Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M506309200 on September 20, 2005

J. Biol. Chem., Vol. 280, Issue 46, 38682-38688, November 18, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/46/38682    most recent
M506309200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, Y.
Right arrow Articles by Zhou, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, Y.
Right arrow Articles by Zhou, D.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Recognition and Ubiquitination of Salmonella Type III Effector SopA by a Ubiquitin E3 Ligase, HsRMA1*

Ying Zhang1, Wendy Higashide1, Shipan Dai, Debra M. Sherman, and Daoguo Zhou2

From the Department of Biological Sciences, Purdue University, West Lafayette, Indiana 47907

Received for publication, June 9, 2005 , and in revised form, August 24, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Salmonella translocate bacterial effectors into host cells to confer bacterial entry and survival. It is not known how the host cells cope with the influx of these effectors. We report here that the Salmonella effector, SopA, interacts with host HsRMA1, a ubiquitin E3 ligase with a previously unknown function. SopA is ubiquitinated and degraded by the HsRMA1-mediated ubiquitination pathway. A sopA mutant escapes out of the Salmonella-containing vacuoles less frequently to the cytosol than wild type Salmonella in HeLa cells in a HsRMA1-dependent manner. Our data suggest that efficient bacterial escape into the cytosol of epithelial cells requires HsRMA1-mediated SopA ubiquitination and contributes to Salmonella-induced enteropathogenicity.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Pathogenic Salmonella cause food poisoning, gastrointestinal inflammation, typhoid fever, and septicemia in humans. Salmonella enterica serovar typhimurium (S. typhimurium) encodes two Type III secretion systems within the Salmonella pathogenicity islands 1 and 2 (SPI-13 and SPI-2) that are required for Salmonella entry and subsequent survival inside the host, respectively (1-5). Among the secreted proteins in SPI-1, SipA, SipC, SopE, SopE2, and SopB (also known as SigD) were found to be responsible for promoting bacterial entry by modulating the host actin cytoskeleton (6-11). SPI-2 effectors are responsible for subsequent Salmonella survival inside the host cells by modulating bacterial trafficking (12-16). In addition, SPI-1 effectors SipA, SopA, SopB, SopD, SopE, and SopE2 are largely responsible for inducing inflammation and diarrhea in animal models (17-19) through yet undefined mechanisms.

Ubiquitination is the main protein degradation pathway that governs a variety of cellular processes including cell cycle, vesicle trafficking, and signal transduction (20). Ubiquitination involves a multienzyme cascade consisting of classes of enzymes known as E1 (ubiquitin-activating enzyme), E2 (ubiquitin-conjugating enzyme), and E3 (ubiquitin protein ligase) (20). Ubiquitinated proteins are either rapidly degraded by the 26 S proteasome (21) or targeted to various specific cellular compartments (20, 22). The ubiquitin ligases (E3) play pivotal roles in defining the specificity of proteins targeted for ubiquitination.

HsRMA1 (RING finger protein with membrane anchor, also named RNF5) is a newly identified membrane-bound ubiquitin E3 ligase belonging to the novel RING finger protein family (23-26). HsRMA1 is well conserved in higher eukaryotes but not present in the yeast genome. It has been reported that Arabidopsis thaliana AtRMA1 is able to complement the yeast temperature-sensitive, secretion-deficient sec15 mutation (23). One of the late-acting sec genes is sec15, which is involved in the vesicle trafficking from the Golgi to the plasma membrane (27, 28). Recently, HsRMA1 was reported to interact with paxillin to alter the localization of paxillin to regulate cell motility (29). The importance of ubiquitination in the secretory pathway and endocytosis has also been described (20). These studies suggest that HsRMA1 might complement the sec15 mutation by regulating certain factors involved in vesicle trafficking.

Previous studies have shown that Salmonella type III effector protein SopB is ubiquitinated in the host cells (30). More recently, another type III effector protein, SopE, was shown to be rapidly degraded by a proteasome-mediated pathway (31). Despite these advances, the fate of the translocated bacterial proteins and how the host cells reorganizes and copes with the infusion of "foreign" proteins are still largely unknown. We report here that Salmonella type III secreted protein, SopA, is recognized, ubiquitinated, and degraded through the HsRMA1-mediated ubiquitination pathway.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Bacterial Strains—The wild type S. typhimurium strain SL1344 has been previously described (32). The sopA in-frame deletion mutant strain (ZP3) was constructed by introducing an in-frame deletion of SopA into the wild type Salmonella strain, SB300, retaining the first three and last two amino acids of SopA using a suicide vector (33, 34).

Yeast Two-hybrid Screening—The Gal4-based yeast two-hybrid system was used following standard procedures (35). The bait plasmid (pZP61) was constructed by fusing the entire coding sequence of SopA to the yeast Gal4 binding domain in pGBT9c (35). A human HeLa cell cDNA library, which was constructed by oligo(dT) priming in pGADGH (Clontech Laboratories, Palo Alto, CA), was kindly provided by Xosé Bustelo (SUNY at Stony Brook, Stony Brook, NY). A total of 5 x 105 transformants were screened in the yeast indicator strain Y153 using the co-transformation protocol as described (Clontech Laboratories). Clones that grow on the Yeast Synthetic Drop-Out Media lacking histidine and exhibited positive {beta}-galactosidase in the filter lift assay were chosen for further analysis.

Construction of Plasmids and Transfection of Eukaryotic Cells—Plasmid pZP188 (sopA complementing plasmid) was constructed by cloning the entire coding region of SopA (2346 bp) into pBAD derivative, pSB1136 (36), resulting in a SopA-M45 fusion. A plasmid expressing YFP-HsRMA1 was constructed by cloning the entire HsRMA1 coding sequence into the tagging vector pEYFP-C1. An E3 ligase-deficient mutant of HsRMA1 was constructed by mutating the cysteine residue to a serine residue (C42S) (24) using a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). To purify recombinant HsRMA1 and SopA proteins from Escherichia coli, HsRMA1 fused to the maltose-binding protein (MBP-HsRMA12-164) was constructed by cloning the C-terminal deletion construct into expression vector pIADL16 (37). SopA fused to the glutathione S-transferase (GST-SopA56-782) was constructed by fusing the SopA coding sequence into pGEX-KG (38). COS-1 cells were maintained at 37 °C and 5% CO2 in Dulbecco's modified Eagle's medium containing 5% fetal bovine serum. HeLa cells were maintained at 37 °C and 5% CO2 in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum. Cells were transfected with plasmids by using FuGENE 6 (Roche Applied Science) according to the manufacturer's instructions. MG132 proteasome inhibitor (25 µM) (Sigma) was added 6 h before cell harvesting where appropriate. In co-transfection experiments plasmids encoding YFP-SopA together with pEYFP-C1 vector, YFP-HsRMA1, or YFP-HsRMA1 C42S were introduced into COS-1 or HeLa cells and analyzed by Western blotting with an anti-GFP antibody (Sigma). To assess the effect of MG132 or HsRMA1, we optimized the minimum amount of plasmid to get detectable amounts of SopA in the presence and absence of MG132 in COS-1 cells.

Fluorescence Staining—HeLa cells were infected with Salmonella strains as indicated. Infected cells were fixed with 3.7% formaldehyde in phosphate-buffered saline (PBS) for 15 min and permeabilized with 0.2% Triton X-100 in PBS. Bacteria were identified with antibodies (Difco) against Salmonella O-antigen (39). Anti-LAMP2 antibodies were obtained from the Developmental Studies Hybridoma Bank, the University of Iowa (Iowa City, IA). All images represent black and white projections of z-section slices obtained on a Zeiss AxioVert 200 M deconvolution microscope. Pseudo colors were added using Adobe Photoshop.

Purification of Recombinant Proteins from E. coli—We purified recombinant HsRMA1 and SopA proteins from E. coli BL21(DE3)-expressing HsRMA1 fused to the maltose-binding protein (MBP-HsRMA12-164) (37) and SopA fused to the glutathione S-transferase (GST-SopA56-782) (38) using amylose resin (New England Biolabs, Beverly, MA) and the glutathione-Sepharose 4B (Amersham Biosciences), respectively. All purified proteins were dialyzed extensively and resuspended in Dulbecco's phosphate-buffered saline with 2 mM dithiothreitol.

In Vitro SopA Ubiquitination and Degradation Assay—In vitro ubiquitination experiments were carried out as described (24). Briefly, a reaction mixture (20 µl) containing 40 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 2 mM ATP, 2 mM dithiothreitol, 300 ng/µl ubiquitin (Sigma), 0.1 µM E1 (Boston Biochem, Boston, MA), 0.5 µM UbcH5a (Boston Biochem), 200 ng MBP-RMA1 or MBP-RMA1(C42S), and 500 ng of GST-SopA or GST were incubated at 35 °C for the indicated times and subjected to Western blotting with anti-GST or anti-MBP antibodies (New England Biolabs). For examining SopA degradation, the 100-µl reaction mixture containing 40 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 2 mM ATP, 2 mM dithiothreitol, 300 ng/µl ubiquitin (Sigma), 5 µl of rabbit reticulocyte lysate (Promega, Madison WI), 600 ng of GST-SopA in the absence or presence of 1 µg of MBP-HsRMA1 was incubated at 35 °C. At the indicated times, 20-µl samples were taken from each reaction mixture and analyzed by Western blotting.

HsRMA1 siRNA—HsRma1 siRNA expression plasmids were constructed by using pSilencer 2.1 (Ambion, Inc., Austin, TX) together with a pair of 63-bp oligonucleotides, each containing a unique 19-bp HsRma1 sequence: 5'-GATCCAGCTGGGATCAGCAGAGAGTTCAAGAGACTCTCTGCTGATCCCAGCTTTTTTTGGAAA-3'; 5'-AGCTTTTCCAAAAAAAGCTGGGATCAGCAGAGAGTCTCTTGAACTCTCTGCTGATC CCAGCTG-3'. The sequence of HsRma1 was empirically selected and did not show significant homology with any gene with a BLAST search. The oligonucleotides were annealed and ligated into pSilencer 2.1 between the BamHI and HindIII sites. For negative control, a scrambled siRNA hairpin was placed into the same sites in pSilencer 2.1.

Transmission Electron Microscopy—HeLa cells were infected at a multiplicity of infection of 3 with wild type Salmonella for 6 h. Infected cells were fixed with 2% glutaraldehyde in 0.1 M cacodylate buffer, pH 7.4, supplemented with 2 mM MgCl2, 1 mM CaCl2, and 0.25% NaCl. After washing with buffer followed by water, cells were fixed again with reduced osmium (1% OsO4 + 1.5% K3Fe(CN)6 in distilled water). Fixations were carried out in a Pella Model 3451 Scientific Microwave with variable wattage and a cold-spot attachment (Ted Pella, Inc. Redding, CA) at settings of 182 watts and 5 mm Hg vacuum using 40 s for each fixation step with 30 s rest (40). Samples were then dehydrated through a graded ethanol series and infiltrated through a graded ethanol/resin series followed by 3 changes of 100% LX-112 epoxy resin with accelerator (LADD Research Industries, Burlington, VT). They were then allowed to polymerize for 48 h at 60 °C. Polymerized cells were thin sectioned horizontally to the plate surface. Samples were stained with uranyl acetate and lead citrate and imaged at 80 kV using a Philips CM-10 Biotwin TEM (FEI Company, Hillsboro, OR).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Interaction of Salmonella Type III Effector SopA with HsRMA1, an E3 Ubiquitin Ligase—S. typhimurium SopA has been shown to be translocated into the host cells and to play a key role in the induction of enteritis (17, 19), but its biochemical and cellular functions are not known. In a search for host cellular proteins that interact with SopA, we conducted a yeast two-hybrid screening (41) of a human HeLa cell cDNA library using a fusion of the DNA binding domain of GAL4 and full-length SopA (GAL4BD-SopA) as bait. Four independent clones were identified as encoding the full-length human RMA1 (HsRMA1), which specifically interacts with the GAL4BD-SopA chimeric protein (Fig. 1). This interaction was further confirmed by a GST pull-down assay (data not shown). To determine the region of SopA that is responsible for interacting with HsRMA1, a series of SopA deletions was constructed. We found that amino acids 56-470 were sufficient for mediating the SopA-HsRMA1 interaction (Fig. 1B).

HsRMA1 Mediates the Ubiquitination of Salmonella SopA—HsRMA1 is a membrane-bound ubiquitin E3 ligase belonging to the RING finger protein family (23-26). Ubiquitination and protein degradation govern a variety of eukaryotic cellular processes including cell cycle, vesicle trafficking, and signal transduction (20). The interaction of SopA with HsRMA1 suggested that SopA may serve as the substrate for host HsRMA1-mediated ubiquitination. To test this hypothesis, an in vitro ubiquitination assay was conducted using purified recombinant MBP-HsRMA1 as the E3 and GST-SopA as the substrate (24). As shown in Fig. 2A, prominent polyubiquitinated SopA was detected in the presence of MBP-HsRMA1. As a negative control, GST or GST-SopA307-782, which does not interact with HsRMA1, was used in place of GST-SopA in identical reactions, and no ubiquitination was observed, indicating that the HsRMA1-mediated ubiquitination is specific to SopA (Fig. 2A).

The RING Finger Domain of HsRMA1 Is Required for the Ubiquitination of SopA—RING finger proteins feature a series of histidine and cysteine residues that are characteristically spaced (42). A conserved cysteine in the RING finger domain is required for the in vitro ubiquitin ligase activity of HsRMA1 (24). To further confirm that HsRMA1 functions as an E3 for SopA, we made the cysteine-to-serine point mutation at position 42 (C42S) in HsRMA1. We first verified that the wild type HsRMA1 exhibited prominent ubiquitination activity and that the mutated HsRMA1(C42S) had lost its ligase activity completely (Fig. 2B). We then examined the HsRMA1-mediated ubiquitination of SopA using purified MBP-HsRMA1(C42S) as the E3. In contrast to the wild type HsRMA1, MBP-HsRMA1(C42S) failed to induce the formation of poly-ubiquitinated SopA (Fig. 2B). These data indicate that the RING finger domain of HsRMA1 is required for the polyubiquitination of SopA.



View larger version (62K):
[in this window]
[in a new window]
  		FIGURE 1.
Interaction of SopA with HsRMA1 in the yeast two-hybrid assay. Plasmids expressing full-length (#2 and #6), truncated SopA56-782 (#1 and #5), and SipA446-684 (#3 and #4) fused to the GAL4 binding domain were transformed into yeast strain Y153 expressing a fusion between the GAL4 activation domain and HsRMA1 (#1, #2, and #4) or the human plastin clone (#3, #5, and #6). Yeast strains expressing the above plasmid combinations were streaked on SD-Leu-Trp (-LW) or -Leu-Trp-His+15 mM 3-AT (-LWH) media. Quantitative {beta}-galactosidase activities were measured from yeast grown in SD-Leu-Trp and expressed in Miller units.

 
HsRMA1 Accelerates the Degradation of SopA in Vitro and in Vivo—To determine whether ubiquitinated SopA is degraded by the proteasome, we examined the stability of SopA using an in vitro ubiquitination/degradation assay. Identical amounts of GST-SopA were added to each reaction containing rabbit reticulocyte lysates in the presence or absence of MBP-HsRMA1. The amount of GST-SopA was monitored by Western blot (Fig. 3A). There was a gradual degradation of GST-SopA in the reticulocyte lysate, probably due to endogenous HsRMA1 activity and/or other proteinases. GST-SopA degradation was accelerated, however, when MBP-HsRMA1 was included in the reaction, indicating that HsRMA1-mediated GST-SopA ubiquitination contributed to the degradation of GST-SopA in vitro.

To further examine the role of the HsRMA1-mediated ubiquitin-proteasome pathway in SopA degradation in vivo, the effect of the proteasome inhibitor MG132 on SopA protein levels after transient transfection of mammalian cells was examined. COS-1 cells were transiently transfected with plasmids expressing either YFP-SopA56-782 or the truncated YFP-SopA307-782, which does not interact with HsRMA1. After 24 h, MG132 or Me2SO (as a control) was added for 6 h, and the amount of YFP-SopA was determined by Western blot (Fig. 3B). Actin was also measured in the same blot as a negative control. The amount of YFP-SopA56-782 was dramatically lower in the absence of MG132 as compared with that with MG132. In contrast, there was no significant change of YFP-SopA307-782.

To determine whether the amount of the SopA was affected by HsRMA1 E3 ligase activity in vivo, we performed a double-transfection experiment. Plasmids expressing either YFP-SopA56-782 or YFP-SopA307-782 were co-transfected with wild type HsRMA1 or the catalytically dead HsRMA1(C42S) mutant, and the amounts of YFP-SopA56-782 and YFP-SopA307-782 were evaluated by Western blotting. The level of YFP-SopA56-782 was markedly decreased when co-transfected with plasmid expressing the wild type HsRMA1 (Fig. 3C), but there was no change in the amount of YFP-SopA56-782 when the catalytically dead HsRMA1(C42S) mutant was used (Fig. 3C). In contrast, the amount of actin or YFP remained constant with and without HsRMA1 (Fig. 3C and data not shown). No significant change was observed when YFP-SopA307-782, which does not interact with HsRMA1, was used in the reaction (Fig. 3C).

SopA Is Involved in Salmonella Escape into the Cytosol of HeLa Cells—It has been shown that the A. thaliana RMA1 (AtRMA1) was able to complement the yeast secretion-deficient sec15 mutation (23). The sec15 gene is one of the late-acting sec genes involved in the vesicle trafficking from the Golgi to the plasma membrane (27, 28). The importance of ubiquitination in the secretory pathway and endocytosis is well documented (20). It is known that Salmonella replicate inside vacuoles and multiply more rapidly in the cytosol of epithelial cells (43-46). However, it is not clear how Salmonella escape into the cytosol or whether the escape plays a role in pathogenesis. To examine whether Salmonella escape into the cytosol under our experimental conditions, HeLa cells were infected with the wild type Salmonella or the sopA mutant strain for 6 h, and intracellular bacteria were examined for surrounding membranes by transmission electron microscopy (Fig. 4A). Numerous bacteria were found within membrane-bound vacuoles, and some also appeared to be free in the cytosol in both the wild type and the sopA mutant-infected cells (Fig. 4A and data not shown).

Upon entry Salmonella-containing vacuoles (SCVs) acquire early endosome markers followed by selective accumulation of the lysosomal glycoproteins, LAMP1, LAMP2, and CD63 (47-49). To examine whether SopA and the host ubiquitination pathway play any role in Salmonella trafficking in epithelial cells, HeLa cells were infected with either wild type Salmonella or the sopA mutant strain. Intracellular bacteria were examined for the acquisition of the LAMP2 markers to determine whether the bacteria were inside the vacuoles (45, 46) (Fig. 4, B and C). The distribution of LAMP2-positive and LAMP2-negative bacteria was similar between the wild type and the sopA mutant strain 2 h after infection. However, there were significantly fewer LAMP2-negative bacteria (for cells containing greater than 20 bacteria) in cells infected with the sopA mutant strain compared with cells infected with the wild type (p = 0.0010, two-tailed Student's t test) 6 h post-infection. This difference was not observed when the sopA strain was complemented by a plasmid expressing the full-length SopA or when MG132 was added to the media to inhibit the proteasome activity (Fig. 4, B and C, and data not shown).

It has been reported that Salmonella replicate more rapidly within the cytoplasm of epithelial cells as compared with inside the vacuoles (45, 46). To investigate whether differences in LAMP2 acquisition correlated with the total number of intracellular bacteria, HeLa cells were similarly infected with either wild type Salmonella or the sopA mutant strain. The number of bacteria was enumerated 2 and 6 h after infection (Fig. 4D and data not shown). The number of bacteria was similar 2 h after infection, but at 6 h after infection there were more cells with more than 20 bacteria for the wild type than for the sopA mutant strain (p = 0.012).

The reduced number of sopA mutant bacteria in the cytosol may be due either to a defect in cytosolic replication or to a reduction in escape from SCVs. To differentiate between these two possibilities, we infected HeLa cells with a sifA mutant strain, which is defective in maintaining the integrity of SCVs (13). In addition, the cells were infected with a sifAsopA double-mutant strain. If SopA plays a role in cytosolic replication, there should be a greater reduction in the number of cytosolic bacteria in HeLa cells infected with the sifAsopA mutant strain than in those infected with the sifA mutant strain. We observed no difference in the number of LAMP2-negative bacteria or in the total intracellular bacteria in HeLa cells infected with the sifA and sifAsopA mutant strains 2 and 6 h post-infection (data not shown). There appears to be no defect in the cytosolic replication of the sopA mutant in HeLa cells; thus, the reduced number of cytosolic bacteria must be due to a defect in the escape from vacuoles.



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 2.
Salmonella SopA is a substrate for HsRMA1-mediated ubiquitination in vitro. A, combinations of ubiquitin (Ub), E1, ubcH5a, MBP-HsRMA1, GST-SopA56-782, GST or GST-SopA307-782 were incubated at 35 °C. Samples were taken at 0 and 2 h and processed by Western blot using anti-GST antibodies. B, the E3 ligase activity of HsRMA1 is required for mediating the ubiquitination of SopA. Reaction mixtures containing ubiquitin, E1, UbcH5a were incubated with either wild type HsRMA1 or HsRMA1(C42S), and the immunoblot was performed using an anti-MBP antibody (left panel). Reaction mixtures containing ubiquitin, E1, and UbcH5a were incubated with SopA alone, SopA with wild type HsRMA1, or with HsRMA1(C42S), and a Western blot was done using an anti-GST antibody (right panel).

 



View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 3.
HsRMA1-dependent degradation of SopA both in vitro and in vivo. A, HsRMA1 accelerates the degradation rate of SopA in rabbit reticulocyte lysates. The reaction mixture containing 2 mM ATP, 2 mM dithiothreitol, rabbit reticulocyte lysate, and GST-SopA was incubated with or without HsRMA1 for 1 or 2 h. The Western blot was performed using an anti-GST antibody. B, the amount of SopA is regulated by the ubiquitin-proteasome pathway. COS-1 cells were transiently transfected with plasmids expressing YFP-SopA56-782 or YFP-SopA307-782. Twenty-four hours after transfection, cells were treated with MG132 (25 mM) or Me2SO for 6 h. Cell lysates were fractionated on SDS-PAGE, and the Western blot was performed using anti-GFP antibody. C, expression of HsRMA1 down-regulates SopA in vivo. COS-1 cells were co-transfected with plasmids expressing YFP-SopA56-782 or YFP-SopA307-782 together with a vector control, HsRMA1, or HsRMA1(C42S). Cells were harvested 24 h after transfection, and a Western blot was performed using anti-GFP antibody. D, E, and F represent the quantification for panels A, B, and C, respectively, using ImageQuant software.

 
Suppression of HsRMA1 Expression Affects Efficient Salmonella Escape into the Host Cell Cytosol—To further analyze the role of HsRMA1 in Salmonella trafficking, we used siRNA to suppress the endogenous levels of HsRMA1 in HeLa cells. We failed to detect endogenous HsRMA1 in all the cell lines tested, presumably due to its short half-life or low level of expression. To assess the effectiveness of our HsRMA1 siRNA, we cotransfected a plasmid encoding YFP-HsRMA1 with a plasmid encoding HsRMA1 siRNA or a control vector encoding the scrambled siRNA into HeLa cells (Ambion). The expression of YFP-HsRMA1 was examined by monitoring YFP under the fluorescent microscope (Fig. 5A) or by Western blotting (Fig. 5B). Our data showed that the HsRMA1 siRNA effectively suppressed the expression of YFP-HsRMA1. We then transfected HeLa cells with a plasmid encoding HsRMA1 siRNA or a control vector encoding the scrambled siRNA. Transfected cells were then infected with wild type or the sopA mutant Salmonella and examined for the acquisition of the LAMP2 marker as described above (Fig. 5C). The distribution of LAMP2-positive (data not shown) and LAMP2-negative bacteria was similar 2 h after infection for cells transfected with the plasmid encoding HsRMA1 siRNA and the control vector encoding scrambled siRNA (Fig. 5C and data not shown). However, there were significantly fewer LAMP2-negative bacteria (>20) in cells transfected with the plasmid encoding HsRMA1 siRNA compared with cells transfected with the control vector (p = 0.0171) 6 h post-infection when infected with the wild type Salmonella. No significant difference was observed when infected with the sopA mutant Salmonella. This result further supports our hypothesis that HsRMA1-mediated SopA ubiquitination contributes to Salmonella escape into the cytosol of HeLa cells.



View larger version (76K):
[in this window]
[in a new window]
  		FIGURE 4.
The role of SopA in Salmonella trafficking and replication in HeLa cells. HeLa cells were infected at a multiplicity of infection of 3 with wild type Salmonella, sopA null mutant, or sopA containing a complementing plasmid expressing full-length SopA. A, bacteria were visualized by transmission electron microscopy. Arrows indicate membrane-surrounded bacteria, and arrowheads indicate cytosolic bacteria. B, bacteria were visualized by staining with an anti-LPS antibody (red in B1, B2, B5, and B6). LAMP2 was detected with a mouse anti-LAMP2 (H4B4) antibody (green in B3, B4, B5, and B6). DNA was stained with 4,6-diamidino-2-phenylindole (blue in B1, B2, B5, and B6). Arrows indicate LAMP2-positive bacteria and arrowheads indicate LAMP2-negative bacteria. Images represent black and white projections of z-section slices obtained on a Zeiss AxioVert 200M deconvolution microscope. Pseudo colors were added using Adobe Photoshop. C, quantitation of LAMP2-positive and LAMP2-negative bacteria by immunofluorescent microscopy. The number of HeLa cells containing more than 20 LAMP2-negative sopA bacteria was significantly lower than that of wild type or sopA(psopA) (p = 0.001). D, total number of intracellular bacteria as measured by immunofluorescent microscopy. The number of HeLa cells containing more than 20 sopA mutant Salmonella was significantly lower than the wild type or sopA(psopA) strain (p = 0.012) at 6 h. Quantitative analysis includes three independent experiments (a minimum of 500 cells were counted from each experiment) with S.E. shown.

 



View larger version (50K):
[in this window]
[in a new window]
  		FIGURE 5.
The role of HsRMA1 in Salmonella escape in HeLa cells. A, HeLa cells were co-transfected with YFP-HsRma1 together with plasmid expressing the control siRNA (A1 and A2) or HsRma1 siRNA (A3 and A4). Cells were then visualized under a fluorescent microscope. The expression level of YFP-HsRma1 is dramatically reduced when co-expressed with HsRma1 siRNA (A3 versus A1). Phase contrast images (A2 and A4) are shown for total cell density. B, expression level of YFP-HsRma1 is also examined by Western blot using anti-GFP antibody. Total actin was used as the loading control. C, quantitative analysis of LAMP2-negative bacteria in HeLa cells transfected with HsRMA1 siRNA. HeLa cells were transfected with plasmids expressing HsRMA1 siRNA or the control siRNA for 24 h. Cells were then infected with wild type or sopA mutant Salmonella for 15 min at a multiplicity of infection of 10. Transfected cells were examined for LAMP2 staining, which was detected with a mouse anti-LAMP2 (H4B4) antibody. Bacteria were visualized by staining with anti-LPS antibody. Quantitative analysis includes three independent experiments (a minimum of 500 cells were counted from each experiment) with S.E. shown.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Although significant progress has been made toward the understanding of Salmonella invasion of non-phagocytic cells and its survival in phagocytic cells, little is known about how Salmonella induce diarrhea in infected animals. We observed a reduced numbers of sopA mutant bacteria in the cytosol of HeLa cell 6 h after infection compared with that of the wild type strains. We further determined that HeLa cells infected with a sifA mutant strain that is defective in maintaining the integrity of SCVs (13) showed a degree of escape, and the total number of bacteria compare similarly to cells infected with a sifAsopA double mutant strain. This leads us to conclude that there is no defect in the cytosolic replication of the sopA mutant in HeLa cells and that the reduced number of cytosolic bacteria must be due to a defect in the escape from the SCVs. We also examined Salmonella escape into the cytosol by transmission electron microscopy and found numerous bacteria in the cytosol in both the wild type and the sopA mutant-infected cells. However, our data do not indicate when and how this escape occurs. Because SopA has been shown to be required for inducing inflammation and diarrhea in animal models (17-19), we speculate that Salmonella escape and subsequent replication in the cytosol contribute to diarrhea.



View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 6.
A working model depicting the role of SopA in Salmonella escape into the cytosol of HeLa cells. Upon contact with the host cells, Salmonella translocate a panel of type III effector proteins to promote bacteria entry. Most of the intracellular Salmonella remain in a membrane-enclosed compartment, whereas a small percentage escapes into the cytosol. We speculate that HsRMA1-mediated ubiquitination (Ub) of SopA promotes this escape and the eventual degradation of SopA by the proteasome pathway. Escaped cytosolic Salmonella replicate rapidly in the cytoplasm of HeLa cells.

 
Ubiquitination pathways play important roles in regulating protein levels either constitutively or in response to the external environment. Our study suggests that Salmonella have evolved to not only inject bacterial effector proteins into host cells but also to manage their ubiquitination state. Modulation of the ubiquitination of bacterial translocated effector proteins is consistent with the recent observation that SopB, a Salmonella type III-secreted membrane-associated inositol phosphatase, is indeed ubiquitinated inside the host cells (30). We identified the host ubiquitin E3 ligase that is responsible for mediating the ubiquitination of Salmonella SopA. Our data indicate that the ubiquitination of SopA serves as the signal for proteasome-mediated degradation. Interestingly, the HsRMA1-mediated ubiquitination seems to be involved in efficient Salmonella escape into the cytosol of HeLa cells through an unknown mechanism. Ubiquitination is known to play a role in both the secretory pathway and endocytosis process (20). Because Salmonella replicate both inside vacuoles and in the cytosol of epithelial cells (43-46), it is tempting to speculate that HsRMA1-mediated ubiquitination plays a role in the trafficking and maintenance of SCVs.

Our current study suggests a balanced strategy employed by Salmonella to inject bacterial proteins into the host cells and to program their destruction by the host ubiquitination pathways. Such a balanced strategy would enable Salmonella to continuously translocate bacterial proteins across the host cell membrane to secure its replication niche without disrupting host cellular functions that are detrimental to host cell survival. Further studies are needed to investigate whether SopA affects the ubiquitination pathways that regulate the ubiquitination of host proteins, which may be involved in vesicle trafficking, apoptosis, antigen presentation, and the host inflammatory response to microbial infection. A role of HsRMA1 in vesicle trafficking agrees with a recent report that HsRMA1 is able to suppress the temperature-sensitive sec15 mutation, which has a defect in exocytosis, although no RMA1 homolog is currently known in the yeast genome (23, 24). This complex interaction between Salmonella and the host cells by modulating the host ubiquitination pathway may represent a novel strategy employed by a group of intracellular pathogens to aid their survival in the host cells.

We showed that Salmonella SopA serves as the substrate for HsRMA1-mediated ubiquitination. However, we cannot rule out the possibility that SopA modulates the E3 ligase activity upon binding to HsRMA1. In fact, it is known that the E6 proteins of human papilloma virus 16 and 18 interact with cellular E6-AP to facilitate the ubiquitination and degradation of the tumor-suppressor protein p53 (50-53). Studies are under way to determine whether SopA functions in a similar manner to enable HsRMA1 to interact with novel cellular substrates.

We propose a working model showing how host cells utilize and cope with SopA, one of the key Salmonella effector proteins involved in the induction of enteritis (Fig. 6). Soon after entry Salmonella remain in enclosed membrane compartments. Membrane-associated HsRMA1 mediates the ubiquitination of SopA. We speculate that the mono-ubiquitinated SopA promotes Salmonella escape from the SCVs either directly or through an unknown host factor. Subsequent polyubiquitination of SopA leads to the degradation of SopA by the host proteasome pathway. Cytosolic Salmonella then replicate rapidly in the host cells. This suggests that bacterial escape may contribute to Salmonella-induced enteropathogenicity. Interestingly, SopA ubiquitination also led to the degradation of SopA, suggesting a balanced interplay between Salmonella and the host cells to maintain a low level of SopA to accommodate normal host cellular functions. This demonstrates the intricate co-evolution of Salmonella and its host cells.


   FOOTNOTES
 
* This research was supported by National Institutes of Health Grant AI49978 (to D. Z.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 Both authors contributed equally. Back

2 To whom correspondence should be addressed. Tel.: 765-494-8159; Fax: 765-494-0876; E-mail: zhoud{at}purdue.edu.

3 The abbreviations used are: SPI, Salmonella pathogenicity island; E1, ubiquitin-activating enzyme; E3, ubiquitin protein ligase; GST, glutathione S-transferase; MBP, maltose-binding protein; siRNA, small interfering RNA; SCV, Salmonella-containing vacuole; YFP, yellow fluorescent protein. Back


   ACKNOWLEDGMENTS
 
We thank Dr. Arthur Aronson and Dr. Barry Wanner for fruitful discussions and Virginia Livingston for reading the manuscript.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Galán, J. E., and Curtiss, R. D. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 6383-6387[Abstract/Free Full Text]
  2. Vazquez-Torres, A., Xu, Y., Jones-Carson, J., Holden, D. W., Lucia, S. M., Dinauer, M. C., Mastroeni, P., and Fang, F. C. (2000) Science 287, 1655-1658[Abstract/Free Full Text]
  3. Hensel, M., Shea, J. E., Raupach, B., Monack, D., Falkow, S., Gleeson, C., Kubo, T., and Holden, D. W. (1997) Mol. Microbiol. 24, 155-167[CrossRef][Medline] [Order article via Infotrieve]
  4. Hensel, M., Shea, J. E., Waterman, S. R., Mundy, R., Nikolaus, T., Banks, G., Vazquez-Torres, A., Gleeson, C., Fang, F. C., and Holden, D. W. (1998) Mol. Microbiol. 30, 163-174[CrossRef][Medline] [Order article via Infotrieve]
  5. Shea, J. E., Beuzon, C. R., Gleeson, C., Mundy, R., and Holden, D. W. (1999) Infect. Immun. 67, 213-219[Abstract/Free Full Text]
  6. Zhou, D., Mooseker, M. S., and Galán, J. E. (1999) Science 283, 2092-2095[Abstract/Free Full Text]
  7. Chang, J., Chen, J., and Zhou, D. (2005) Mol. Microbiol. 55, 1379-1389[CrossRef][Medline] [Order article via Infotrieve]
  8. Hayward, R. D., and Koronakis, V. (1999) EMBO J. 18, 4926-4934[CrossRef][Medline] [Order article via Infotrieve]
  9. Hardt, W.-D., Chen, L.-M., Schuebel, K. E., Bustelo, X. R., and Galán, J. E. (1998) Cell 93, 815-826[CrossRef][Medline] [Order article via Infotrieve]
  10. Zhou, D., Chen, L. M., Hernandez, L., Shears, S. B., and Galán, J. E. (2001) Mol. Microbiol. 39, 248-259[CrossRef][Medline] [Order article via Infotrieve]
  11. Hong, K. H., and Miller, V. L. (1998) J. Bacteriol. 180, 1793-1802[Abstract/Free Full Text]
  12. Hansen-Wester, I., Stecher, B., and Hensel, M. (2002) Infect. Immun. 70, 1403-1409[Abstract/Free Full Text]
  13. Stein, M. A., Leung, K. Y., Zwick, M., Garcia-del Portillo, F., and Finlay, B. B. (1996) Mol. Microbiol. 20, 151-164[Medline] [Order article via Infotrieve]
  14. Guy, R. L., Gonias, L. A., and Stein, M. A. (2000) Mol. Microbiol. 37, 1417-1435[CrossRef][Medline] [Order article via Infotrieve]
  15. Uchiya, K., Barbieri, M. A., Funato, K., Shah, A. H., Stahl, P. D., and Groisman, E. A. (1999) EMBO J. 18, 3924-3933[CrossRef][Medline] [Order article via Infotrieve]
  16. Beuzon, C. R., Meresse, S., Unsworth, K. E., Ruiz-Albert, J., Garvis, S., Waterman, S. R., Ryder, T. A., Boucrot, E., and Holden, D. W. (2000) EMBO J. 19, 3235-3249[CrossRef][Medline] [Order article via Infotrieve]
  17. Zhang, S., Santos, R. L., Tsolis, R. M., Stender, S., Hardt, W. D., Baumler, A. J., and Adams, L. G. (2002) Infect. Immun. 70, 3843-3855[Abstract/Free Full Text]
  18. Hapfelmeier, S., Ehrbar, K., Stecher, B., Barthel, M., Kremer, M., and Hardt, W. D. (2004) Infect. Immun. 72, 795-809[Abstract/Free Full Text]
  19. Wood, M. W., Jones, M. A., Watson, P. R., Siber, A. M., McCormick, B. A., Hedges, S., Rosqvist, R., Wallis, T. S., and Galyov, E. E. (2000) Cell. Microbiol. 2, 293-303[CrossRef][Medline] [Order article via Infotrieve]
  20. Bonifacino, J. S., and Weissman, A. M. (1998) Annu. Rev. Cell Dev. Biol. 14, 19-57[CrossRef][Medline] [Order article via Infotrieve]
  21. Hough, R., Pratt, G., and Rechsteiner, M. (1987) J. Biol. Chem. 262, 8303-8313[Abstract/Free Full Text]
  22. Reggiori, F., and Pelham, H. R. (2002) Nat. Cell Biol. 4, 117-123[CrossRef][Medline] [Order article via Infotrieve]
  23. Matsuda, N., and Nakano, A. (1998) Plant Cell Physiol. 39, 545-554[Abstract/Free Full Text]
  24. Matsuda, N., Suzuki, T., Tanaka, K., and Nakano, A. (2001) J. Cell Sci. 114, 1949-1957[Abstract]
  25. Freemont, P. S. (2000) Curr. Biol. 10, 84-87[CrossRef]
  26. Kyushiki, H., Kuga, Y., Suzuki, M., Takahashi, E., and Horie, M. (1997) Cytogenet. Cell Genet. 79, 114-117[Medline] [Order article via Infotrieve]
  27. Salminen, A., and Novick, P. J. (1989) J. Cell Biol. 109, 1023-1036[Abstract/Free Full Text]
  28. TerBush, D. R., Maurice, T., Roth, D., and Novick, P. (1996) EMBO J. 15, 6483-6494[Medline] [Order article via Infotrieve]
  29. Didier, C., Broday, L., Bhoumik, A., Israeli, S., Takahashi, S., Nakayama, K., Thomas, S. M., Turner, C. E., Henderson, S., Sabe, H., and Ronai, Z. (2003) Mol. Cell. Biol. 23, 5331-5345[Abstract/Free Full Text]
  30. Marcus, S. L., Knodler, L. A., and Finlay, B. B. (2002) Cell. Microbiol. 4, 534-546
  31. Kubori, T., and Galan, J. E. (2003) Cell 115, 333-342[CrossRef][Medline] [Order article via Infotrieve]
  32. Hoiseth, S. K., and Stocker, B. A. (1981) Nature 291, 238-239[CrossRef][Medline] [Order article via Infotrieve]
  33. Dai, S., and Zhou, D. (2004) J. Bacteriol. 186, 5078-5086[Abstract/Free Full Text]
  34. Kaniga, K., Delor, I., and Cornelis, G. R. (1991) Gene (Amst.) 109, 137-141[CrossRef][Medline] [Order article via Infotrieve]
  35. Bartel, P. L., and Fields, S. (1995) Methods Enzymol. 254, 241-263[Medline] [Order article via Infotrieve]
  36. Hardt, W. D., Urlaub, H., and Galán, J. E. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 2574-2579[Abstract/Free Full Text]
  37. Lessard, I. A., Pratt, S. D., McCafferty, D. G., Bussiere, D. E., Hutchins, C., Wanner, B. L., Katz, L., and Walsh, C. T. (1998) Chem. Biol. (Lond.) 5, 489-504
  38. Guan, K.-L., and Dixon, J. E. (1991) Anal. Biochem. 192, 262-267[CrossRef][Medline] [Order article via Infotrieve]
  39. Dai, S., Sarmiere, P. D., Wiggan, O., Bamburg, J. R., and Zhou, D. (2004) Cell. Microbiol. 6, 459-471[CrossRef][Medline] [Order article via Infotrieve]
  40. Giberson, R. T., Austin, R. L., Charlesworth, J., Adamson, G., and Herrera, G. A. (2003) Ultrastruct. Pathol. 27, 187-196[CrossRef][Medline] [Order article via Infotrieve]
  41. Fields, S., and Song, O. (1989) Nature 340, 245-246[CrossRef][Medline] [Order article via Infotrieve]
  42. Pickart, C. M. (2001) Annu. Rev. Biochem. 70, 503-533[CrossRef][Medline] [Order article via Infotrieve]
  43. Perrin, A. J., Jiang, X., Birmingham, C. L., So, N. S., and Brumell, J. H. (2004) Curr. Biol. 14, 806-811[CrossRef][Medline] [Order article via Infotrieve]
  44. Brumell, J. H., Goosney, D. L., and Finlay, B. B. (2002) Traffic 3, 407-415[CrossRef][Medline] [Order article via Infotrieve]
  45. Brumell, J. H., Tang, P., Zaharik, M. L., and Finlay, B. B. (2002) Infect. Immun. 70, 3264-3270[Abstract/Free Full Text]
  46. Beuzon, C. R., Salcedo, S. P., and Holden, D. W. (2002) Microbiology 148, 2705-2715[Abstract/Free Full Text]
  47. Garcia-del Portillo, F., and Finlay, B. (1995) J. Cell. Biol. 129, 81-97[Abstract/Free Full Text]
  48. Meresse, S., Steele-Mortimer, O., Finlay, B. B., and Gorvel, J. P. (1999) EMBO J. 18, 4394-4403[CrossRef][Medline] [Order article via Infotrieve]
  49. Steele-Mortimer, O., Meresse, S., Gorvel, J. P., Toh, B. H., and Finlay, B. B. (1999) Cell. Microbiol. 1, 33-49[Medline] [Order article via Infotrieve]
  50. Scheffner, M., Werness, B. A., Huibregtse, J. M., Levine, A. J., and Howley, P. M. (1990) Cell 63, 1129-1136[CrossRef][Medline] [Order article via Infotrieve]
  51. Scheffner, M., Huibregtse, J. M., and Howley, P. M. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 8797-8801[Abstract/Free Full Text]
  52. Scheffner, M., Huibregtse, J. M., Vierstra, R. D., and Howley, P. M. (1993) Cell 75, 495-505[CrossRef][Medline] [Order article via Infotrieve]
  53. Huibregtse, J. M., Scheffner, M., and Howley, P. M. (1991) EMBO J. 10, 4129-4135[Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Infect. Immun.Home page
M. Hentschke, K. Trulzsch, J. Heesemann, M. Aepfelbacher, and K. Ruckdeschel
Serogroup-Related Escape of Yersinia enterocolitica YopE from Degradation by the Ubiquitin-Proteasome Pathway
Infect. Immun., September 1, 2007; 75(9): 4423 - 4431.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
K. D. Bromberg, H. M. Kluger, A. Delaunay, S. Abbas, K. A. DiVito, S. Krajewski, and Z. Ronai
Increased Expression of the E3 Ubiquitin Ligase RNF5 Is Associated with Decreased Survival in Breast Cancer
Cancer Res., September 1, 2007; 67(17): 8172 - 8179.
[Abstract] [Full Text] [PDF]

Home page
 Plant CellHome page
C.-W. Yang, R. Gonzalez-Lamothe, R. A. Ewan, O. Rowland, H. Yoshioka, M. Shenton, H. Ye, E. O'Donnell, J. D.G. Jones, and A. Sadanandom
The E3 Ubiquitin Ligase Activity of Arabidopsis PLANT U-BOX17 and Its Functional Tobacco Homolog ACRE276 Are Required for Cell Death and Defense
PLANT CELL, April 1, 2006; 18(4): 1084 - 1098.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/46/38682    most recent
M506309200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, Y.
Right arrow Articles by Zhou, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, Y.
Right arrow Articles by Zhou, D.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement