HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 280, Issue 50, 41137-41145, December 16, 2005

This Article Abstract Full Text (PDF) All Versions of this Article: 280/50/41137    most recent M509793200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Komuro, I. Articles by Akagawa, K. S. Search for Related Content PubMed PubMed Citation Articles by Komuro, I. Articles by Akagawa, K. S. Social Bookmarking                      What's this?

Catalase Plays a Critical Role in the CSF-independent Survival of Human Macrophages via Regulation of the Expression of BCL-2 Family^*

Iwao Komuro, Tomoyoshi Yasuda¶, Aikichi Iwamoto, and Kiyoko S. Akagawa1

From the Departments of Immunology and ^¶Parasitology, National Institute of Infectious Diseases, Toyama 1-23-1, Shinjuku-ku, Tokyo 162-8640 and Division of Infectious Diseases, the Advanced Clinical Research Center, Institute of Medical Science, University of Tokyo, Shiroganedai 4-6-1, Minato-ku, Tokyo 108-8639, Japan

Received for publication, September 7, 2005 , and in revised form, September 19, 2005.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
M-colony-stimulating factor (M-CSF)-induced monocyte-derived macrophages (M-M) required continuous presence of M-CSF for their survival, and depletion of M-CSF from the culture induced apoptosis, whereas human alveolar macrophages (A-M) and granulocyte-macrophage (GM)-CSF-induced monocyte-derived macrophages (GM-M) survived even in the absence of CSF. The expression of BCL-2 was higher in M-M, and M-CSF withdrawal down-regulated the expression. The expression of BCL-X_L was higher in A-M and GM-M, and the expression was CSF-independent. The expression of MCL-1 and BAX were not different between M-M and GM-M and were CSF-independent. Down-regulation of the expression of BCL-2 and BCL-X_L by RNA interference showed the important role of BCL-2 and BCL-X_L in the survival of M-M and GM-M, respectively. Human erythrocyte catalase (HEC) and conditioned medium obtained from GM-M or A-M cultured in the absence of GM-CSF prevented the M-M from apoptosis and restored the expression of BCL-2. The activity of the conditioned medium was abrogated by pretreatment with anti-HEC antibody. Anti-HEC antibody also induced the apoptosis of M-M cultured in the presence of M-CSF and GM-M and A-M cultured in the presence or absence of GM-CSF and down-regulated the expression of BCL-2 and BCL-X_L in these Ms. GM-M and A-M, but not M-M, can produce both extracellular catalase and cell-associated catalase in a CSF-independent manner. Intracellular glutathione levels were kept equivalent in these Ms, both in the presence or absence of CSF. These results indicate a critical role of extracellular catalase in the survival of human macrophages via regulation of the expression of BCL-2 family genes.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Human tissue macrophages (M)² play important roles for homeostasis, and in vivo alveolar (A)-M acquire a strong antioxidant phenotype that contributes to prevention of the oxidant burst in an aerobic environment and can survive for long periods (1). In a previous study, we reported that human A-M and GM-CSF-induced monocyte-derived macrophages (GM-M) are resistant to hydrogen peroxide (H₂O₂) via their high basal and inducible levels of catalase activity and that M-CSF-induced monocyte-derived macrophages (M-M) are sensitive to low levels of H₂O₂ with low levels of catalase activity (2). GM-M is phenotypically identical to A-M, whereas M-M closely resembles peritoneal M in respect to morphology, cell surface antigen expression, and several biological functions (2-7). In vivo A-M express BCL-2 family proteins such as BCL-2 and BCL-X_L that prevent H₂O₂-induced apoptosis via inhibition of caspase-3 or -9 activation and cytochrome c release from mitochondria (8-11). These findings suggest that a high level of catalase activity enables long survival of GM-M and A-M with positive regulation of BCL-2 family protein.

In this study, we found that M-M absolutely require CSF for their survival and express high levels of BCL-2 gene and protein in the presence of M-CSF. In contrast to M-M, GM-M and A-M can survive in the absence of CSF via high levels of BCL-X_L gene and protein. We further examined the relation between catalase activity and distinct expression of BCL-2 family protein and make clear the roles of CSF in the regulation of catalase activity and BCL-2 family protein in human tissue macrophages under the influence of oxidative stress.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Preparation and Culture of Macrophages—Monocytes (Mo) were obtained from peripheral blood mononuclear cells of normal healthy volunteers using a magnetic cell separation system (MACS; Miltenyi Biotec, Bergisch Gladbach, Germany) with anti-CD14 monoclonal antibody-coated microbeads as described previously (7). CD14⁺ Mo were cultured in RPMI 1640 medium (Nissui Seiyaku Co., Ltd., Tokyo, Japan), 3 mg/ml filtered glutamine (Sigma), 100 units/ml penicillin G potassium (Banyu Seiyaku Co., Ltd., Tokyo, Japan), 100 µg/ml streptomycin (Meiji Seika Co., Ltd., Tokyo, Japan), 10% autoclaved NaHCO₃, and 10% heat-inactivated fetal calf serum (Z. L. Bockneck Laboratories Inc., Ontario, Canada) with the following human recombinant cytokines at optimal concentrations: 5 ng/ml GM-CSF (Schering-Plough Japan, Osaka, Japan) or 50 ng/ml M-CSF (Morinaga Milk Industry Co., Ltd., Tokyo, Japan) at 37 °C in humidified 5% CO₂ for 7 days. During the culture, Mo differentiated to M.

Human A-M were obtained from healthy volunteers (non-smokers without diseases) by bronchial alveolar lavage method (2, 7). All volunteers gave informed consent to the use of their A-M in part for this study.

Antisense Oligonucleotide (AS) Treatment—2'-O-methyl-modified oligoribonucleotide phosphorothioate 18-mer two CpG motifs targeted to the BCL-2 initiation codon (G3139 (BCL AS): 5'-TCTCCCAGCGTGCGCCAT-3'), G3139 variant with single base mismatch at each CpG motif (G4126 (BCL missense (MS)): 5'-TCTCCCAGCATGTGCCAT-3') (12) and 18-mer to the 5'-splice site of BCL-X_L (5'-BCL-X AS, ACCCAGCCGCCGUUCUCC) (13) and MCL-1 AS (ISIS 20 408, TTGGCTTTGTGTCCTTGGCG) (14) were synthesized by Proligo France SAS (Paris, France). Oligonucleotides with random sequences were used as negative controls. Cells were treated with oligonucleotides complexed with Lipofectin (5 mg/ml; Invitrogen) cationic lipid delivery agent according to the manufacturer's directions.

Assessment of Cell Number and Cell Viability—The number of adherent Mo and M was determined by counting the liberated intact nuclei from lysed cells stained with 1% (w/v) cetyltrimethyl ammonium bromide (Cetavelone; Wako Pure Chemical Industries, Ltd., Osaka, Japan) in 0.1 M citric acid with 0.05% (w/v) naphthol blue black (Sigma). Cell viability was assessed by the trypan blue dye exclusion test.

Assessment of Apoptosis—DNA fragmentation was detected by immunohistochemical staining using the terminal deoxynucleotidyl-transferase-mediated dUTP-biotin nick end-labeling method (Apo-tag kit; Oncor Co.) or visualized as DNA ladder formation (5). Cells were preincubated with 1% H₂O₂ in phosphate-buffered saline for inactivation of endogenous peroxidase for 5 min at room temperature. Incorporation of digoxigenin-conjugated dUTP to the terminal 3'-OH of fragmented DNA by exogenous terminal deoxynucleotidyl transferase was carried out at 37 °C for 1 h. The reaction products were incubated with horseradish peroxidase-linked anti-digoxigenin antibody at 37 °C for 30 min and visualized with the substrate 3-3' diaminobenzidine plus 0.6% H₂O₂.

Cells were lysed with hypotonic lysis buffer (10 mM Tris-Cl (pH 7.4), 10 mM EDTA (pH 8.0), 0.5% Triton-X), and crude DNA was extracted from the lysed cells by incubation with 40 µg/ml RNase and 40 µg/ml proteinase K for 1 h at 37 °C. The DNA was precipitated with final 50% propanol at -20 °C overnight and washed with 70% (w/v) ethanol. Electrophoresis was performed in 2% agarose at 50 V, and the migrated DNA was visualized by ethidium bromide staining.

Transmission Electron Microscopy—Cells were fixed by immersion in a 2.5% glutaraldehyde-2% paraformaldehyde mixture (10), followed by 1% glutaraldehyde-0.5% tannic acid diluted in 0.1 M cacodylate buffer (Wako Pure Chemical Industries, Ltd.) at 4 °C for 2 h. Samples were post-fixed with 1% OsO₄ (osmium tetroxide; Wako) at 4 °C for 2 h and then embedded in epoxy resin (Epok 812; Okenshoji. Co., Ltd., Tokyo). Thin sections were cut using a LKB-8800 ultratome (LKB, Uppsala, Sweden) and observed using a transmission electron microscope (Hitachi H-7000) after staining with uranyl acetate (Serva Electrophoresis GmbH)-0.2% lead citrate buffer (Wako).

Neutralization of Conditioned Medium—Conditioned medium was obtained from M cultured in medium alone for 48 h at 37 °C and incubated for 60 min at 37 °C with 10 µg/ml rabbit anti-human erythrocyte catalase (HEC) IgG (lot PTC 9301; Athens Research and Technology, Inc., Athens GA) or with normal rabbit IgG (Organon Teknika Co.) as a control.

Measurement of Catalase Activity—Intracellular and extracellular catalase activity was measured according to Aebi's modified method as described previously (2). Purified HEC (5 x 10⁴ units/mg, lot 643793; Calbiochem-Nova Biochem) was used for conversion of the catalase activity in samples into real catalase activity, and the activity was expressed as milliunits/ml per 2.5 x 10⁵ cells or units/mg protein. Protein was measured using a protein assay kit (Bio-Rad Laboratories).

Measurement of GSH Level—The total GSH level was determined using a BIOXYTECH S. A. kit. Briefly, the cells were lysed with 5% metaphosphoric acid, and the chromophore formation catalyzed at pH 13.4 was measured at 400 nm as described previously (15). The intracellular GSH level was expressed as pmol/mg protein.

Isolation of RNA and Northern Blot Analysis—Isolation of total RNA and Northern blot analysis were performed as described previously (5). Blots were hybridized with cDNA probes against human catalase (kindly donated by Dr. K. Onozaki, Faculty of Pharmaceutical Sciences, Nagoya City University) and -actin (Sigma). All the probes were labeled using a multiprime DNA-labeling system with [-³²P]dCTP (New England Nuclear Research Products, Boston, MA). The blots were analyzed using a Fuji BAS 2000 bioimage analyzer (Fuji Photo Film Co., Ltd., Tokyo).

Immunoblot Analysis—Immunoblot analysis was performed as described in our previous report (7). The membrane was incubated overnight at 4 °C with 1 mg/ml rabbit anti-HEC antibody (anti-Cat Ab; Athens Research and Technology, Inc.), mouse anti-BCL-2 antibody (Santa Cruz Biotechnology, Santa Cruz, CA), rabbit anti-BCL-xL/S antibody (Santa Cruz Biotechnology), rabbit anti-BCL-X antibody (Transduction Laboratories, Lexington, KY), mouse anti-MCL-1 antibody (Santa Cruz Biotechnology), rabbit anti-BAX antibody (Santa Cruz Biotechnology), or normal rabbit or mouse IgG and then at room temperature for 1 h with horseradish peroxidase-conjugated goat anti-rabbit IgG or anti-mouse IgG (Santa Cruz Biotechnology). The blots were visualized with Amersham ECL reagent on Hyper ECL film (Amersham Biosciences).

Reverse Transcription and Polymerase Chain Reaction—Total RNAs (1 mg) were prepared by use of RNA Zol B (Cinna/Biotecx Laboratories, Friendswood, TX) and reverse transcribed by incubation in 50 µl of 10 mM Tris-HCl (pH 8.3), 6.5 mM MgCl₂, 50 mM KCl, 10 mM dithiothreitol, each dNTP at 1 mM, 2 mM random primer, and 2.4 units/ml Moloney murine leukemia virus reverse transcriptase for 1 h at 42°C (Takara Shyzo, Otsu, Japan). The conditions for PCR were as follows: in a 50-µl reaction, 0.15 mM each primer, each dNTP at 2.5 mM, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl₂, and 1.25 units of Taq polymerase (Takara Shyzo). Primers used were as follows: glyceraldehyde-3-phosphate dehydrogenase: sense, 5'-CCTTCATTGACCTCAACTAC-3' and antisense, 5'-AGTGATGGCATGGACTGTGGT-3'; BCL-2: sense, 5'-CATTTCCACGTCAACAGAATTG-3' and antisense, 5'-AGCACAGGATTGGATATTCCAT-3'; BCL-X_L: sense, 5'-TTGGACAATGGACTGGTTGA-3' and antisense, 5'-GTAGAGTGGATGGTCAGTG-3'; MCL-1: sense, 5'-GAGGAGGAGGACGAGTTGTA-3' and antisense, 5'-CAGCTTTCTTGGTTTATGGT-3'; BAX: sense, 5'-AAGAAGCTGAGCGAGTGTC-3' and antisense, 5'-CGGCCCCAGTTGAAGTTGC-3'. Reactions were incubated in a PerkinElmer DNA thermal cycler for 25 cycles (with each cycle consisting of denaturation for 30 s at 95 °C, annealing for 30 s at 60 °C, and extension for 60 s at 72 °C) (5).

Statistical Analyses—Statistical analyses of the data were performed using Student's t-test. p values <0.01 were considered significant. The results shown are representative of three to seven independent experiments.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Requirement for Continuous Presence of CSF for the Survival of M-M, but not of GM-M and A-M—M-M, GM-M, and A-M were cultured with or without CSF, and then cell viability was determined. M-CSF withdrawal from M-M induced cell death in a time-dependent manner; 60% of the cells died by 2 days and almost all of the cells died by 8 days (Fig. 1A). In contrast, GM-CSF withdrawal from GM-M or A-M did not induce cell death significantly during the culture period (Fig. 1A). M-M cultured in the absence of M-CSF changed from spindle shaped to round and then detached from the dish and floated, with a shrunken cytosol and nucleus and with chromatin condensation and apoptotic vacuoles without microvilli (Fig. 1B). No such morphological change was observed in M-M cultured with M-CSF or in GM-M cultured with or without GM-CSF (Fig. 1B). A typical ladder pattern of internucleosomal DNA cleavage was detected in DNA of M-M cultured for 24 h in the absence of M-CSF, whereas no significant DNA fragmentation was detected in DNA of M-M cultured in the presence of M-CSF or that of GM-M cultured in the presence or absence of GM-CSF (Fig. 1C). Apoptosis and DNA fragmentation of A-M were similar to those of GM-M (data not shown). These findings suggest that M-CSF withdrawal from M-M induces apoptosis but both GM-M and A-M can survive in the absence of CSF.

View larger version (27K): [in this window] [in a new window]   FIGURE 1. Susceptibility of CSF-induced monocyte-derived M and A-M to CSF withdrawal. M-M and GM-M (2.5 x 105/ml/well) were cultured in medium with or without M-CSF or GM-CSF, and A-M were cultured in medium without GM-CSF. A, cell number and viability of Ms were assessed using Cetavlon and trypan blue dye as described under "Experimental Procedures." Values are expressed as the means of triplicate cultures ± S.D. B, electron microscopic features of M cultured in medium with or without CSF for 24 h (magnification x10,000). C, electrophoresis of low molecular mass DNA from cultured M. M were incubated with M-CSF, GM-CSF, or medium alone for 24 h. Low molecular mass DNA was isolated from the cells, and electrophoresis was performed as described under "Experimental Procedures." HaeIII-digested l DNA fragment size standards were run in lanes 1 and 6. Lane 2, M-M without M-CSF; lane 3, M-M with M-CSF; lane 4, GM-M without GM-CSF; lane 5, GM-M with GM-CSF.

The expression of BCL-2 family proteins in A-M resembles that of GM-M, and the expression was independent of CSF (Fig. 2B). As shown in Figs. 6 and 7, the expression of MCL-1 and BAX proteins in both Ms was not changed in the presence or absence of CSF, in accordance with the expression patterns of the MCL-1 and BAX genes.

HEC Stimulates the Survival and the Expression of BCL-2 in CSF-withdrawn M-M, and Anti-HEC Antibody Abolishes the Survival-stimulating Activity of CM Obtained from CSF-withdrawn GM-M and A-M—The above findings suggest that GM-M and A-M, but not M-M, can produce factor(s) that maintain their survival in the absence of CSF. To investigate this possibility, the conditioned medium (CM) obtained from these M cultured for 48 h without CSF was used to examine its effect on the survival of M-CSF-withdrawn M-M. CM of GM-M or A-M, but not of M-M, prevented cell death of M-CSF-depleted M-M (Fig. 3A).

A previous study showed that human CEM T cells can survive in serum-free medium supplemented with a low level of extracellular catalase (21). Therefore, we examined whether extracellular catalase prevents apoptosis in M-CSF-withdrawn M-M and stimulates the expression of both BCL-2 gene and protein. Addition of HEC prevented M-CSF-withdrawn M-M from undergoing cell death in a dose-dependent manner, and 10 units/ml of HEC completely rescued the cells from apoptosis. Addition of 10 units/ml HEC to GM-CSF-withdrawn GM-M had no such effect (Fig. 3A).

View larger version (29K): [in this window] [in a new window]   FIGURE 2. Effects of CSF and catalase on the levels of protein and mRNA expression of BCL-2 family genes in monocyte-derived M and A-M. A, RT-PCR analysis of mRNA levels of BCL-2 family genes and the glyceraldehyde-3-phosphate dehydrogenase gene in total RNA preparations (200 ng/lane) from these Ms at 3 h of cultivation as described under "Experimental Procedures." M-M and GM-M were cultured in medium with or without CSF or supplemented with catalase. B, Western blot analysis of BCL-2, BCL-XL/S, or -actin protein in cell lysates (25 µg/lane) probed using rabbit polyclonal BCL-2 or BCL-X antibody or mouse monoclonal -actin antibody. M-M were cultured for 48 h in medium with M-CSF or catalase or with M-CSF supplemented with anti-catalase antibody (Anti-Cat Ab), and GM-M and A-M were cultured in medium with GM-CSF or catalase or supplemented with Anti-Cat Ab. The relative amounts of these proteins in cells were measured using NIH image software, and the expression levels were corrected relative to those of -actin (photo-stimulating luminescence (PSL), A/mm2).

Next, we examined the role of catalase in the expression of BCL-2 family genes in M-CSF-withdrawn M-M. Addition of catalase to M-CSF-withdrawn M-M restored the expression of BCL-2 but did not affect the gene expression of BCL-X_L, MCL-1, or BAX (Fig. 2A). Addition of catalase did not significantly change the gene and protein expression of BCL-2 family genes in GM-CSF-withdrawn GM-M (Fig. 2A). These results suggest that the active molecule in the CM of GM-M and A-M that can rescue the survival of M-CSF-withdrawn M-M via restoration of BCL-2 expression is catalase.

Anti-catalase Antibody Abolished the Expression of BCL-2 in M-M Cultured with M-CSF and BCL-X_L in GM-M or A-M Cultured with or without GM-CSF and Induced Apoptosis of These Ms—The above results indicate that catalase can stimulate the expression of BCL-2 and rescue the survival of M-CSF-withdrawn M-M. Therefore we next examined whether extracellular catalase also plays a critical role in the CSF-dependent survival of M-M and in the survival of GM-M and A-M. Addition of anti-Cat Ab suppressed the expression of BCL-2 protein in M-M cultured in the presence of M-CSF and of BCL-X_L protein in both GM-M and A-M cultured without GM-CSF (Fig. 2B). In accordance with these data, addition of anti-Cat Ab induced cell death of M-M cultured with M-CSF and GM-M cultured with or without GM-CSF, and addition of control IgG had no effect on the cell viability of these Ms (Fig. 3C). The cell death of these M induced by anti-Cat Ab was due to apoptosis, as indicated by terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end-labeling staining (data not shown).

View larger version (18K): [in this window] [in a new window]   FIGURE 3. Effect of endogenously produced or exogenously added catalase on the survival of M-M and GM-M. A, M-M were cultured for 48 h in the medium with M-CSF, medium containing the indicated concentrations of catalase, or 100% of conditioned medium (CM) obtained from M-M, GM-M, or A-M. GM-M were used as the control. Cell number and viability of M were assessed as described in Fig. 1. Values are expressed as the means of triplicate cultures ± S.D. B, M-M were cultured for 48 h in medium with M-CSF, CM pretreated with Anti-Cat Ab (IgG), or rabbit IgG as a control. Cell number and viability of M were assessed as described in Fig. 1. Values are expressed as the means of triplicate cultures ± S.D. C, M-M and GM-M were cultured for 48 h in medium with or without CSF plus Anti-Cat Ab or rabbit IgG. Cell number and viability of M were assessed as described in Fig. 1. Values are expressed as the means of triplicate cultures ± S.D.

Next, we examined the cell-associated levels of catalase activity in these Ms (Fig. 4B). The levels of catalase activity in GM-M and A-M lysates was 5 units/mg protein both in the presence or absence of CSF, whereas that in M-M in the presence of M-CSF was 1 unit/mg. The catalase activity in M-CSF-withdrawn M-M lysates (250 milliunits/mg protein) was 4-fold lower than that in M-CSF-treated M-M lysates. In agreement with the measurements of enzyme activity, similar results were observed in Western blot analyses (Fig. 4B).

To further confirm the distinction between the regulation of extracellular and cell-associated catalase activity by CSF in M-M versus GM-M, we examined the levels of transcription of the catalase gene in these Ms cultured with or without CSF (Fig. 4C). The level of the transcript of the catalase gene in M-CSF-withdrawn M-M was 3-fold lower than that in M-CSF-treated M-M. In contrast, the level of the catalase transcript in GM-CSF-withdrawn GM-M and A-M was similar to that in GM-CSF-treated GM-M and A-M, and the level was 5-fold higher than that in M-CSF-treated M-M.

Thus, the difference of total extracellular plus intracellular catalase activity and the difference in the levels of catalase gene expression between CSF-withdrawn M-M and GM-M reached 15-20- and 15-fold, respectively. The results indicate that extracellular catalase activity is regulated at the transcription levels by CSF-dependent M-M but CSF-independent GM-M and A-M.

Thiol Derivatives Act as Additive Effectors That Rescue the Cell Death of M—The above data suggest that extracellular catalase plays a major role in M survival. However, several reports have demonstrated that thiol proteins and thiol compounds such as GSH, adult T cell leukemia-derived factor, and L-cysteine play important roles in the survival of lymphocytes or neuronal cells in the absence of growth factors (22, 23, 24). Thus, thiol derivatives may help M survival. The level of intracellular GSH, however, was almost the same in M-M and GM-M cultured with or without CSF or cultured with catalase (Fig. 5A), and this level (300 pmol/10⁵ cells) was similar to that in A-M (data not shown). Diamide, which can bind the SH groups of reduced thiols and oxidize them (22), induced cell death of M-M and GM-M, but the levels of cell death were not very high (20%) and no significant difference was observed between the effects of diamide on these two Ms (Fig. 5B). 40 µM diamide and 10 µg/ml anti-Cat Ab showed synergistic effects on the cell viability of M-M cultured with M-CSF and GM-M cultured without CSF, causing reduction of their viability to <10% at 48 h (Fig. 5B). These results suggest that, in contrast to that of catalase, the levels of thiol derivatives were constant in these Ms with CSF withdrawal-induced oxidative stress and that thiol derivatives have only a minor effect and cannot support the full survival of M.

View larger version (26K): [in this window] [in a new window]   FIGURE 4. Activities, protein levels, and mRNA levels of catalase in monocyte-derived M and A-M. M were cultured with or without CSF for 48 h (A, B) or for 3 h (C). A and B, enzyme activities (upper panel) and protein levels (lower panel) of catalase in the culture medium (25 µl/lane) (A) or cell lysates (25 µg/lane) (B) from M were examined as described under "Experimental Procedures." Western blot analysis of catalase protein in the culture medium or cell lysates of M was performed using anti-catalase antibody. The relative amounts of catalase protein in cells were measured using NIH image software, and the expression levels were corrected relative to those of -actin (photo-stim ulating luminescence (PSL), A/mm2). C, mRNA levels of catalase and the -actin gene were examined in total RNA preparations (10 µg/lane) from these M at 3 h of cultivation by Northern blot analysis. The relative transcript levels of catalase mRNA in cells were measured using NIH image software, and the expression levels were corrected relative to those of -actin (photo-stimulating luminescence, A/mm2).

View larger version (26K): [in this window] [in a new window]   FIGURE 5. Partial effect of GSH on the survival of monocyte-derived M. A, intracellular GSH levels in M-M and GM-M incubated with or without CSF for 24 h were measured as described under "Experimental Procedures." Values are expressed as the means of triplicate cultures ± S.D. B, M-M or GM-M were cultured for 48 h in medium supplemented or not supplemented with CSF, anti-catalase antibody (Anti-Cat Ab), diamide, or the combination of them, and cell number and viability were assessed as described above.

View larger version (31K): [in this window] [in a new window]   FIGURE 6. BCL-2 AS dominantly induced cell death of M-M. A, cell number and viability of M at 7 days after 5 µM AS treatment (upper panel) and immunoblot analysis at 2 days (lower panel). B, cell number and viability of M at 7 days after the indicated concentrations of AS treatment (upper panel) and immunoblot analysis at 2 days (lower panel). M-M were cultured in medium supplemented with the indicated concentrations of BCL-2 AS (G3139), BCL-2 MS (G4126), 5'-BCL-X AS (BCL-X AS), MCL-AS or control random sequence (oligonucleotide MS). Cell number and viability of M were assessed as described in Fig. 1. Values are expressed as the means of triplicate cultures ± S.D. Western blot analysis of BCL-2, BCL-XL/S, MCL-1, and -actin proteins in cell lysates of M probed using BCL-2, BCL-X (antibody from Santa Cruz Biotechnology for XL/S band, from Sinal transduction Labo for XL band only), and -actin antibody was performed as described in Fig. 4. The relative amounts of these proteins in cells were measured using NIH image software, and the expression levels were shown as photo-stimulating luminescence (PSL).

In contrast, treatment of GM-M with 5'-BCL-X AS down-regulated the expression of BCL-X_L protein to 20% of that of control cells treated with oligonucleotide MS at 2 days after the oligonucleotide treatment and induced the cell death in a dose-dependent manner (Fig. 7). The cell viability markedly decreased to 25% of that of control cells at 7 days of cultivation. As shown in Fig. 6, however, 90% of the cells are viable in M-M treated with 5 mM 5'-BCL-X AS in agreement with the low expression of BCL-X_L protein.

MCL-1, a main molecule of BCL-2 family protein (14), is expressed in both M-M and GM-M, but down-regulation of this protein by treatment with MCL-1 AS did not stimulate the cell death of either M or affect the expression levels of BCL-2 in M-M and BCL-X_L in GM-M. These findings suggest that BCL-2 and BCL-X_L expression supported by catalase prevents cell death of M-M and GM-M, respectively, in agreement with the dominant expression levels of gene and protein of BCL-2 in M-M and BCL-X_L in GM-M.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The present study showed that extracellular catalase has a novel role in the prevention of apoptosis in human M through the dominant expression of BCL-2 in M-M and BCL-X_L in GM-M and that the regulation of catalase production is CSF-dependent in M-M but CSF-independent in GM-M and A-M. Recently, H₂O₂ has been shown to enhance oxidative damage and apoptosis in C2-ceramide-pretreated HL-60 cells via a mechanism in which C2-ceramide inhibits catalase activity by increasing casapase-3-dependent proteolysis of catalase and down-regulation of catalase mRNA (25). Overexpression of catalase inhibits oxidation-mediated apoptosis through phosphorylated BCL-2, a reduced form of BCL-2 and BAX interaction (20). Thus, constant high activity of extracellular catalase plays an important role in the prevention of ceramide- and caspase-3-induced apoptosis in CSF independent of GM-M and A-M and CSF dependent of M-M (11, 26).

GM-CSF and M-CSF stimulate catalase induction during the differentiation of Mo into M, but GM-CSF alone establishes a CSF-independent autoregulatory system of catalase production in M. We previously showed that human Mo-derived GM-M resembles human A-M in several respects (2, 5-7). In this study, we showed that GM-M and A-M have a similar phenotype of the resistance to apoptosis via CSF-independent expression of catalase and BCL-X_L. Consistent with our present study, A-M from human smokers express higher levels of p21^CIP1/WAF1 and BCL-X_L, but not BCL-2, and the former two molecules may reduce apoptosis (9). The autoregulatory mechanism of catalase induction in GM-M and A-M is not yet understood but may have a strong correlation with endogenously generated low levels of H₂O₂ (8), because we previously showed that GM-M and A-M, but not M-M, can increase catalase expression at both the protein and mRNA levels when stimulated with H₂O₂ (2). Adequate low levels of H₂O₂ may keep catalase activity constant to prevent CSF deprivation-induced apoptosis in GM-M and A-M.

View larger version (40K): [in this window] [in a new window]   FIGURE 7. BCL-X AS dominantly induced cell death of GM-M. A, cell number and viability of M at 7 days after 5 µM AS treatment (upper panel) and immunoblot analysis at 2 days (lower panel). B, cell number and viability of M at 7 days after the indicated concentrations of AS treatment (upper panel) and immunoblot analysis at 2 days (lower panel). The experimental procedure was performed as described in Fig. 6.

We demonstrated that catalase regulates apoptosis through the expression of BCL-2 and BCL-X_L in human M used in the present study. In fact, down-regulation of these proteins by RNA interference treatment induced the cell death of the Ms. Proapoptotic BCL-2 family protein, BAX, can induce apoptosis with permeabilization of mitochondrial membranes and cytochrome c release (10, 18, 27). In a recent study, induction of apoptosis of TF-1 cells by GM-CSF withdrawal is shown to be related to down-regulation of the MCL-1 gene, and overexpression of MCL-1 is shown to delay apoptosis (16). In our study, however, BAX and MCL-1 were not associated with the regulation of apoptosis of M, because both mRNA and protein levels of these genes were not significantly changed in M-M and GM-M after CSF deprivation. Moreover, we showed that down-regulation of the expression of MCL-1 protein by MCL-1 As treatment did not affect the viability of the Ms.

Our interesting finding is that BCL-2 and BCL-X_L are differently expressed in M during the Mo differentiation into M in the presence of M-CSF and GM-CSF; the expression of BCL-2 is dominant in M-M and that of BCL-X_L is dominant in GM-M or A-M. In accordance with such different expression patterns, we found by RNA interference experiments that BCL-2 and BCL-X_L play a critical role for the survival of M-M and GM-M, respectively. Similar differential expression of BCL-2 and BCL-X_L is also observed during the selection and maturation of mouse thymocytes toward splenic T cells (17, 19). At present, we do not know the mechanisms that control the different induction of BCL-2 and BCL-X_L in M-M and GM-M or A-M, respectively. The distal promoter region of the BCL-X_L gene responds to very low levels of H₂O₂ at exon 1B-1D in rodent cardiac myocytes, and the expression of BCL-X_L protein is increased by H₂O₂ treatment (28). Thus, GM-M and A-M, which possess high catalase activity even in the absence of CSF, limit the levels of endogenously generated H₂O₂ to low levels that are suitable for BCL-X_L expression.

In conclusion, the present study is the first to reveal that CSF is a critical regulator of extracellular catalase activity that maintains selective expression of BCL-2 family genes and prevents tissue-specific M from apoptosis. These distinct patterns of CSF-induced regulation of catalase activity may greatly contribute to the oxidant stress-induced selection of tissue Ms suitable for their respective microenvironments.

	FOOTNOTES

 
^* This study was supported in part by grants for Research on Health Sciences Focusing on Drug Innovation from the Japan Health Sciences Foundation and the Ministry of Health, Labor, and Welfare of Japan. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ To whom correspondence should be addressed. Tel.: 81-3-5285-1111; Fax: 81-3-5285-1150; E-mail: akagawak{at}nih.go.jp.

² The abbreviations used are: M, macrophage; M-M, M-CSF-induced monocyte-derived M; A-M, alveolar M; GM-M, granulocyte-macophage-CSF induced monocyte-derived M; CSF, colony-stimulating factor; HEC, human erythrocyte catalase; CM, conditioned medium; Mo, monocytes; GSH, glutathione; AS, antisense oligonucleotide; BCL AS (G3139), 2'-O-methyl-modified oligonucleotide phosphorothioate 18-mer two CpG motifs targeted to the BCL-2 initiation codon; BCL MS (G4126), G3139 variant with single base mismatch at each CpG motif; 5'-BCL-X AS, 2'-O-methyl-modified oligonucleotide phosphorothioate 18-mer to the 5'-splice site of BCL-X_L; MS, missense; anti-Cat ab, anti-HEC antibody.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Pietarinen, P., Raivio, K., Devlin, R. B., Crapo, J. D., Chang, L. Y., and Kinnula, V. L. (1995) Am. J. Respir. Cell Mol. Biol. 13, 434-441[Abstract]
2. Komuro, I., Keicho, N., Iwamoto, A., and Akagawa, K. S. (2001) J. Biol. Chem. 276, 24360-24364[Abstract/Free Full Text]
3. Eischen, A., Duclos, B., Schmitt-Goguel, M., Rouyer, N., Bergerat, J. P., Hummel, M., Oskam, R., and Oberling, F. (1994) Br. J. Haematol. 88, 712-722[Medline] [Order article via Infotrieve]
4. Dranoff, G., Crawford, A. D., Sadelain, M., Ream, B., Rashid, A., Bronson, R. T., Dickersin, G. R., Bachurski, C. J., Mark, E. L., Whitsett, J. A., and Mulligan, R. C. (1994) Science 264, 713-716[Abstract/Free Full Text]
5. Hashimoto, S. I., Komuro, I., Yamada, M., and Akagawa, K. S. (2001) J. Immunol. 167, 3619-3625[Abstract/Free Full Text]
6. Akagawa, K. S. (2002) Int. J. Hematol. 76, 27-34[Medline] [Order article via Infotrieve]
7. Komuro, I., Yokota, Y., Yasuda, S., Iwamoto, A., and Kagawa, K. S. (2003) J. Exp. Med. 198, 443-453[Abstract/Free Full Text]
8. Borutaite, V., and Brown, G. C. (2001) FEBS Lett. 500, 114-118[CrossRef][Medline] [Order article via Infotrieve]
9. Tomita, K., Caramori, G., Lim, S., Ito, K., Hanazawa, T., Oates, T., Chiselita, I., Jazrawi, E., Chung, K. F., Barnes, P. J., and Adcock, I. M. (2002) Am. J. Respir. Crit. Care Med. 166, 724-731[Abstract/Free Full Text]
10. Shankaranarayanan, P., and Nigam, S. (2003) J. Immunol. 170, 887-894[Abstract/Free Full Text]
11. Goyal, A., Wang, Y., Graham, M. M., Doseff, A. I., Bhatt, N. Y., and Marsh, C. B. (2002) Am. J. Respir. Cell Mol. Biol. 26, 224-230[Abstract/Free Full Text]
12. Raffo, A., Lai, C. J., Stein, A. C., Miller, P., Scaringe, S., Khvorova, A., and Benimetskaya, L. (2004) Clin. Cancer Res. 10, 3195-3206[Abstract/Free Full Text]
13. Mercatante, R. D., Bortner, D. C., Cidlowski, A. J., and Ryszard, K. (2001) J. Biol. Chem. 276, 16411-16417[Abstract/Free Full Text]
14. Derenne, S., Monia, B., Dean, M. N., Taylor, K. J., Rapp, M.-J., Harousseau, J.-L., Bataille, R., and Amiot, M. (2002) Blood 100, 194-199[Abstract/Free Full Text]
15. Anderson, M. E. (1989) in Glutathione: Chemical, Biochemical, and Medical Aspects (Dolphind, D., Poulson, R., and Avramovic O., eds) Vol. A, 339-365, John Wiley and Sons, New York
16. Liu, H., Ma, Y., Cole, S. M., Zander, C., Chen, K. H., Karras, J., and Pope, R. M. (2003) Blood 13, 13
17. Broome, H. E., Dargan, C. M., Krajewski, S., and Reed, J. C. (1995) J. Immunol. 155, 2311-2317[Abstract]
18. Yamaguchi, H., and Wang, H. G. (2001) Oncogene 20, 7779-7786[CrossRef][Medline] [Order article via Infotrieve]
19. Haughn, L., Hawley, R. G., Morrison, D. K., Von Boehmer, H., and Hockenbery, D. M. (2003) J. Biol. Chem. 28, 28
20. Xiao, D., Choi, S., Johnson, D. E., Vogel, V. G., Johnson, C. S., Trump, D. L., Lee, Y. J., Singh, S. V., Lu, D., Bai, X. C., Gui, L., Su, Y. C., Deng, F., Liu, B., Li, X. M., Zeng, W. S., Cheng, B. L., Luo, S. Q., Pugazhenthi, S., Nesterova, A., Jambal, P., Audesirk, G., Kern, M., Cabell, L., Eves, E., Rosner, M. R., Boxer, L. M., Reusch, J. E., Liu, A. L., Zou, Z. P., Wang, Y., Ke, Z. Y., and Ji, Q. S. (2004) Oncogene 7, 7
21. Sandstrom, P. A., and Buttke, T. M. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 4708-4712[Abstract/Free Full Text]
22. Sato, N., Iwata, S., Nakamura, K., Hori, T., Mori, K., and Yodoi, J. (1995) J. Immunol. 154, 3194-3203[Abstract]
23. Iwata, S., Hori, T., Sato, N., Hirota, K., Sasada, T., Mitsui, A., Hirakawa, T., and Yodoi, J. (1997) J. Immunol. 158, 3108-3117[Abstract]
24. Kirkland, R. A., and Franklin, J. L. (2001) J. Neurosci. 21, 1949-1963[Abstract/Free Full Text]
25. Iwai, K., Kondo, T., Watanabe, M., Yabu, T., Kitano, T., Taguchi, Y., Umehara, H., Takahashi, A., Uchiyama, T., and Okazaki, T. (2003) J. Biol. Chem. 278, 9813-9822[Abstract/Free Full Text]
26. Yamada, Y., Kajiwara, K., Yano, M., Kishida, E., Masuzawa, Y., and Kojo, S. (2001) Biochim. Biophys. Acta 1532, 115-120[Medline] [Order article via Infotrieve]
27. Garland, J. M., and Rudin, C. (1998) Blood 92, 1235-1246[Abstract/Free Full Text]
28. Valks, D. M., Kemp, T. J., and Clerk, A. (2003) J. Biol. Chem. 278, 25542-25547[Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				J. Roiniotis, H. Dinh, P. Masendycz, A. Turner, C. L. Elsegood, G. M. Scholz, and J. A. Hamilton Hypoxia Prolongs Monocyte/Macrophage Survival and Enhanced Glycolysis Is Associated with Their Maturation under Aerobic Conditions J. Immunol., June 15, 2009; 182(12): 7974 - 7981. [Abstract] [Full Text] [PDF]

				M. Chang, J. A. Hamilton, G. M. Scholz, and C. L. Elsegood Glycolytic control of adjuvant-induced macrophage survival: role of PI3K, MEK1/2, and Bcl-2 J. Leukoc. Biol., June 1, 2009; 85(6): 947 - 956. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 280/50/41137    most recent M509793200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Komuro, I. Articles by Akagawa, K. S. Search for Related Content PubMed PubMed Citation Articles by Komuro, I. Articles by Akagawa, K. S. Social Bookmarking                      What's this?