
  7. Salaün, J.-P., Simon, A., and Durst, F. (1986) Lipids 21, 776–779[CrossRef]
  8. Pinot, F., Salaün, J.-P., Bosch, H., Lesot, A., Mioskowski, C., and Durst, F. (1992) Biochem. Biophys. Res. Commun. 184, 183–193[CrossRef][Medline] [Order article via Infotrieve]
  9. Tijet, N., Helvig, C., Pinot, F., Le Bouquin, R., Lesot, A., Durst, F., Salaün, J.-P., and Benveniste, I. (1998) Biochem. J. 332, 583–589
  10. Pinot, F., Benveniste, I., Salaün, J.-P., Loreau, O., Noël, J.-P., Schreiber, L., and Durst F. (1999) Biochem. J. 342, 27–32
  11. Kolattukudy, P. E. (1980) Science 208, 990–1000[Abstract/Free Full Text]
  12. Schweizer, P., Jeanguenat, A., Whitacre, D., Métraux, J.-P., and Mösinger, E. (1996) Physiol. Mol. Plant Pathol. 49, 103–120[CrossRef]
  13. Fauth, M., Schweizer, P., Buchala, A., Markstädter, C., Riederer, M., Kato, T., and Kauss, H. (1998) Plant Physiol. 117, 1373–1380[Abstract/Free Full Text]
  14. Pinot, F., Benveniste, I., Salaün, J.-P., and Durst, F. (1998) Plant Physiol. 118, 1481–1486[Abstract/Free Full Text]
  15. Simpson, A. E. C. M. (1997) Gen. Pharmacol. 28, 351–359[Medline] [Order article via Infotrieve]
  16. Gibson, G. G. (1989) Xenobiotica 19, 1123–1148[Medline] [Order article via Infotrieve]
  17. Scheller, U., Zimmer, T., Kärgel, E., and Schunck, W.-H. (1996) Arch. Biochem. Biophys. 328, 245–254[CrossRef][Medline] [Order article via Infotrieve]
  18. Le Bouquin, R., Skrabs, M., Kahn, R., Benveniste, I., Salaün, J.-P., Schreiber, L., Durst, F., and Pinot, F. (2001) Eur. J. Biochem. 268, 3083–3090[Medline] [Order article via Infotrieve]
  19. Lait, C. G., Alborn, H. T., Teal, P. E. A., and Tumlinson, J. H. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 7027–7032[Abstract/Free Full Text]
  20. Paré, P. W., Alborn, H. T., and Tumlinson, J. H. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 13971–13975[Abstract/Free Full Text]
  21. Meyer, A., Gross, D., Vorkefeld, S., Kummer, M., Schmidt, J., Sembdner, G., and Schreiber, K. (1989) Phytochemistry 28, 1007–1011[CrossRef]
  22. Hamberg, M., and Gardner, H. W. (1992) Biochim. Biophys. Acta 1165, 1–18[Medline] [Order article via Infotrieve]
  23. Salaün, J.-P., Benveniste, I., Reichhart, D., and Durst, F. (1978) Eur. J. Biochem. 90, 155–159[Medline] [Order article via Infotrieve]
  24. Salaün, J.-P., Benveniste, I., Fonné, R., Gabriac, B., Reichhart, D., Simon, A., and Durst, F. (1982) Physiol. Veg. 20, 613–621
  25. Pinot, F., Alayrac, C., Mioskowski, C., Durst, F., and Salaün, J.-P. (1994) Biochem. Biophys. Res. Commun. 198, 795–803[CrossRef][Medline] [Order article via Infotrieve]
  26. Zimmerlin, A., and Durst, F. (1992) Plant Physiol. 100, 874–881[Abstract/Free Full Text]
  27. Morant, M., Hehn, A., and Werck-Reichhart, D. (2002) BMC Plant Biol. 2, 7[CrossRef][Medline] [Order article via Infotrieve]
  28. Meijer, A. H., Souer, E., Verpoorte, R., and Hoge, J. H. C. (1993) Plant Mol. Biol. 22, 379–383[CrossRef][Medline] [Order article via Infotrieve]
  29. Hehn, A., Morant, M., and Werck-Reichhart, D. (2002) Methods Enzymol. 357, 343–351[Medline] [Order article via Infotrieve]
  30. Pompon, D., Louerat, B., Bronine, A., and Urban, P. (1996) Methods Enzymol. 272, 51–64[CrossRef][Medline] [Order article via Infotrieve]
  31. Omura, T., and Sato, R. (1964) J. Biol. Chem. 239, 2370–2378[Free Full Text]
  32. Blée, E., and Schuber, F. (1990) J. Biol. Chem. 265, 12887–12894[Abstract/Free Full Text]
  33. Pinot, F., Bosch, H., Salaün, J.-P., Durst, F., Mioskowski, C., and Hammock, B. D. (1997) Plant Physiol. Biochem. 35, 103–110
  34. Eglinton, G., Hunneman, D. H., and McCormick, A. (1968) Org. Mass Spectrom. 1, 593–611[CrossRef]
  35. Holloway, P. J. (1982) in The Plant Cuticle (Cutler, D. F., Alvin, K. L., and Price, C. E., eds) pp. 45–85, Academic Press, London
  36. Durst, F., and Nelson, D. (1995) Drug Metab. Drug Interact. 12, 189–206[Medline] [Order article via Infotrieve]
  37. Benveniste, I., Tijet, N., Adas, F., Philipps, G., Saläun, J.-P., and Durst, F. (1998) Biochem. Biophys. Res. Commun. 243, 688–693[CrossRef][Medline] [Order article via Infotrieve]
  38. Cabello-Hurtado, F., Batard, Y., Salaün, J.-P., Durst, F., Pinot, F., and Werck-Reichhart, D. (1998) J. Biol. Chem. 273, 7260–7267[Abstract/Free Full Text]
  39. Kato, T., Yamaguchi, Y., Abe, N., Uyehara, T., Namai, T., Kodama, M., and Shiobara, Y. (1985) Tetrahedron Lett. 26, 2357–2360[CrossRef]
  40. Ohta, H., Shida, K., Peng, Y. L., Furusawa, I., Shishiyama, J., Aibara, S., and Morita, Y. (1991) Plant Physiol. 97, 94–98[Abstract/Free Full Text]
  41. Masui, H., Kondo, T., and Kojima, M. (1989) Phytochemistry 28, 2613–2615[CrossRef]
  42. Summerer, S., Hanano, A., Utsumi, S., Arand, M., Schuber, F., and Blée, E. (2002) Biochem. J. 366, 471–480[CrossRef][Medline] [Order article via Infotrieve]
  43. Afitlhile, M. M., Fukushige, H., and Hildebrand, D. (2004) Phytochemistry 65, 2679–2684[Medline] [Order article via Infotrieve]
  44. Kong, L., Anderson, J. M., and Ohm H. W. (2005) Genome 48, 29–40[Medline] [Order article via Infotrieve]
  45. Kahn, R. A., LeBouquin, R., Pinot, F., Benveniste, I., and Durst, F. (2001) Arch. Biochem. Biophys. 39, 180–187
  46. CaJacob, C. A., Chang, W. K., Shephard, E., and Ortiz de Montellano, P. R. (1988) J. Biol. Chem. 263, 18640–18649[Abstract/Free Full Text]
  47. Cross, J. W., Herzmark, P., Guilford, W. L., Patterson, T. G., and Labovitz, J. N. (1992) Pestic. Biochem. Physiol. 44, 28–39[CrossRef]
  48. Capdevila, J. H., Harris, R. C., and Falck, J. R. (2002) Cell. Mol. Life Sci. 59, 780–789[CrossRef][Medline] [Order article via Infotrieve]
  49. Qu, W., Bradbury, J. A., Tsao, C. C., Maronpot, R., Harry, G. J., Parker, C. E., Davis, L. S., Breyer, M. D., Waalkes, M. P., Falck, J. R., Chen, J., Rosenberg, R. L., and Zeldin, D. C. (2001) J. Biol. Chem. 276, 25467–25479[Abstract/Free Full Text]
  50. Chuang, S. S., Helvig, C., Taimi, M., Ramshaw, H. A., Collop, A. H., Amad, M., White, J. A., Petkovich, M., Jones, G., and Korczak, B. (2004) J. Biol. Chem. 279, 6305–6314[Abstract/Free Full Text]
  51. McGiff, J. C., and Quilley, J. (1999) Am. J. Physiol. 277, 607–623
  52. Carroll, M. A., Balazy, M., Margiotta, P., Huang, D. D., Falck, J. R., and McGiff, J. C. (1996) Am. J. Physiol. 271, R863–R869
  53. Corcos, L., and Lagadic-Gossmann, D. (2001) Pharmacol. Toxicol. 89, 113–122[CrossRef][Medline] [Order article via Infotrieve]
  54. Kawamoto, T., Sueyoshi, T., Zelko, I., Moore, R., Washburn, K., and Negishi, M. (1999) Mol. Cell. Biol. 19, 6318–6322[Abstract/Free Full Text]
  55. Maitra, S., Dombrowski, S. M., Waters, L. C., and Ganguly, R. (1996) Gene (Amst.) 180, 165–171[CrossRef][Medline] [Order article via Infotrieve]
  56. Helvig, C., Tijet, N., Feyereisen, R., Walker, A., and Restifo, L. (2004) Biochem. Biophys. Res. Commun. 325, 1495–1502[Medline] [Order article via Infotrieve]
  57. McFadden, J. J., Gronwald, J. W., and Eberlein, C. V. (1990) Biochem. Biophys. Res. Commun. 168, 206–213[CrossRef][Medline] [Order article via Infotrieve]
  58. Theodoulou, F. L., Clark, I. L., Pallett, K. E., and Hallahan, D. L. (1999) Plant Physiol. 119, 1567[Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Plant Physiol.Home page
S. Greer, M. Wen, D. Bird, X. Wu, L. Samuels, L. Kunst, and R. Jetter
The Cytochrome P450 Enzyme CYP96A15 Is the Midchain Alkane Hydroxylase Responsible for Formation of Secondary Alcohols and Ketones in Stem Cuticular Wax of Arabidopsis
Plant Physiology, November 1, 2007; 145(3): 653 - 667.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
L. Huang, Q. Sun, F. Qin, C. Li, Y. Zhao, and D.-X. Zhou
Down-Regulation of a SILENT INFORMATION REGULATOR2-Related Histone Deacetylase Gene, OsSRT1, Induces DNA Fragmentation and Cell Death in Rice
Plant Physiology, July 1, 2007; 144(3): 1508 - 1519.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/43/35881    most recent
M500918200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kandel, S.
Right arrow Articles by Pinot, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kandel, S.
Right arrow Articles by Pinot, F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement