Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M504655200 on October 2, 2005

J. Biol. Chem., Vol. 280, Issue 47, 39152-39160, November 25, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/47/39152    most recent
M504655200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cui, R.
Right arrow Articles by Barton, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cui, R.
Right arrow Articles by Barton, M. C.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Family Members p53 and p73 Act Together in Chromatin Modification and Direct Repression of {alpha}-Fetoprotein Transcription*

Rutao Cui{ddagger}12, Thi T. Nguyen{ddagger}1, Joseph H. Taube{ddagger}1, Sabrina A. Stratton{ddagger}, Miriam H. Feuerman§, and Michelle Craig Barton{ddagger}3

From the {ddagger}Department of Biochemistry and Molecular Biology, Program in Genes and Development, Graduate School of Biological Sciences, University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030 and the §Department of Biochemistry, State University of New York Downstate Medical Center, Brooklyn, New York 11203

Received for publication, April 28, 2005 , and in revised form, September 28, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Aberrant expression of the {alpha}-fetoprotein (AFP) gene is a diagnostic tumor marker of hepatocellular carcinoma. We find that AFP gene expression is repressed by the TP53 family member p73 during normal hepatic development and when p73{alpha} or p73{beta} is introduced into cultured hepatoma cells that express AFP. Transient co-transfection of p53 family members showed that p53 and transactivating (TA)-p73, but not TA-p63, repress endogenous AFP transcription additively or independently. p53-independent functions of p73 are further supported by delayed, p73-associated compensation of AFP repression during development of the p53-null mouse. Chromatin immunoprecipitation assays of normal and p53-null mouse liver tissue showed that TA-p73 binds at a previously identified p53 repressor site (-860/-830) within the distal promoter of AFP at a level equivalent to p53 in wild type liver, with increased binding of TA-p73 to chromatin in the absence of p53. Sequential chromatin immunoprecipitation analyses revealed that TA-p73 and p53 bind simultaneously to their shared regulatory site in wild type liver. Like the founding family member p53, TA-p73 represses AFP expression by chromatin structure alteration, targeting reduction of acetylated histone H3 lysine 9 and increased dimethylated histone H3 lysine 9 levels. However, chromatin-bound TA-p73 is associated with elevated di- and tri-methylated histone H3 lysine 4 levels in p53-null liver and hepatoma cells, concomitant with a reduced ability to repress transcription compared with p53.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The p53 superfamily encompasses a number of p53-, p63-, and p73-specific isoforms, defined by their conserved domains and structural homology (1-3). Alternative splicing and/or divergent promoter usage can lead to considerable diversity in the composition of functional domains and regulatory motifs among specific family members. The most striking structural differences between p53 and p63/p73 include the extended C termini of full-length, transactivating (TA)4 isoforms, and the truncated N termini of the {Delta}N isoforms, of p63 and p73 (1). The TA isoforms of p63/p73 activate the transcription of specific, p53-regulated genes with functions in cell cycle arrest and apoptosis, as well as regulate other genes in a p53-independent manner. Dominant negative forms of p53, which lack DNA binding ability, may form heteromeric complexes with p73 or p63 (4) and interfere with p63/p73 function (5, 6). Although mutations of p63/p73 are not frequently associated with tumorigenesis (7, 8), correlations between aberrantly high levels of {Delta}N isoform expression and specific tumor formation have been reported (8, 9). Developmentally, {Delta}N-p73 plays an essential role in protection of embryonic neurons from p53-mediated cell death (10). These studies and the observed requirement for p63/p73 in p53-induced apoptosis in E1A-expressing mouse embryo fibroblasts suggest an intricate network of influence among the p53 family members (11).

The phenotypes of mice genetically engineered for the loss of the individual genes encoding p53, p63, and p73 vary considerably. p53-null mice have a predisposition for early tumor development, and most, but not all, develop normally to adulthood (12-14). Knock-out of the p63-encoding gene causes profound malfunction in epithelial development with severe abnormalities in limbs, skin, prostate, breast, and urothelia (15, 16). In the absence of p73 expression, mice exhibit neural defects and problems in inflammatory response and pheromone detection (1, 17).

Recently, loss of p63 and/or p73 has been shown to predispose mice toward the development of specific, spontaneous tumors. Mice, which are heterozygous for p53 loss and either p63 or p73+/-, have a higher tumor burden compared with p53+/- mice. Interestingly, 15% of p53+/-,p73+/- mice develop hepatocellular carcinoma (HCC), but none of the mice heterozygous for p53, p63, or p73 alone nor any of the p53+/-,p63+/- mice displayed HCC (18). These findings suggest that members of the p53 superfamily have tissue-specific functions in regulation of gene expression and tumor suppression, in addition to any overlapping activities caused by conservation of sequence and structure (9).

We have focused on transcription repression of the HCC-associated tumor marker AFP as a model for p53 function during development of the liver. AFP is highly expressed during fetal liver development but is rapidly repressed within a few weeks after birth. Expression of AFP in adult liver is reactivated only in cases of renewed cellular proliferation, as occurs during liver regeneration and HCC (19, 20). Additionally, aberrant expression of AFP protein during HCC induces apoptosis of dendritic cells, and studies of patients with HCC show that levels of serum AFP are inversely proportional to tumor necrosis factor-{alpha} production (21). The tumor spectrum of mice mutant for p53 and p73, a large proportion of which develop HCC, as well as the association of aberrant AFP production and dysfunction in immune response, suggested a possible role for p73 in repression of AFP.

Expression of AFP is sustained developmentally in p53-null mouse liver compared with WT but declines to undetectable levels by 4 months of age (22). This alteration in the time course of AFP repression during liver development led us to consider that members of the p53 superfamily might compensate for the loss of p53 function and act in transcription repression of AFP. In this study, we found that AFP gene expression is regulated by both p53 and p73, but not p63, independently as well as additively. ChIP and Re-ChIP analysis of wild type mouse liver tissue revealed simultaneous occupancy of the p53/p73 regulatory element by p53 and TA-p73, concomitant with developmental repression of AFP expression. Within p53-null mouse liver, TA-p73 binds chromatin at the AFP p53 regulatory element at a time of delayed repression of AFP during development. TA-p73 is a less effective repressor of transcription, targeting only a subset of the co-repressor proteins and histone modifications associated with p53-mediated repression of transcription. Our data support a model of additive p53 and p73 function in direct developmental repression of transcription, which in the absence of p53 is compromised but not lost.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture and Plasmids—Hepa1-6, mouse hepatoma cells, and Hep3B, a human hepatoma cell line, were obtained from ATCC and cultured under standard, suggested conditions. The plasmid encoding wild type p53 (LTR-XA) has been previously described (23). Plasmids encoding p73{alpha} and {beta} have been previously described and were generous gifts of G. Melino (24). The p63 plasmids encoding Myc-tagged p63{alpha} and p63{gamma} were obtained from F. McKeon (15, 16). The cells were transfected with 2 µg of total DNA/100-mm plate using Lipofectamine, according to the manufacturer's instructions (Invitrogen).

Quantifying RNA Levels—Total RNA was isolated from cultured cells, C3H {Delta}10, and C57/B6 WT and p53-/- mouse livers using TRIzol reagent (Invitrogen). cDNA was synthesized with the SuperScript first strand system (Invitrogen) using 2 µg of total RNA as template and oligo(dT) as primer. Murine AFP (forward primer, 5'-CCCACTTCCAGCACTGCCTGCGG-3'; reverse primer, 5'-GGCTGCAGCAGCCTGAGAGTC-3') and murine GAPDH (forward primer, 5'-TTCACCACCATGGAGAAGGC-3'; reverse primer 5'-GGCATGGACTGTGGTCATGA-3') oligonucleotides were used separately in both semi-quantitative and real time PCR. Oligonucleotides for amplification of human AFP (forward primer, 5'-GCTGACCTGGCTACCATATT-3'; reverse primer, 5'-CTGCAGAGTCTGAATGTCC-3') and human GAPDH (forward primer, 5'-TCTCATGGTTCACCCATGACGAACATG-3'; reverse primer, 5'-AAGAAGATGCGGCTGACTGTCGAGCCACAT-3') were used in semi-quantitative PCR. To distinguish the AFP minigene transcript from endogenous AFP, minigene primers bridging the third and fourteenth exons were used (forward primer, 5'-AAGCCACCGAGGAGGAAG-3'; reverse primer 5'-TTAAACGCCCAAAGCATCAC-3'). PCR products were separated on a 5% polyacrylamide gel and stained with SYBR-Green dye. Real time PCR was performed in 25-µl reaction volumes containing iQ SYBR-Green Supermix (Bio-Rad), 200 nM of each primer, and 1 µl cDNA using the iCycler iQ real time PCR detection system (Bio-Rad). PCR cycle parameters were: 3 min at 95 °C, 50 cycles of 30 s at 95 °C, 30 s at 55 °C, and 30 s at 72 °C, followed by melting curve analysis. The amount of AFP mRNA relative to AFP at 8 days is defined as 2 ^ ((CtAFP,8d - CtGAP,8d) - (CtAFP,x - CtGAP,x)).

Western Blot and Immunoprecipitation Analyses—Western blotting was performed as previously described (25). Approximately 60 µg of total protein of cell extracts were fractionated by electrophoresis on a separating SDS-polyacrylamide gel. Proteins were transferred to polyvinylidene difluoride membrane (Bio-Rad) overnight at 200 mA. Primary antibodies used were as follows: p53 (pAb240, Santa Cruz), AFP (c-19, Santa Cruz), p63 (H-137, Santa Cruz), Lamin-B (C-20, Santa Cruz), and p73 (H-79, Santa Cruz and 5B429, IMGENEX). A standard immunoprecipitation protocol was followed to detect protein-protein interactions (26), with 500 µg of total cell lysate protein used for p53 immunoprecipitations and 1200 µg for p73. Input lysates equivalent to one-tenth of immunoprecipitation input were analyzed by SDS-polyacrylamide electrophoresis and immunoblotting alongside immunoprecipitated material from each reaction.

ChIP Assay of Cultured Cells and Solid Tissue—ChIP assays of cultured cells were performed as described (27, 28). ChIP assays of liver tissue were performed and quantified as previously described (22). Liver tissue from C57BL/6J WT and p53-/-, as well as C3H {Delta}10 mice (29), was used for ChIP assays. Antibody sources: anti-p73 (H-79, 15 µl; Santa Cruz), p53 (Ab1 OP03, 15 µl; Oncogene), normal sheep IgG (12-369, 5 µl; Upstate Cell Signaling Technologies), acetylated histone H3 lysine 9 (AcH3K9) (06-942, 5 µl; Upstate Cell Signaling Technologies), dimethylated histone H3 lysine 9 (DiMetH3K9) (07-212, 5 µl; Upstate Cell Signaling Technologies), dimethylated histone H3 lysine 4 (DiMetH3K4) (07-030, 5 µl; Upstate Cell Signaling Technologies), trimethylated histone H3 lysine 4 (TriMetH3K4) (ab8580-50, 5 µl; Abcam), and histone H3 (ab1791-100, 10 µl, Abcam). 3 µg of each antibody were added to the reactions and incubated overnight at 4 °C followed by incubation with 40 µl of protein A/G beads (preblocked with 1 mg/ml bovine serum albumin and 0.3 mg/ml of salmon sperm DNA). PCR primer sequences are as follows: the AFP SBE/p53RE region of -887 to -762 (forward primer, TAAAAAATAAACTCAACTACATATG; reverse primer, GAAAACTTTTAAAACTTCCC), the AFP start site region of -82 to +94 (forward primer, CATATGTTTGCTCACTGAAGGTTAC; reverse primer, CGCAGCGAAATGTAGCAGGAGGA), the Albumin enhancer region of 151 bp, 11 kb upstream of the transcription start site (forward primer, GGGACGAGATGTACTTTGTG; reverse primer, GATCAGTCCAAACTTCTTTCTG), the Brn-3b region from 151 bp 5' of the stop codon to 186 bp downstream (forward primer, TCTGGAAGCCTACTTCGCCA; reverse primer, CCGGTTCACAATCTCTCTGA), and for transgene analysis of -1100 to -800 (forward primer, TATGAACTAGGTTTGATCG; reverse primer, TCTGTGTGTCATATTGGAT.

To ensure that the PCRs were in linear range, several serial dilutions of the input DNA and two dilutions of each of the bound DNA fractions were used to quantify products (data not shown). PCR products were separated on 6% polyacrylamide gels and stained with Sybr Green (Sigma). DNA bands were visualized and quantified using ImageQuant 5.2 and NIH Image 1.63 software. We used an antibody that recognizes the C-terminal tail of histone H3 (Abcam), which is not modification-specific, as an internal control to normalize recovery of chromatin in the preparation of each lysate. The percentage of input bound was calculated by dividing the value of the bound fraction by the average of values for the input dilutions in the linear range and multiplying by the respective dilution factor. If any signal was present in the IgG negative control, this background level of precipitation was subtracted from the total percentage of input bound. Quantifications from multiple individual experiments were taken, and the average values were plotted graphically using Microsoft Excel software. The error bars represent the standard deviation.



View larger version (70K):
[in this window]
[in a new window]
  		FIGURE 1.
p73, but not p63, represses endogenous AFP transcription. A, Hepa1-6 cells were transfected with pUC, p73{alpha},orp73{beta} plasmid DNA, as indicated, separated into two halves and processed for RNA and protein isolation. The top and middle panels show immunoblots of cell lysate proteins, which were probed sequentially with anti-p73, anti-{beta}-actin and anti-AFP antibodies. The bottom panel shows the results of RT-PCR of RNA expression of AFP and GAPDH. B, similar transfections of Hepa1-6 cells were performed with the addition of Myc-p63-{alpha} and -{gamma}. Immunoblot analysis included p21 protein and Myc (for p63 expression), as well as in A. C, Hep3B cells were transfected as above and processed for RNA and protein isolation. The top three panels are immunoblot analyses of p73, AFP, and {beta}-actin proteins present in the cell lysates. The bottom panel is the RT-PCR analysis of transfected cell RNAs, amplified with primers for AFP and GAPDH, which were specific for human sequences. D and E, immunoblots (D) and RNA analyses (E) of Hep3B transfections, as in C, with the addition of p63 expression and analysis of p21 protein and Myc (for p63). MW, molecular mass.

 
Re-ChIP of Chromatin-bound Proteins—Precipitated complexes were eluted from primary immunoprecipitates, pooled from three or four reactions, and incubated with 30 µl of ChIP elution buffer (50 mM NaHCO3, 1% SDS). The samples were shaken for 30 min at room temperature, then spun down, and collected as supernatants. The complexes were eluted twice, and both elutions were combined. The pooled elutions were diluted 1:10 in buffer (1% Triton X-100, 5 mM EDTA, 150 mM NaCl, 25 mM Tris, pH 8) containing a protease inhibitor mixture (Sigma). Further Re-ChIP of supernatants and analysis of the results were performed as described above for primary ChIP immunoprecipitations.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
AFP Gene Expression Is Repressed by Expression of p73—Transcription of p63 and p73 from upstream or downstream promoters generates protein variants with extended N termini, containing TA domains or N-terminal deleted forms ({Delta}N) that may interact with TA isoforms to alter their function or display their own regulatory effects (1, 2, 9). To examine qualitatively the effects of p73 and p63 expression on endogenous AFP expression, cultured hepatoma cells were transiently transfected with the TA isoform p73{alpha}, p73{beta}, p63{alpha}, or p63{gamma} expression vectors (Fig. 1). Overexpression of either TA-p73 isoform led to a decrease in AFP RNA and protein levels in p53+, mouse Hepa1-6 (Fig. 1, A and B) and p53-, human Hep3B cells (Fig. 1, C-E). These representative data show that both TA-p73 isoforms equivalently repress AFP expression, independently of p53 status or specific cell background, and establish cause and effect between p73 expression and AFP regulation. In contrast to p73, neither p63 isoform had an effect on AFP expression in the mouse or human hepatoma cell lines (Fig. 1, B, D, and E). The ability to activate p21 in other cell types has been previously shown for transactivating isoforms of p63 and p73 (30, 31). As a positive control, we find that both p63{alpha} and {gamma} activated transcription of endogenous p21 in mouse and human hepatoma cells, as did p73 (Fig. 1, B and D).

Co-expression of p53 and p73 had no combinatorial effect when p53 was expressed at high levels and repression of AFP may have been maximal (Fig. 2A). However, when p53 expression was reduced, introduction of p73 had an additive, dose-dependent effect on repression of AFP RNA and protein expression (Fig. 2, B and C). We conclude that p53 and TA-p73 repress AFP transcription independently and additively, but TA-p73 function can be masked by the more effective transcription regulator p53.

Previously, we showed that endogenous p53 could be activated in Hepa1-6 cells by exposure to actinomycin D, concomitant with sequence-specific repression of AFP and induction of p21 protein levels (25). Likewise, the addition of transforming growth factor-{beta}1 ligand led to repression of AFP transcription and increased association of endogenous p53 with an overlapping Smad-binding element/p53 regulatory element (SBE/p53RE). Interaction of p53 with chromatin increased 4-fold at this site, although detectable levels of bound p53 were present even in the absence of transforming growth factor-{beta}1 ligand addition (28). We explored the mechanism of p73-mediated repression using ChIP analysis of Hepa1-6 cells. We found that p73 binding at the SBE/p53RE repression of AFP did not occur unless p73-encoding plasmids were introduced by transfection (Fig. 3A). Overexpressed TA-p73 protein bound specifically to the SBE/p53RE region, but to no other sites within the distal or proximal promoter (data not shown). The downstream effects of exogenous TA-p73 expression were monitored by ChIP analysis of histone modifications present at the SBE/p53RE (repressor region, -887 to -827) and core promoter (start site, -82 to +94) of AFP. Expression of either isoform of TA-p73 (p73{alpha} and {beta}) led to loss of acetylation and increased methylation of histone H3 at lysine 9 (H3K9), which are both correlated with repressed chromatin. Decreased trimethylation of lysine 4 of histone H3 (H3K4) is another alteration generally associated with repression of transcription; however, p73 expression induced no change in H3K4 trimethylation at the core promoter and a slight decrease at the repressor region of AFP.



View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 2.
p73 acts additively with p53, as well as independently, to repress AFP transcription. A, p73 and p53 are not additive in repression of AFP at maximal levels of expression. Hepa1-6 cells were transfected with 2 µg of each indicated DNA. The isolated RNA from each reaction was analyzed by RT-PCR for AFP and GAPDH levels, as indicated. B, at submaximal p53 levels, p73 acts in a dose-dependent, additive way to repress AFP. Hepa1-6 cells were transfected with the indicated amounts of each DNA plasmid. RNA levels, determined by RT-PCR analysis of RNA isolated from cells transfected as indicated, were repressed in an additive and dose-dependent way by p53 and p73. C, similarly, extracts of transfected cells were analyzed by immunoblotting for p73{alpha}, p53, AFP, and {beta}-actin protein levels. MW, molecular mass.

 



View larger version (53K):
[in this window]
[in a new window]
  		FIGURE 3.
TA-p73 binds the SBE/p53RE of AFP and forms a complex with p53 protein. A, ChIP assays of lysates isolated from Hepa1-6 cells transfected with no DNA (reagent only, lanes 1-3), p73{alpha}, or p73{beta} DNA. One set of transfections was used for p73 (H-79) antibody precipitation (top panels) and additional transfections analyzed with AcH3K9, TriMetH3K4, and DiMetH3K9 antibodies. Primers specific for the AFP Repressor (SBE/p53RE) region (-887/-827) or the AFP start site (-82/+94) region were used to determine the presence of specific DNA in ChIP samples. B, endogenous p53 and p73 protein in Hepa1-6 cells interact. Immunoprecipitation analysis of Hepa1-6 extracts were performed by immunoprecipitation with IgG control, p53, or p73 antibodies. The precipitated protein complexes were analyzed for the presence of p73 or p53 protein, respectively. C, p73 protein binds the SBE/p53RE in the presence or absence of co-expressed p53 protein. Radiolabeled SBE/p53RE oligonucleotides (-862/-830) were incubated with lysates isolated from Hepa1-6 transfected with no DNA (lanes 1 and 6), p73{alpha} (lanes 2 and 4), p73{beta} (lanes 3 and 5), p73{alpha} and p53 (lanes 7 and 9), or p73{beta} and p53 (lanes 8 and 10). Unlabeled double-stranded SBE/p53RE oligonucleotides were added in 50-fold molar excess to reactions shown in lanes 4, 5, 9, and 10. Protein-DNA complexes were separated on a non-denaturing polyacrylamide gel, which was dried and exposed for autoradiography. - Ab, without antibody; IP, immunoprecipitation.

 
Immunoblot analysis of Hepa1-6 lysates showed that endogenous p53 but not TA-p73 was readily detectable (Fig. 3B). However, immunoprecipitation analysis of endogenous p53 and p73 revealed that heteromeric complexes of p53 and p73 formed within Hepa1-6 cells but likely represent only a fraction of the endogenous p53-protein complexes. Further support for the formation of p53·p73 protein complexes, as well as p53·protein complexes lacking p73, and their ability to bind the SBE/p53RE of AFP was supplied by in vitro protein-DNA binding analyses using electromobility shift assays (Fig. 3C). Equal concentration of proteins present in lysates of Hepa1-6 cells, transfected with vector only (lanes 1 and 6), p73{alpha} only (lanes 2 and 4), p73{beta} only (lanes 3 and 5),or a combination of these p73 isoforms and p53 (lanes 7-10), were incubated with radiolabeled, double-stranded oligomers containing the SBE/p53RE (-860/-830). Protein·SBE/p53RE complexes were apparent only when exogenous proteins were expressed and were specifically competed by 50-fold excess of unlabeled SBE/p53RE oligonucleotides (lanes 4, 5, 9, and 10). One major protein·DNA complex formed in the presence of either p73{alpha} or {beta}, but multiple protein·DNA complexes were apparent when both p53 and either TA-p73 isoform were expressed (lanes 2, 3, 7, and 8).



View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 4.
p53 and TA-p73 interact simultaneously at the SBE/p53RE of AFP chromatin. A, immunoblot analysis of p53, p73, and p63 protein levels in adult mouse liver (2 months of age), Hepa1-6, and HeLa cell extracts. A Lamin-B antibody was used as probe for levels of protein present in each extract, loading control (LC). B, ChIP assays of liver tissue isolated from 2-month-old WT mice. Primers specific for the AFP -850 SBE/p53RE, AFP transcription start site, albumin, and Brn-3b were used. Negative controls include nonspecific IgG, no antibody addition to immunoprecipitation, and no precipitated DNA added to PCR (oligonucleotides). C, schematic description for Re-ChIP analysis. D, upper panels, Re-ChIP analysis reveals simultaneous association of p53 and TA-p73 at the SBE/p53RE but not at the AFP transcription start site in liver tissue from WT 2-month-old mice. A 1° ChIP was done with histone H3, TA-p73, and p53 (total of four separate immunoprecipitations). p53 1° ChIP reactions were pooled, released from protein A/G beads, and then reimmunoprecipitated for TA-p73 (p53 -> p73). Bottom panel, the reverse, replacing p73 as the 1° ChIP antibody was performed similarly (p73 -> p53) with the additional control of a 2° precipitation of IgG-control (1°) precipitated material. MW, molecular mass.

 
Association of p73 and p53 with Chromatin Correlates with Developmental Repression of AFP—Recently we exploited ChIP analysis of solid tissues to show that p53 associates specifically with an SBE/p53RE within the AFP distal promoter (-860/-830) when AFP is repressed during hepatic development (22). DNA affinity purification of adult mouse liver nuclear extracts and ChIP analyses of liver tissue show that effectors of transforming growth factor-{beta} signaling, Smads 2/4 and SnoN proteins, interact with the SBE/p53RE to repress AFP transcription cooperatively with p53. In the absence of p53 protein, SnoN binding to the SBE/p53RE is considerably compromised in vivo and in vitro (28). ChIP analysis of p53-null mouse liver tissue revealed that mSin3a and histone deacetylase 1 also interacted at this site in a p53-dependent manner to effect histone deacetylation, in parallel with increased H3K9 methylation and decreased di- and trimethylated H3K4 (22).

We used this approach to determine whether endogenous TA-p73 interacts with the SBE/p53RE of AFP in adult liver, where AFP expression is fully repressed. Immunoblot analysis of extracts isolated from adult mouse liver (2 months of age), Hepa1-6 and HeLa cells was performed for p53, TA-p73, and p63 (Fig. 4A). Levels of p53 in normal mouse liver are very low but detectable (lane 1). As observed in numerous tumor-derived cell lines, p53 protein is stabilized in Hepa1-6 and undetectable (at the appropriate molecular mass) in HeLa cells (lanes 2 and 3). Interestingly, there is an inverse relationship between levels of p53 and p73 detected in normal liver cells, compared with tumor-derived, hepatoma cells (lanes 1 and 2). A prominent band, revealed by the p73-specific antibody, migrates at a molecular mass greater than 110 kDa, which may be the sumoylated form of p73{alpha} reported previously (32). The p63 protein is expressed at undetectable levels in normal liver tissue, as previously reported (33), and is present in Hepa1-6 cell extracts.

Quantified ChIP assays of normal, WT liver tissue show that equal levels of p53 and TA-p73 are bound at the SBE/p53RE repressor site in repressed AFP chromatin (Fig. 4B, representative PCR data shown, the percantage bound values are averages of at least three separate determinations). The N-terminal p73-specific (amino acids 1-80) antibody, used in these studies, does not distinguish between p73{alpha} and p73{beta} and likely will not detect the {Delta}N isoforms of p73. With histone H3 recovery as a positive control for all regions of chromatin assayed, we found that association of p53 and TA-p73 at the repressor region was specific for the SBE/p53RE. No binding of either p53 or TA-p73 was detected at the start site of AFP transcription, which is 850 bp downstream of the SBE/p53RE, at the enhancer of albumin (ALB), which is ~45 kb upstream of the SBE/p53RE, or at the Brn-3b gene, which is silenced in liver and expressed in cells of retina (34).

One question of considerable interest is whether two proteins capable of binding to the same DNA element actually do so simultaneously. To address this point, we performed sequential immunoprecipitation where chromatin, enriched by specific interaction with one antibody (ChIP), is eluted and then used as input for a second, sequential immunoprecipitation (Re-ChIP; Fig. 4C). Chromatin associated with p53 in WT liver from 2-month-old mice was immunopurified in parallel with histone H3 and TA-p73, as positive controls (Fig. 4D). This p53-enriched fraction was then eluted from p53-antibody beads and used as a source of chromatin for immunopurification of TA-p73-associated chromatin. We then performed the reciprocal Re-ChIP analysis and obtained identical results. The Re-ChIP results show that p53 and TA-p73 occupy the AFP repressor site (SBE/p53RE) simultaneously at a time of developmental repression of AFP in WT liver.

Mechanisms of AFP Repression in the Absence of p53—At 2 months of age in normal liver, AFP is fully repressed and undetectable even by extensive PCR amplification, but in the p53-null liver, it remains expressed at low levels. This low level of AFP expression is extinguished by 4 months of age in p53-null mice (22). Analysis of p53-null liver tissue by ChIP showed that TA-p73 bound to the SBE/p53RE repressor element independently of p53 in normal hepatocytes (Fig. 5A). We used immunoprecipitation of histone H3 protein to normalize the average recovery of chromatin fragments in each lysate of pooled tissues (27.6 and 24.7%, respectively) and compared WT with p53-null liver. Binding of TA-p73 in the p53-null liver exhibited a 30% increase when compared with WT (Fig. 4). The association of TA-p73 in the absence of p53 does not fully compensate for p53, because expression of AFP is detectable in the p53-null liver at this stage of development, and repression is delayed, again supporting our findings (Fig. 2) and earlier reports that p73 is a weaker transcription regulator compared with p53 (35).

We analyzed p53-null liver at 4 months of age, when AFP is fully repressed, and detected a slight increase in TA-p73 binding (Fig. 5B). Using antibodies specific for modified histones, we assessed the downstream consequences of TA-p73 binding in the absence of p53, during developmental repression. These analyses showed that histone modifications normally associated with transcription repression (36, 37) were present at this stage of development in the p53-null liver. DiMetH3K9 levels were substantial at both the SBE/p53RE repressor and AFP start site of transcription, similar to levels found at the silenced Brn-3b gene. The ratio of AcH3K9 to DiMetH3K9 in AFP and Brn-3b chromatin, respectively, is especially striking in contrast to the actively transcribed ALB gene. Applying this comparison to two other modifications, which are generally associated with active transcription (38, 39), we saw that both di- and trimethylation of H3K4 were decreased in the repressed AFP and silenced Brn-3b genes compared with ALB.

We compared the quantified histone modifications present at the developmentally repressed AFP gene locus in both p53-null and WT liver to determine how TA-p73 established repressed chromatin structure in the absence of p53 versus in combination with p53, respectively (Fig. 5C). ChIP values were normalized for relative chromatin recovery, using values of histone H3 precipitation, from mouse liver tissue isolated from 4-month-old mice. Histone modifications associated with repression of AFP in WT liver were identical to those effected in the absence of p53 in null liver with the exception of H3K4 methylation. These results suggest that p53 and TA-p73 are each capable of targeting histone modifying complexes that deacetylate H3K9 and promote methylation at this residue, but proteins that demethylate H3K4 (40, 41) may interact less efficiently with p73 or p73 complexes. Direct determination of this and the role of H3K4 demethylation in repression of AFP transcription are subjects for future study.

Can AFP Repression Occur in the Absence of p53 and p73?—Mice that are genetically engineered as p73-null have a very high rate of mortality (17). Thus, a direct comparison of developmental repression of AFP in p73-/- mice, over a time course of 4 months, is not practical (18). We therefore turned to a transgenic mouse model of AFP repression, which has been well established for a number of years (42, 43). The original identification of a region of the AFP distal promoter that conferred developmental repression of expression was made by progressive deletion of sequences from an AFP transgene, consisting of AFP upstream regulatory regions driving expression of a mini-gene (MG, a fusion of exons 1, 2, 3, 14, and 15) construct (44). In this study, developmental repression of the AFP minigene expression was lost when a large region from -838 to -250 was deleted from the transgene. The 5' end point of this region divides the SBE/p53RE, deleting the majority of the downstream p53RE and SBE repeats (28).

Indirect effects, because of the lack of p53 expression during differentiation, may play a modulating role in maintaining AFP expression beyond the normal time of developmental repression in the p53-null mouse. Injury or disease states, such as liver regeneration, chronic hepatitis infection or cirrhosis, that cause renewed cell cycle progression in normal adult liver induce reactivation of AFP expression (45, 46). Concerns that increased cellular proliferation, in the absence of p53, may play a significant role in the sustained expression of AFP are allayed by measurements of transgene expression, which takes place in an otherwise normal, hepatic background of unaltered cell cycle status. We used a transgenic mouse model bearing multiple copies of an AFP MG construct, driven by AFP upstream regulatory sequences from -7.6 kb to +1 with a deletion from -1000 to -838, which lacks most of the SBE/p53/p73 regulatory element (47). RNA was isolated from these mice, called {Delta}10, at specific stages of development and analyzed for AFP MG (AFPMG) and endogenous AFP (AFPEND) expression (Fig. 6). RT-PCR analysis showed that the {Delta}10 MG expression was expressed for months longer than the endogenous gene, when analyzed at the same number of amplification cycles (Fig. 6A). Detection of AFPMG expression, which was eventually extinguished, may reflect the sensitivity of the analysis and the ability to detect elevated expression from multiple gene copies versus the single endogenous allele. Additional cycles of PCR amplification of endogenous AFP cDNA, in an attempt to equalize expression to multi-copy transgenes, did not reveal sustained AFP expression from the endogenous, WT gene (Fig. 6A, bottom panel).

To normalize multi-copy transgene expression, we used real time PCR and determined the ratio of AFP endogenous or MG expression (1 and 2 months) relative to fully activated expression (8 days post-partum) of each (Fig. 6B). Lack of p53 and p73 binding correlated with sustained AFPMG expression, well beyond the AFPEND timeline. Endogenous AFP expression was repressed 17,000- and 25,000-fold at 1 and 2 months of age, respectively. In contrast, AFPMG expression was repressed 400- and 200-fold at the same time points. Comparison of the RNA expressed from the endogenous AFP gene in p53-null liver at these time points also supports the conclusion that p73 contributes to repression of AFP. Loss of p53 alone yields repression of the endogenous AFP gene that is intermediate between the AFP minigene and the endogenous AFP gene expressed in WT mice at the same point in time. This ratio of RNA levels was determined for the endogenous AFP gene in nontransgenic, p53-null mice, but the trend is striking, because the endogenous AFP gene is repressed 2000-fold at 1 month of age and 800-fold at 2 months in p53-null liver (compare with WT endogenous and minigene, above). As noted above and in Ref. 28, we found that co-repressor SnoN interaction with AFP chromatin at the SBE/p53RE was detectable but greatly reduced by 7-fold in p53-null mice. The AFP MG lacks Smad elements and cannot bind Smad proteins, generally activators, or SnoN, a co-repressor, which may also contribute to altered regulation of the AFP MG. Thus, loss of the SBE/p53RE-interacting proteins, including both p53 and p73, led to an increased level of sustained AFP minigene expression and considerably delayed repression, compared with the endogenous AFP gene in either WT or p53-null liver.



View larger version (49K):
[in this window]
[in a new window]
  		FIGURE 5.
Chromatin profiles of p53 WT and p53-null mouse liver tissue. A, p73 binds to the SBE/p53RE in the absence of p53. ChIP assays were carried out as in Fig. 2. B, AFP repression in 4-month-old p53-null mice is mediated through chromatin modification. ChIP at AFP SBE/p53RE shows acetylation and methylation profiles more similar to the silenced gene Brn-3b than the expressed gene Albumin. Quantified levels of each precipitated material were calculated as stated under "Experimental Procedures" from at least three determinations. A representative PCR analysis is shown for each gene region. C, methylation of H3K4 is elevated in p53-null mice even when AFP is repressed. Comparison of WT and p53-null ChIP data, relative to histone H3 recovery controls for each lysate, reveals significant increases in trimethylated H3K4 at both the AFP SBE/p53RE and the transcription start site and specifically in dimethylated H3K4 at the SBE/p53RE. MW, molecular mass.

 



View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 6.
Deletion of the SBE/p53/p73RE delays developmental repression. A, RT-PCR analysis of mouse liver RNA extracted from 8-day-old, 1-month-old, 2-month-old, and 6-month-old was performed for endogenous AFP (AFPEnd), GAPDH, and minigene AFP (AFPMG). The data summarized in the upper three panels were generated by 23 cycles of amplification, and data in the bottom panel were generated by 30 cycles of amplification. B, real time RT-PCR analysis was performed as above. Ct values were normalized to GAPDH and then graphed relative to 8-day transcript levels: y axis = log10 scale, x axis = days post-partum. The error bars represent the standard deviation (n = 5-8). The average values for fold developmental repression of RNA samples isolated at each time point are shown in the box. C, ChIP analysis of {Delta}10 mice liver tissue from one month of development. At least three lysates were analyzed, and the average values were determined for the amounts of histone H3 (C terminus), AcH3K9, and DiMetH3K9 present in the chromatin formed with the endogenous or MG -1100/-800 region of AFP. Chromatin recovery was normalized by histone H3 levels, and IgG background was subtracted when detectable. The two panels show separate images of the same scanned gel.

 
The chromosomal site of transgene insertion can have profound effects on expression, although these effects may be abrogated by gene regulatory elements such as enhancers or locus control regions (48, 49). To establish that AFP MG chromatin exhibited histone modification similar to endogenous chromatin, we performed ChIP analysis of 1-month-old liver tissue isolated from {Delta}10 mice (Fig. 6C). Primers amplifying a region from -1100 to -800, using endogenous AFP nucleotide numbering, were used to determine simultaneously the amount of DNA bound to histone H3, AcH3K9, and DiMetH3K9 in both endogenous AFP and AFP MG chromatin. We found that the ratio of AcH3K9- to DiMetH3K9-enriched chromatin reflected the expression patterns of the two AFP genes. The more highly active AFP MG had much higher AcH3K9 levels than the endogenous gene, approximately equal to DiMetH3K9, and did not bind either p73 or p53 proteins (data not shown). The repressed, endogenous AFP chromatin was primarily comprised of DiMetH3K9-enriched chromatin, and acetylation of this residue was essentially undetectable.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Fine tuning of p53 activities is essential and occurs not only in response to stress signaling or DNA damage but also during development (50, 51). In the absence of Mdm2 protein, which inhibits p53 function by multiple mechanisms, levels of p53 protein increase unchecked in normal, unstressed cells and lead to cell death (52). Targeted ablation of MDM2 in mice causes embryonic lethality, which is rescued in a p53-null background (53). Constitutive activity of endogenous p53 in mice, which express a genetically engineered, truncated version of p53 lacking the regulatory controls imposed by the C terminus of the protein, causes premature aging (54). However, p53 highly expressed from a large number of transgene copies but regulated normally does not induce aging and confers protection from tumor development (55).

The p53 family members, p63 and p73, clearly are essential during development, because mice null for these genes display profound, isoform-specific abnormalities. The discovery of highly related p53 family members led to the speculation that p63 or p73 could compensate for loss of p53 in development, because the p53-null mouse lacked a dramatic phenotype (2). Using ChIP to detect binding of endogenous proteins in liver tissue and analyses of co-expressed p53 and TA-p73 in cultured cells, our findings support this model. However, TA-p73 alone is a relatively poor substitute for p53/p73-mediated repression of AFP transcription. During liver development, sustained expression of AFP (at 2 months) in p53-null liver is marked by lower levels of chromatin-bound SnoN, histone deacetylase 1, and mSin3A, in parallel with increased methylation of H3K4, increased H3K9 acetylation, and decreased methylation of H3K9, compared with WT liver (22, 28). The regulatory role of H3K4 demethylation, which is decreased in the absence of p53 during p73-mediated repression of AFP, is underscored by recent studies of tissue-specific Co-REST, a co-repressor essential in neuronal silencing, which acts by targeting H3K4 demethylase (56). AFP repression in p53-null mice is substantially delayed until chromatin-bound TA-p73 levels and the ratio of H3K9 methylation/acetylation increase (4 months of age). This delayed compensation for loss of p53 may be due to the ability of TA-p73 to target only a subset of repressive histone modifications and co-repressors.

Qualitatively, we found no difference between the TA isoforms p73{alpha} and p73{beta} in their ability to repress endogenous AFP expression in hepatoma cells, whether they express or do not express p53. The p73{beta} isoform lacks most of the sterile {alpha} motif, which is associated with protein-protein interactions, and the C-terminal portion of the otherwise homologous isoform p73{alpha} (9). Previous reports suggested that transcription of p53 target genes is increased more by p73{beta} than by p73{alpha} (8, 15) and that the C-terminal region of p73{alpha} inhibits p300-CBP interaction (57). Repression of AFP, which occurs in part by p53-induced histone deacetylation (22, 28), appears unaffected by the C-terminal inhibitory regions of p73{alpha} and is likely mediated by sequences conserved between TA-p73 isoforms and p53 but lacking in p63, which dictate their function as repressors rather than activators of AFP transcription. That p53 and TA-p73 act together, without TA-p63, in developmental repression of gene expression in normal tissue, as well as when co-expressed in hepatoma cells, adds another component to the network of p53 family interactions and isoform-specific functions.

Because AFP expression is acutely tied to cell cycle and proliferation, it is likely that complete, developmental repression is the sum total of multiple, temporally regulated factors. Alterations in chromatin structure that repress transcription, which are targeted by p53/p73 and, potentially, by other repressors, the loss of fetal transactivator proteins, such as Nkx2.8 (58), and continued maintenance of repressive chromatin structure, as hepatocytes exit from cell cycle and enter the G0/differentiated state, act in combination to repress expression of AFP. Identifying the keystone changes in this profile of repression that occur during reactivation of cellular proliferation and tumorigenesis may offer some insights into the regulatory dysfunction that leads to aberrant expression of tumor marker genes.


   FOOTNOTES
 
* This work was supported by Grant GM53683 from the National Institutes of Health (to M. C. B.) and in part by an NCI (National Institutes of Health) Cancer Center Support Grant to the University of Texas M. D. Anderson Cancer Center. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 These authors contributed equally to this work. Back

2 Present address: Pediatric Oncology Dept., Dana Farber Cancer Institute, Harvard Medical School, 44 Binney St., Boston, Massachusetts 02115. Back

3 To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biology, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Blvd., Box 117, Houston, TX 77030. Tel.: 713-834-6268; Fax: 713-834-6273; E-mail: mbarton{at}odin.mdacc.tmc.edu.

4 The abbreviations used are: TA, transactivating; HCC, hepatocellular carcinoma; AFP, {alpha}-fetoprotein; {Delta}N, N-terminally deleted; ChIP, chromatin immunoprecipitation; AcH3K9, acetylated histone H3 lysine 9; diMetH3K9, dimethylated histone H3 lysine 9; diMetH3K4, dimethylated histone H3 lysine 4; triMetH3K4, trimethylated histone H3 lysine 4; Re-ChIP, sequential ChIP; WT, wild type; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RT, reverse transcription; SBE/p53RE, Smad-binding element/p53 regulatory element; MG, mini-gene. Back


   ACKNOWLEDGMENTS
 
We thank W.-W. Tsai and S.-C. Hsu for advice on the Re-ChIP protocol and the members of the Barton and Dent laboratories for helpful advice and interactions.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Melino, G., Lu, X., Gasco, M., Crook, T., and Knight, R. A. (2003) Trends Biochem. Sci. 28, 663-670[CrossRef][Medline] [Order article via Infotrieve]
  2. Moll, U. M., and Slade, N. (2004) Mol. Cancer Res. 2, 371-386[Abstract/Free Full Text]
  3. Courtois, S., de Fromentel, C. C., and Hainaut, P. (2004) Oncogene 23, 631-638[CrossRef][Medline] [Order article via Infotrieve]
  4. Strano, S., Fontemaggi, G., Costanzo, A., Rizzo, M. G., Monti, O., Baccarini, A., Del Sal, G., Levrero, M., Sacchi, A., Oren, M., and Blandino, G. (2002) J. Biol. Chem. 277, 18817-18826[Abstract/Free Full Text]
  5. Di Como, C. J., Gaiddon, C., and Prives, C. (1999) Mol. Cell. Biol. 19, 1438-1449[Abstract/Free Full Text]
  6. Gaiddon, C., Lokshin, M., Ahn, J., Zhang, T., and Prives, C. (2001) Mol. Cell. Biol. 21, 1874-1887[Abstract/Free Full Text]
  7. Kaghad, M., Bonnet, H., Yang, A., Creancier, L., Biscan, J. C., Valent, A., Minty, A., Chalon, P., Lelias, J. M., Dumont, X., Ferrara, P., McKeon, F., and Caput, D. (1997) Cell 90, 809-819[CrossRef][Medline] [Order article via Infotrieve]
  8. Benard, J., Douc-Rasy, S., and Ahomadegbe, J. C. (2003) Hum. Mutat. 21, 182-191[CrossRef][Medline] [Order article via Infotrieve]
  9. Yang, A., Kaghad, M., Caput, D., and McKeon, F. (2002) Trends Genet. 18, 90-95[CrossRef][Medline] [Order article via Infotrieve]
  10. Pozniak, C. D., Radinovic, S., Yang, A., McKeon, F., Kaplan, D. R., and Miller, F. D. (2000) Science 289, 304-306[Abstract/Free Full Text]
  11. Flores, E. R., Tsai, K. Y., Crowley, D., Sengupta, S., Yang, A., McKeon, F., and Jacks, T. (2002) Nature 416, 560-564[CrossRef][Medline] [Order article via Infotrieve]
  12. Donehower, L. A., Harvey, M., Slagle, B. L., McArthur, M. J., Montgomery, C. A., Jr., Butel, J. S., and Bradley, A. (1992) Nature 356, 215-221[CrossRef][Medline] [Order article via Infotrieve]
  13. Donehower, L. A., and Bradley, A. (1993) Biochim. Biophys. Acta 1155, 181-205[Medline] [Order article via Infotrieve]
  14. Sah, V. P., Attardi, L. D., Mulligan, G. J., Williams, B. O., Bronson, R. T., and Jacks, T. (1995) Nat. Genet. 10, 175-180[CrossRef][Medline] [Order article via Infotrieve]
  15. Yang, A., Kaghad, M., Wang, Y., Gillett, E., Fleming, M. D., Dotsch, V., Andrews, N. C., Caput, D., and McKeon, F. (1998) Mol. Cell 2, 305-316[CrossRef][Medline] [Order article via Infotrieve]
  16. Yang, A., Schweitzer, R., Sun, D., Kaghad, M., Walker, N., Bronson, R. T., Tabin, C., Sharpe, A., Caput, D., Crum, C., and McKeon, F. (1999) Nature 398, 714-718[CrossRef][Medline] [Order article via Infotrieve]
  17. Yang, A., Walker, N., Bronson, R., Kaghad, M., Oosterwegel, M., Bonnin, J., Vagner, C., Bonnet, H., Dikkes, P., Sharpe, A., McKeon, F., and Caput, D. (2000) Nature 404, 99-103[CrossRef][Medline] [Order article via Infotrieve]
  18. Flores, E. R., Sengupta, S., Miller, J. B., Newman, J. J., Bronson, R., Crowley, D., Yang, A., McKeon, F., and Jacks, T. (2005) Cancer Cell 7, 363-373[CrossRef][Medline] [Order article via Infotrieve]
  19. Tilghman, S. M., and Belayew, A. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, 5254-5257[Abstract/Free Full Text]
  20. Tilghman, S. M. (1985) Oxf. Surv. Eukaryot. Genes 2, 160-206[Medline] [Order article via Infotrieve]
  21. Um, S. H., Mulhall, C., Alisa, A., Ives, A. R., Karani, J., Williams, R., Bertoletti, A., and Behboudi, S. (2004) J. Immunol. 173, 1772-1778[Abstract/Free Full Text]
  22. Nguyen, T. T., Cho, K., Stratton, S. A., and Barton, M. C. (2005) Mol. Cell. Biol. 25, 2147-2157[Abstract/Free Full Text]
  23. Hinds, P., Finlay, C., and Levine, A. J. (1989) J. Virol. 63, 739-746[Abstract/Free Full Text]
  24. De Laurenzi, V., Costanzo, A., Barcaroli, D., Terrinoni, A., Falco, M., Annicchiarico-Petruzzelli, M., Levrero, M., and Melino, G. (1998) J. Exp. Med. 188, 1763-1768[Abstract/Free Full Text]
  25. Lee, K. C., Crowe, A. J., and Barton, M. C. (1999) Mol. Cell. Biol. 19, 1279-1288[Abstract/Free Full Text]
  26. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1987) Current Protocols in Molecular Biology (Janssen, K., ed) 1st Ed., pp. 20.5.1-20.5.5, John Wiley and Sons, Hoboken, NJ
  27. Chadee, D. N., Hendzel, M. J., Tylipski, C. P., Allis, C. D., Bazett-Jones, D. P., Wright, J. A., and Davie, J. R. (1999) J. Biol. Chem. 274, 24914-24920[Abstract/Free Full Text]
  28. Wilkinson, D. S., Ogden, S. K., Stratton, S. A., Piechan, J. L., Nguyen, T. T., Smulian, G. A., and Barton, M. C. (2005) Mol. Cell. Biol. 25, 1200-1212[Abstract/Free Full Text]
  29. Jin, D. K., and Feuerman, M. H. (1996) Somat. Cell. Mol. Genet. 22, 211-226[CrossRef][Medline] [Order article via Infotrieve]
  30. Dietz, S., Rother, K., Bamberger, C., Schmale, H., Mossner, J., and Engeland, K. (2002) FEBS Lett. 525, 93-99[CrossRef][Medline] [Order article via Infotrieve]
  31. De Laurenzi, V., and Melino, G. (2000) Ann. N. Y. Acad. Sci. 926, 90-100[Medline] [Order article via Infotrieve]
  32. Minty, A., Dumont, X., Kaghad, M., and Caput, D. (2000) J. Biol. Chem. 275, 36316-36323[Abstract/Free Full Text]
  33. Petitjean, A., Cavard, C., Shi, H., Tribollet, V., Hainaut, P., and Caron de Fromentel, C. (2005) Oncogene 24, 512-519[CrossRef][Medline] [Order article via Infotrieve]
  34. Ninkina, N. N., Stevens, G. E., Wood, J. N., and Richardson, W. D. (1993) Nucleic Acids Res. 21, 3175-3182[Abstract/Free Full Text]
  35. Melino, G., De Laurenzi, V., and Vousden, K. H. (2002) Nat. Rev. Cancer 2, 605-615[CrossRef][Medline] [Order article via Infotrieve]
  36. Felsenfeld, G., and Groudine, M. (2003) Nature 421, 448-453[CrossRef][Medline] [Order article via Infotrieve]
  37. Fischle, W., Wang, Y., and Allis, C. D. (2003) Curr. Opin. Cell Biol. 15, 172-183[CrossRef][Medline] [Order article via Infotrieve]
  38. Strahl, B. D., Ohba, R., Cook, R. G., and Allis, C. D. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 14967-14972[Abstract/Free Full Text]
  39. Strahl, B. D., and Allis, C. D. (2000) Nature 403, 41-45[CrossRef][Medline] [Order article via Infotrieve]
  40. Shi, Y., Lan, F., Matson, C., Mulligan, P., Whetstine, J. R., Cole, P. A., and Casero, R. A. (2004) Cell 119, 941-953[CrossRef][Medline] [Order article via Infotrieve]
  41. Kubicek, S., and Jenuwein, T. (2004) Cell 119, 903-906[CrossRef][Medline] [Order article via Infotrieve]
  42. Camper, S. A., Godbout, R., and Tilghman, S. M. (1989) Prog. Nucleic Acids Res. Mol. Biol. 36, 131-143[Medline] [Order article via Infotrieve]
  43. Camper, S. A., and Tilghman, S. M. (1989) Genes Dev. 3, 537-546[Abstract/Free Full Text]
  44. Vacher, J., and Tilghman, S. M. (1990) Science 250, 1732-1735[Abstract/Free Full Text]
  45. Abelev, G. I., and Eraiser, T. L. (1999) Sem. Cancer Biol. 9, 95-107[CrossRef][Medline] [Order article via Infotrieve]
  46. Michalopoulos, G. K., and DeFrances, M. C. (1997) Science 276, 60-66[Abstract/Free Full Text]
  47. Jin, D. K., Vacher, J., and Feuerman, M. H. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 8767-8772[Abstract/Free Full Text]
  48. Martin, D. I. K., Fiering, S., and Groudine, M. (1996) Curr. Opin. Gen. Dev. 6, 488-495[CrossRef][Medline] [Order article via Infotrieve]
  49. Francastel, C., Walters, M. C., Groudine, M., and Martin, D. I. (1999) Cell 99, 259-269[CrossRef][Medline] [Order article via Infotrieve]
  50. Harris, S. L., and Levine, A. J. (2005) Oncogene 24, 2899-2908[CrossRef][Medline] [Order article via Infotrieve]
  51. Choi, J., and Donehower, L. A. (1999) Cell Mol. Life Sci. 55, 38-47[CrossRef][Medline] [Order article via Infotrieve]
  52. de Rozieres, S., Maya, R., Oren, M., and Lozano, G. (2000) Oncogene 19, 1691-1697[CrossRef][Medline] [Order article via Infotrieve]
  53. Montes de Oca Luna, R., Wagner, D. S., and Lozano, G. (1995) Nature 378, 203-206[CrossRef][Medline] [Order article via Infotrieve]
  54. Tyner, S. D., Venkatachalam, S., Choi, J., Jones, S., Ghebranious, N., Igelmann, H., Lu, X., Soron, G., Cooper, B., Brayton, C., Hee Park, S., Thompson, T., Karsenty, G., Bradley, A., and Donehower, L. A. (2002) Nature 415, 45-53[CrossRef][Medline] [Order article via Infotrieve]
  55. Garcia-Cao, I., Garcia-Cao, M., Martin-Caballero, J., Criado, L. M., Klatt, P., Flores, J. M., Weill, J. C., Blasco, M. A., and Serrano, M. (2002) EMBO J. 21, 6225-6235[CrossRef][Medline] [Order article via Infotrieve]
  56. Lee, M. G., Wynder, C., Cooch, N., and Shiekhattar, R. (2005) Nature 437, 432-435[Medline] [Order article via Infotrieve]
  57. Liu, G., and Chen, X. (2005) J. Biol. Chem. 280, 20111-20119[Abstract/Free Full Text]
  58. Apergis, G. A., Crawford, N., Ghosh, D., Steppan, C. M., Vorachek, W. R., Wen, P., and Locker, J. (1998) J. Biol. Chem. 273, 2917-2925[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
W.-W. Tsai, T. T. Nguyen, Y. Shi, and M. C. Barton
p53-Targeted LSD1 Functions in Repression of Chromatin Structure and Transcription In Vivo
Mol. Cell. Biol., September 1, 2008; 28(17): 5139 - 5146.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
D. S. Wilkinson, W.-W. Tsai, M. A. Schumacher, and M. C. Barton
Chromatin-Bound p53 Anchors Activated Smads and the mSin3A Corepressor To Confer Transforming Growth Factor {beta}-Mediated Transcription Repression
Mol. Cell. Biol., March 15, 2008; 28(6): 1988 - 1998.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
J. Zhang and X. Chen
{Delta}Np73 Modulates Nerve Growth Factor-Mediated Neuronal Differentiation through Repression of TrkA
Mol. Cell. Biol., May 15, 2007; 27(10): 3868 - 3880.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
C. Zhang, Z. Li, Y. Cheng, F. Jia, R. Li, M. Wu, K. Li, and L. Wei
CpG Island Methylator Phenotype Association with Elevated Serum {alpha}-Fetoprotein Level in Hepatocellular Carcinoma
Clin. Cancer Res., February 1, 2007; 13(3): 944 - 952.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y. Kajiyama, J. Tian, and J. Locker
Characterization of Distant Enhancers and Promoters in the Albumin-{alpha}-Fetoprotein Locus during Active and Silenced Expression
J. Biol. Chem., October 6, 2006; 281(40): 30122 - 30131.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/47/39152    most recent
M504655200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cui, R.
Right arrow Articles by Barton, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cui, R.
Right arrow Articles by Barton, M. C.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement