|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 280, Issue 52, 42557-42567, December 30, 2005
Synthetic Vpr Protein Activates Activator Protein-1, c-Jun N-terminal Kinase, and NF-
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ABSTRACT |
|---|
|
|
|---|
B in the promonocytic cell line U937 and in primary macrophages. Synthetic HIV-1 Vpr protein activated AP-1, c-Jun N-terminal kinase, and MKK7 in both U937 cells and primary macrophages. Synthetic Vpr activated NF-
B in primary macrophages and to a lesser extent in U937 cells. Because synthetic Vpr activated AP-1 and NF-
B, which bind to the HIV-1 long terminal repeat, we investigated the effect of synthetic Vpr on HIV-1 replication. We observed that synthetic Vpr stimulated HIV-1 long terminal repeat in U937 cells and enhanced viral replication in chronically infected U1 promonocytic cells. Similarly, synthetic Vpr stimulated HIV-1 replication in acutely infected primary macrophages. Activation of transcription factors and enhancement of viral replication in U937 cells and primary macrophages were mediated by both the N-terminal and the C-terminal moieties of synthetic Vpr. Therefore, our results suggest that extracellular Vpr could fuel the progression of AIDS via stimulation of HIV-1 provirus present in such cellular reservoirs as mononuclear phagocytes in HIV-infected patients. | INTRODUCTION |
|---|
|
|
|---|
) (57). It also arrests infected cells at the G2 stage of the cell cycle and prevents their progression into mitosis by suppressing cyclin B-associated kinase activity (810). In addition, Vpr has been shown to induce cellular differentiation (11), to modulate apoptosis (1217), to enhance the fidelity of the viral reverse transcriptase (18), and to regulate HIV replication (19, 20). The HIV-1 Vpr protein has been found to interact with several cellular partners including the glucocorticoid receptor type II complex, Lys-tRNA synthetase, uracil DNA glycosylase, cyclophilin A, heat shock protein 70, transcription factors such as TFIIB, and co-activators such as p300/CBP (18, 2127).
The importance of Vpr for viral persistence, replication, and pathogenesis is suggested by a number of studies. Although this protein does not confer a significant viral growth advantage in primary T cells (28), its function is strictly required for viral replication in nondividing cells, such as monocytes/macrophages (3, 29). However, positive effects of Vpr on HIV replication have been observed in a number of cell types as a result of its ability to delay infected cells at the G2/M phase of the cell cycle, in which the HIV long terminal repeat (LTR) is transcriptionally more active (4). Vpr has been shown to associate as an adaptor with transcription factors (e.g. Sp1) or co-activators (e.g. p300/CBP), to activate the transcription factors NF-interleukin-6 and NF-
B and to induce interleukin-8 expression (20, 3032).
The Vpr protein is characterized by three
helices (HI, amino acids 1733; HII, amino acids 3850; HIII, amino acids 5677) surrounded by flexible N- and C-terminal domains (33). The HIV-1 Vpr protein has two major regions important for nuclear localization that can function independently, as demonstrated by the use of truncated Vpr constructs (3335). The two major regions of HIV-1 Vpr important for nuclear localization are the N-terminal
-helix, residues 1733 (33, 3638), and the C-terminal
-helix, residues 5677 (33, 39). The N terminus of Vpr including the first
-helical domain has been reported to promote nuclear import, to transactivate the HIV LTR, to be involved in virion packaging, to be important for Vpr oligomerization, and to localize both in the nucleus, especially in the nuclear membrane and, to a lesser extent, in the cytoplasm (34, 37, 38, 4045). The C terminus of Vpr including the third
-helical domain is involved in LTR transactivation and cell cycle arrest, has protein-transducing properties, has been reported to trigger apoptosis, and localizes within the nucleus (35, 37, 3941, 4450).
HIV replication is tightly regulated at the transcriptional level through the specific interaction of viral regulatory proteins, namely, Tat and cellular transcription factors binding to a variety of cis-acting DNA sequences in the HIV LTR (51). One of the main mediators of HIV LTR transcription is NF-
B (52). As an inducible transcription factor, NF-
B is composed of homo- and heterodimers of Rel family proteins (53). All of them contain an N-terminal Rel homology domain, which mediates DNA binding, dimerization, and interaction with the inhibitory proteins, or I
Bs. In addition, c-Rel, p65 (RelA), and RelB contain a C-terminal transactivation domain (53). The classical NF-
B complex (p50/p65) is sequestered in the cytoplasm by interaction with a family of inhibitory proteins, or I
Bs, including I
B
, I
B
, I
B
, I
B
, and the proto-oncogene Bcl-3 (54). After cell activation by a variety of extracellular stimuli, such as tumor necrosis factor (TNF)
, I
B
is phosphorylated at the N-terminal Ser-32 and Ser-36 residues by the I
B kinase complex, leading to ubiquitination and subsequent proteasome-mediated degradation, which allows NF-
B to translocate to the nucleus, where it activates gene expression. Since the identification of NF-
B elements in the HIV LTR (52), multiple studies have assessed the effect of this family of transcription factors on the transcriptional regulation of the HIV LTR and its impact on HIV reactivation from latency (55). Studies of the interaction between NF-
B and HIV in both human monocytic cells and transformed human M
have mainly focused on how monocyte differentiation may lead to HIV expression (56) and how HIV infection leads to NF-
B activation. In the promonocytic cell line U937, HIV activates the inducible pool of NF-
B as a result of enhanced I
B
degradation, which is believed to be secondary to I
B kinase activation (57, 58).
The activity of activator protein-1 (AP-1), a transcription factor consisting of a homodimer and heterodimers of members of the Jun family (c-Jun, JunB, and JunD) and heterodimers of the Jun and Fos (c-Fos, FosB, Fra1, and Fra2) families, is regulated at least in part by the activation of c-Jun N-terminal kinase (JNK) and the mitogen-activated protein kinase activator, MKK7 (53). It has also been suggested that the activation of NF-
B is regulated by some upstream mitogen-activated protein kinases that also regulate JNK activation in the cells (59).
Extracellular Vpr protein has been detected in the sera and cerebral spinal fluid of HIV-infected subjects at levels similar to those of p24 antigen (50, 6062). Both antibodies and cytotoxic T lymphocytes directed against Vpr have been found in HIV-infected individuals (63, 64). This suggests that in vivo Vpr is processed and presented by antigen-presenting cells, as the result of uptake of extracellular Vpr possibly released by infected apoptotic cells (65). Vpr has been shown to be efficiently taken up from the extracellular medium by cells in a process that occurs independently of other HIV-1 proteins and appears to be independent of cellular receptors (50, 65). Confocal microscopy indicates that the intracellular distribution of internalized Vpr is identical to that of endogenously produced Vpr, localizing both in the cytoplasm and in the nucleus (41, 50). Although most of the results reported so far in regard to signaling were obtained after expression of endogenous Vpr protein, extracellular Vpr protein could also be involved in the modulation of cell signaling, especially in promonocytic cells and in primary M
. Because activation of NF-
B and AP-1 results in stimulation of HIV-1 replication (57, 66, 67), we investigated the role of extracellular synthetic Vpr protein in this process. We observed that synthetic Vpr protein activates AP-1, JNK, and NF-
B in promonocytic cells U937 and in primary M
and enhances HIV-1 replication in chronically infected U1 cells and in acutely infected primary M
.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
(39, 68). Anti-HIV-1 Vpr antibody was provided by Dr. Josephine Sire (INSERM U372, Marseille, France). Antibody against phospho-I
B
(Ser-32) and phospho-MKK7 were obtained from Cell Signaling Technology (Beverly, MA). The antibody against
-actin was obtained from Sigma-Aldrich (A1978, clone AC15). The antibodies anti-p50 (C19, catalogue #sc109X), anti-p65 (AX, catalogue #sc52X), anti-RelB (C19, catalogue #sc226X), anti-c-Rel (B6, catalogue #sc1190X), anti-p52 (C5, catalogue #sc6955X), anti-c-fos (4, catalogue #sc44X), and anti-c-Jun (D, catalogue #sc52X) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The double-stranded oligonucleotide having the AP-1 and NF-
B consensus sequence were obtained from Eurobio (Courtaboeuf, France). TNF was purchased from R&D Systems (Minneapolis, MN).
Cell Lines and Primary M
Most of the studies were performed with the promonocytic cells U937 obtained from the American Tissue Cell Culture Collection (ATCC, Manassas, VA). The promonocytic cell line U1, derived from cells surviving acute infection of the U937 cell line, contains two integrated HIV copies per cell (69). U1 cells were a gift from Dr. U. Mahlknecht (University of Heidelberg, Germany). U937 and U1 cells were cultivated in RPMI 1640 supplemented with 10% fetal bovine serum.
Human peripheral blood mononuclear cells were prepared from peripheral blood of healthy donors as previously described (70). Ficoll-Hypaque (Eurobio)-isolated human peripheral blood mononuclear cells were incubated for 2 h on plastic. Adherent differentiated M
(>94% CD14+ by flow cytometric analysis) were cultured in RPMI medium supplemented with 10% (v/v) pooled human serum (kindly provided by the Etablissement Français du Sang Bourgogne Franche-Comté, France) as previously reported (71).
Electrophoretic Mobility Shift AssayTo measure NF-
B and AP-1 activation, electrophoretic mobility shift assays were carried out as previously described (72). To measure AP-1 activation, nuclear extracts, prepared as described above, were incubated with 32P-end-labeled AP-1 consensus oligonucleotide 5'-CGCTTGATGACTCAGCCGGAA-3' (bold indicates the AP-1-binding site) and analyzed on a 6% native polyacrylamide gel. The specificity of binding was examined by competition with unlabeled oligonucleotide, with a heterologous unlabeled oligonucleotide (5'-TTGTTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGG-3'), with a consensus unlabeled oligonucleotide (5'-TCTGTTGTGGACTCTG-3'), and with a mutated AP-1 oligonucleotide (5'-CGCTTGATGACTTGGCCGGAA-3') (Santa Cruz Biotechnology). To determine ATF2 activation, we used the NufshiftTM ATF2 kit (Active Motif, Rixensart, Belgium). Nuclear extracts were incubated with 32P-end-labeled 23-mer double-stranded ATF2 oligonucleotide, 5'-GATTCAATGACATCACGGCTGTG-3' (bold indicates ATF2-binding sites). The specificity of the binding was examined by competition with a mutated unlabeled oligonucleotide, 5'-GATTCAAGAACATAGCGGCTGTG-3'. The DNA-protein complex formed was analyzed on a 6% native polyacrylamide gel. The dried gels were visualized, and radioactive bands were quantified by a Molecular Images System GS 505 (Bio-Rad) using Multianalyst software.
Western Blot AnalysisCytoplasmic extracts of U937 cells and primary M
treated for different times with synthetic HIV-1 Vpr protein were used to examine I
B
phosphorylation and MKK7 phosphorylation by Western blot procedures, as previously described (72).
c-Jun Kinase AssayThe JNK assay was performed using the kinase STARTM JNK activity assay kit (Biovision Research, Mountain View, CA).
Reporter Gene Expression AssaysTo examine HIV-1 Vpr-induced NF-
B-dependent and AP-1-dependent gene expression, cells were transfected with the secreted alkaline phosphatase (SEAP) expression plasmid for 24 h before treatment with HIV-1 Vpr. After 24 h, cell culture conditioned medium was harvested and analyzed for alkaline phosphatase activity, as described in the manufacturer's protocol (Clontech, Palo Alto, CA). SEAP activity was assayed on a 96-well flat bottom microtiter plates suitable for plate luminometers (Victor Wallac2, PerkinElmer Life Sciences). This reporter system was specific since TNF-induced NF-
B SEAP activity was inhibited by overexpression of the I
B
mutant, I
B
-DN, which lacks Ser-32 and Ser-36 (72).
To examine NF-
B and AP-1 LTR-driven gene expression by synthetic HIV-1 Vpr, 2 x 106 U937 cells were transfected with 20 µg of pLTR-Luc, 20 µg of pLTRmut-NF-
B-Luc, or 20 µg of pLTRmut-AP1-Luc using the electroporation system, according to the manufacturer's instructions (Bio-Rad). Twenty-four hours later, the cells were stimulated with different concentrations of synthetic HIV-1 Vpr or with TNF. At 48 h after transfection, luciferase activity was measured in cell lysates using a luminometer (Victor Wallac2) as previously reported (72). Values normalized to protein concentrations were expressed as -fold increase over unstimulated control values.
p24 AssayPrimary M
were infected overnight with HIV-1 SF-162 or HIV-89.6 (10 ng of p24/4 x 105 cells). Cells were then washed three times with phosphate-buffered saline to remove the unadsorbed inoculum and reincubated in fresh culture medium at 37 °C. U1 cells and HIV-infected primary M
were treated with different concentrations of synthetic HIV-1 Vpr or TNF at the time of infection and every 3 days thereafter. Culture supernatants were collected for up to 18 days and assayed for p24 antigen using a micro-enzyme-linked immunosorbent assay (Organon, Teknika, Biomerieux, Boxtel, Netherlands).
Detection of Proviral LTR by Real-time PCRPrimary M
were cultivated in T25 flasks (3 x 106 cells/flask), infected with HIV-1 SF-162 (50 ng of p24), and then treated with synthetic HIV-1 Vpr (0.1 ng/ml). Before use, the HIV-1 SF-162 stock was treated for 30 min at room temperature with 100 µg of DNase I/ml supplemented with 5 mM MgCl2. After 1 h of exposure to the virus at 37 °C, the cells were washed 3 times with phosphate-buffered saline to remove the unadsorbed inoculum and reincubated in fresh culture medium supplemented with HIV-1 Vpr (0.1 ng/ml) at 37 °C. The cells were incubated for 0, 24, 48, and 72 h in a buffer containing 100 mM KCl, 20 mM Tris (pH 8.4), 500 µg of proteinase K/ml, and 0.2% (v/v) Nonidet P-40, as previously described (73). Real-time PCR was performed on cell lysates according to the manufacturer's instructions using the ABI Prism 7000 PCR system (Applied Biosystems, Foster City, CA), as previously described (71). The PCR primer sequences for LTR and human
-globin gene (DNA control) were as follows: HIV-1 LTR primers, CACACAAGGCTACTTCCCTGA (U3 (sense)) and GATCTCTAGTTACCAGAGTCAC (U5 (antisense)); human
-globin primers (5'-GAAGAGCCAAGGACAGGTAC-3' (sense); 5'-CAACTTCA TCCACGTTCACC-3' (antisense)) (71, 73).
VirusesHIV-1 SF162 and HIV-1 89.6 (AIDS Reagent Program, NIAID, National Institutes of Health) were grown and titrated in tissue-culture differentiated M
as described previously (70). Endotoxin contamination was avoided, and no exogenous cytokines or growth factors were added to virus stock cultures. At 12 and 15 days after infection, viral supernatants were clarified by centrifugation at 1200 x g for 10 min and passaged through 0.44-µm pore size filters. Viral DNA was removed by treatment with 100 µg of DNase I/ml in the presence of 5 mM MgCl2 for 30 min at room temperature. The supernatants were divided into aliquots and stored at 80 °C.
Statistical AnalysisThe figures show the means of independent experiments and S.E. Statistical comparison of Vpr-treated cells with matched control cell populations was performed using Student's t test (Figs. 1F, 2G, 4, 5, and 6). The level of significance was set at p < 0.05. The program used for plotting was Microsoft Excel.
| RESULTS |
|---|
|
|
|---|
In addition to U937 monocytoid cells, we assessed primary human M
for AP-1 activation. In primary M
, synthetic Vpr activated AP-1, with optimal activation occurring at
60 min (Figs. 2, A and B). Interference analysis with specific antibodies against c-Fos and c-Jun indicated that AP-1 activation induced by synthetic Vpr consisted of Fos and Jun (Fig. 2C). The gel shift band was specific, as formation of the complex was blocked with an unlabeled oligonucleotide but not with a mutated oligonucleotide (Fig. 2D). Both synthetic Vpr-(151) and Vpr-(5296) proteins activated AP-1 in primary M
(Fig. 2E). The pretreatment of synthetic Vpr, Vpr-(151), and Vpr-(5296) proteins with an anti-Vpr antibody blocked AP-1 activation (Fig. 2F), thereby indicating the effect was Vpr-specific. Treatment of M
with synthetic Vpr, Vpr-(151), and Vpr-(5296) proteins activated JNK (p < 0.05) (Fig. 2G). Synthetic Vpr, Vpr-(151), and Vpr-(5296) proteins activated MKK7 in primary M
(Fig. 2H).
Synthetic Vpr Activates NF-
BTreatment of primary M
with synthetic HIV Vpr activated NF-
B, with maximum activation occurring at 1 ng/ml (Figs. 3, A and B). The gel shift band was specific, as formation of the complex was blocked by an unlabeled oligonucleotide (data not shown) and was supershifted by either anti-p50 or anti-p65 antibody alone and also by a mixture of anti-p50 and anti-p65 antibodies (Fig. 3C), indicating that it is composed of p50 and p65 subunits. To rule out the possibility that a TNF inducer, such as lipopolysaccharide, produced the activity, we treated synthetic HIV Vpr protein with 1% trypsin or boiled it at 100 °C. Both treatments abolished Vpr-induced NF-
B activity, indicating that synthetic Vpr protein, but not lipopolysaccharide contamination, was responsible for NF-
B activation (data not shown). Both synthetic Vpr-(151) and Vpr-(5296) proteins activated NF-
B in primary M
(Fig. 3D). The phosphorylated form of I
B
, which is required for I
B
degradation, appeared when primary M
were treated with synthetic Vpr protein for different periods of time. Maximum phosphorylation occurred at 60 min (Fig. 3E). Synthetic Vpr-(151) protein, and to a lesser extent synthetic Vpr-(5296) protein, induced I
B
phosphorylation in primary M
(2.5- versus 1.5-fold induction) (Fig. 3E). The pretreatment of synthetic Vpr, Vpr-(151), and Vpr-(5296) proteins with an anti-Vpr antibody blocked NF-
B activation (Fig. 3F), thereby indicating the effect was Vpr-specific. Moreover, NF-
B activation observed in primary M
treated with synthetic Vpr was not blocked by a neutralizing anti-TNF antibody (Fig. 3G), indicating that NF-
B activation was not mediated by endogenously produced TNF. In agreement with data obtained in primary M
, synthetic Vpr protein activated NF-
B in monocytic U937 cells (Fig. 3H). In addition, synthetic Vpr-(151) protein, and to a lesser extent, synthetic Vpr-(5296) protein activated NF-
B in U937 cells (Fig. 3H).
|
|
|
B-driven SEAP gene expression (p < 0.05) in U937 cells (Fig. 4A). The pretreatment of synthetic Vpr protein with an anti-Vpr polyclonal antibody blocked both NF-
B and AP-1 activation (Fig. 4A), thereby indicating the effect was Vpr-specific. Both synthetic Vpr-(151) and Vpr-(5296) proteins activated AP-1 and, to a lesser extent, NF-
B in transfected U937 cells (p < 0.05) (Fig. 4A). Interestingly, synthetic Vpr, Vpr-(151), and Vpr-(152) proteins activated both NF-
B and AP-1, with maximal induction usually achieved when
1 ng/ml synthetic protein was used (Fig. 4A). Use of higher levels of synthetic Vpr, Vpr-(151), and Vpr-(5296) proteins increased the cell death rate (data not shown).
|
B-dependent LTR stimulation. U937 cells were transiently transfected with a target plasmid that contained the luciferase reporter gene under the control of the HIV-1 LTR promoter, pLTR-Luc (51). Twenty-four hours later, transfected cells were treated for 24 h with synthetic HIV-1 Vpr, synthetic HIV-1 Vpr-(151), or synthetic HIV-1 Vpr-(5296) at 1 ng/ml and harvested, and luciferase activity was measured in cell lysates. Synthetic HIV Vpr stimulation increased LTR activation by
2-fold over untreated control cells (p < 0.05) (Fig. 4B). As a positive control, TNF treatment of transfected U937 cells increased HIV-1 LTR stimulation by 2.5-fold (data not shown). Synthetic Vpr, Vpr-(151), and Vpr-(5296) proteins stimulated HIV LTR, achieving maximal induction when
1 ng/ml proteins was used (data not shown). LTR was not activated by synthetic Vpr when plasmids containing mutated AP-1 or NF-
B sites, pLTR-mut-AP-1-Luc, or pLTR-mut-NF-
B-Luc were used instead of pLTR-Luc (Fig. 4B). These data indicate that synthetic HIV Vpr activated the LTR via both AP-1 and NF-
B stimulation in promonocytic U937 cells. The pretreatment of synthetic Vpr protein with an anti-Vpr polyclonal antibody totally inhibited HIV LTR stimulation (Fig. 4B). Both synthetic Vpr-(151) and Vpr-(5296) proteins stimulated the LTR via both AP-1 and NF-
B activation in U937 cells (p < 0.05) (Fig. 4B).
Synthetic Vpr Stimulates HIV-1 Replication in Chronically Infected Promonocytic U1 Cells and in Acutely Infected Primary M
Because NF-
B and AP-1 DNA-binding sites are present in the HIV-1 LTR, we determined the effect of synthetic Vpr on provirus transcription in the promonocytic cell line U1, a U937 cell line that contains two integrated copies of the provirus per cell (69). Synthetic Vpr, Vpr-(5296), and Vpr-(151) proteins stimulated HIV-1 replication in U1 cells, as measured by p24 assay (Fig. 5). To rule out the possibility that a TNF inducer such as lipopolysaccharide enhanced viral replication in U1 cells, we boiled synthetic Vpr at 100 °C. Boiling significantly diminished synthetic Vpr-induced replication (p < 0.05) (Fig. 5), indicating that the protein was responsible for enhanced viral replication. The stimulation of HIV-1 replication by synthetic Vpr, Vpr-(151), and Vpr-(5296) proteins was significantly diminished by an anti-HIV-1 Vpr antibody (Fig. 5), indicating that the stimulation was Vpr-specific.
|
, we monitored the p24 activity in the supernatant of acutely infected M
. Synthetic Vpr stimulated HIV-1 replication in primary M
, with maximal viral expression achieved (
2-fold increase) when 1 ng/ml synthetic protein was used (Fig. 6A). We measured the time course of proviral LTR synthesis in untreated primary M
or in cells that had been treated with 0.1 ng/ml synthetic Vpr. The absence of proviral LTR in untreated primary M
at time 0 after infection indicated that the DNase I-treated viral stock itself contained no residual HIV-1 DNA (data not shown). In untreated cells, the HIV LTR signal was clearly detected 72 h post-infection but only dimly at 24 and 48 h post-infection (Fig. 6B). By contrast, in Vpr-treated primary M
, a significant increase in HIV LTR signal was detected as early as 24 h post-infection (p < 0.05) (Fig. 6B). An anti-Vpr antibody significantly decreased the HIV LTR signal (p < 0.05) (Fig. 6B), thereby indicating that the effect was Vpr-specific. As measured by p24 activity in culture supernatants, treatment with synthetic Vpr-(5296) protein enhanced HIV-1 replication in primary M
(Fig. 6A). Both Vpr and Vpr-(5296) treatments were deleterious to the cells when higher levels than 1 ng/ml were used (Fig. 6A) and were associated with increased incidence of cell death (data not shown). Stimulation of HIV-1 replication in M
treated with the synthetic Vpr-(5296) protein was sustained over time, up to 18 days post-infection (Fig. 6C). By contrast, synthetic Vpr-(151) protein stimulated viral replication at a high multiplicity of infection (100 ng of p24/4 x 105 cells) mostly during the first 3 days post-infection (Fig. 6D). Similar results were obtained after infection of M
with the dual-tropic HIV-1 89.6 virus (data not shown). The addition of an anti-Vpr antibody inhibited Vpr-mediated enhanced HIV-1 replication in primary M
(Figs. 6, B and D, and data not shown). | DISCUSSION |
|---|
|
|
|---|
B in promonocytic U937 cells and in primary M
. Synthetic HIV-1 Vpr stimulated HIV-1 LTR via AP-1 and NF-
B activation and stimulated HIV-1 replication in chronically infected U1 promonocytic cells and in acutely infected primary M
. Activation of transcription factors and enhanced viral replication in promonocytic cells and primary M
was mediated by both the N-terminal and the C-terminal moieties of synthetic Vpr. These data indicate that synthetic Vpr enhanced HIV-1 replication in latently infected promonocytic cells and in acutely infected primary M
, suggesting that extracellular Vpr could favor the spread of the disease via enhancement of viral replication from latently infected cellular reservoirs in HIV-infected subjects.
Our data indicate that synthetic Vpr protein stimulates HIV-1 LTR via both AP-1 and NF-
B activation. We observed a consistent AP-1 activation after Vpr treatment independent of the cell type or the assay used. Although published reports suggest that Vpr inhibits the expression of several cytokines by inhibiting NF-
B (12), we confirmed other reports that Vpr increases expression from HIV LTR, as has been reported for other
B-containing promoters, such as cytomegalovirus and SV40 (1, 3032, 75). Altogether these data further support the contention that Vpr is usually an enhancer of NF-
B-driven promoters. Whether use of alternative transcription factor family members for NF-
B or differences in the proliferative state or cell type used during NF-
B analysis (lymphoid versus myeloid cells) introduced variations, thereby altering the outcome of HIV transcription, remains to be explored. In agreement with others, we observed a 2-fold stimulation of HIV LTR in Vpr-expressing U937 cells versus untreated control cells (31, 75). Also, in agreement with others, we noted that high levels of Vpr could be toxic to cells and could result in the appearance of a NF-
B, AP-1, and HIV LTR-repressed cell phenotype, especially at concentrations higher than 1 ng/ml (31, 75). This repressed cell phenotype was observed mostly with Vpr-(5296), in agreement with the reported pro-apoptotic activity of the C terminus of Vpr (35, 45).
Our results indicate that extracellular Vpr, Tat, and Nef proteins may, in part, share similar functions. Thus, like extracellular Vpr protein, extracellular Tat and Nef proteins activate AP-1, JNK, and NF-
B, transactivate the HIV-1 LTR when added exogenously to U937 cells growing in culture, and stimulate HIV-1 replication in U1 cells (72, 76, 77). Also, like Nef and Tat proteins, Vpr protein is detected in the serum of HIV-infected subjects (50, 61, 78, 79). Like Vpr, both Tat and Nef proteins are efficiently taken up from the extracellular medium by cells independently of cellular receptors in vitro and in vivo, contributing to the transcellular activation of HIV-1 LTR promoter in latently infected cells (50, 65, 77, 78). Although no specific receptor for extracellular Vpr protein has been described so far, confocal microscopy indicated that the intracellular distribution of internalized, exogenously added Vpr protein was identical to that of endogenously produced Vpr, localizing both in the cytoplasm and in the nucleus (50, 65). The identical intracellular distribution could explain why exogenous synthetic Vpr activates AP-1, JNK, and NF-
B and stimulates the HIV-1 LTR. Thus, extracellular Vpr, Nef, and Tat proteins can enter target cells and activate HIV-1 LTR. Altogether these data indicate extracellular Vpr, Nef, and Tat have several redundant biological functions, including transcription activation.
|
B (Figs. 1, 2, 3), and ATF-2 (data not shown), suggesting that they modulate the cellular machinery in a similar way and, therefore, could have the same effect on HIV replication in mononuclear phagocytes (71, 80). We observed that synthetic Vpr, like TNF treatment, stimulates HIV-1 replication in the chronically infected promonocytic cell line U1 (70). Several features indicate that the activation of AP-1, JNK, and NF-
B by synthetic Vpr is a direct intrinsic effect of the Vpr protein and is not mediated via the release of endogenous TNF. First, we did not detect increased TNF levels in culture supernatants of U937 cells or primary M
treated with synthetic Vpr (data not shown). In agreement with our results, after Vpr stimulation, a 2-fold increase in the level of interferon-
, but not of TNF, in U937 cells has been observed (31). Second, Vpr protein has been recently reported as having anti-inflammatory properties (81). Third, the time curve of AP-1, JNK, and NF-
B activation is similar after treatment with either synthetic Vpr or TNF (76). Fourth, anti-TNF antibody did not inhibit Vpr-induced NF-
B activation in primary M
(Fig. 3G). Thus, to mimic the effect of TNF on primary M
, exogenously added Vpr might interfere with intracellular signaling pathways downstream of TNF receptors. Here we report that synthetic Vpr activates NF-
B and induces I
B
phosphorylation in primary M
. Because phosphorylation of I
B
at serine is induced, synthetic Vpr probably activates I
B kinase
, the only kinase known to phosphorylate I
B
directly (82). I
B kinase
is regulated by several upstream kinases (54). In agreement with this observation, our data show that synthetic Vpr activates MKK7, JNK, AP-1 (Figs. 1 and 2), and ATF-2,6 in both promonocytic cells and primary M
, indicating that synthetic Vpr interferes with the mitogen-activated protein kinase pathway, which is also involved in NF-
B activation (54, 67, 71, 74). Because typical HIV targets, such as monocytes or T cells, would be quiescent and unlikely to contain sufficient amounts of active transcription factor to support initial HIV replication (56), Vpr, in addition to transporting the preintegration virus RNA complex, also may serve to activate transcription factors such as AP-1 and NF-
B and allow for an initial burst of HIV transcription (67). In agreement with this hypothesis, the addition of Vpr into the extracellular medium rescues the replication of Vpr-deficient strains of HIV-1 in human M
cultures (50). Thus, exogenously added Vpr mimics TNF biological effects, suggesting that a viral protein could fuel the progression of the disease even in the absence of proinflammatory cytokines. This might be of critical importance at early stages of the disease when chronic immune activation is not yet predominant and viral factors are needed to establish a productive infection.
We observed that both synthetic Vpr-(151) and Vpr-(5296) proteins activate the transcription factors NF-
B and AP-1 in U937 cells and primary M
. In agreement with our data, residues present in the first and third
-helices, although far away from each other in the primary sequence of Vpr, have been recently reported to be close in the space in the tertiary structure (33). Therefore, synthetic Vpr-(151) and Vpr-(5296) proteins could target the same cellular components and thereby stimulate transcription factors NF-
B and AP-1 in a similar way.
Both N- and C-terminal moieties of synthetic Vpr activated HIV-1 replication in U1 promonocytic cells and primary M
. The N-terminal moiety of synthetic Vpr enhanced HIV-1 replication strongly in the first 3 days after infection and may, therefore, act like a starter to optimize viral replication in primary infected M
. By contrast, the C-terminal moiety of synthetic Vpr was more active in acutely HIV-infected primary M
, resulting in a sustained enhancement of HIV-1 replication. In agreement with this observation, gene defects clustered at the C terminus of the vpr gene of HIV-1 have been reported in long-term nonprogressors (41, 83, 84). In these long-term nonprogressors all the vpr defects in human peripheral blood mononuclear cells and plasma were clustered at the C-terminal moiety of the Vpr protein, between amino acid residues 83 and 89 (84). Vpr association with both Tat and cyclin T1 results in superactivation of LTR by Tat and is not observed with the R73S mutant of Vpr (49). Altogether, our results suggest that both the N-terminal and the C-terminal moieties of synthetic Vpr could synergistically enhance HIV-1 replication in primary M
.
In conclusion, our results show that synthetic Vpr protein activates AP-1, JNK, and NF-
B and stimulates viral replication in the chronically infected promonocytic cells U1 and in acutely infected primary M
. This observation suggests a critical role for extracellular Vpr protein in AIDS pathogenesis via enhancement of HIV-1 replication from latently infected mononuclear phagocytes. A better understanding of the mechanisms underlying the replication of HIV-1 from latently infected cellular reservoirs is likely to lead to new therapeutic approaches, perhaps ones that would clear virions from the reservoirs of HIV-infected individuals.
| FOOTNOTES |
|---|
1 Chargé de Recherches of the Fonds National de la Recherche Scientifique. ![]()
2 Maître de Recherches of the Fonds National de la Recherche Scientifique. ![]()
3 To whom correspondence may be addressed. Tel.: 713-794-1817; Fax: 713-794-1613; E-mail: aggarwal{at}mdanderson.org. 4 To whom correspondence may be addressed: Dept. of Virology, Franche-Comte School of Medicine, Hôpital Saint-Jacques, 2, place Saint-Jacques, F-25030 Besancon cedex, France. Tel.: 33-3-81-21-88-77; Fax: 33-3-81-66-56-95; E-mail: gherbein{at}chu-besancon.fr.
5 The abbreviations used are: HIV, human immunodeficiency virus; M
, macrophages; AP-1, activator protein-1; I
B, inhibitor of NF-
B; JNK, Jun N-terminal kinase; NF-
B, nuclear factor
B; LTR, long terminal repeat; TNF, tumor necrosis factor
; CBP, cAMP-response element-binding protein (CREB)-binding protein; SEAP, secreted alkaline phosphatase. ![]()
6 A. Varin, B. B. Aggarwal, and G. Herbein, unpublished data. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
U. Mahlknecht, I. Dichamp, A. Varin, C. Van Lint, and G. Herbein NF-{kappa}B-dependent control of HIV-1 transcription by the second coding exon of Tat in T cells J. Leukoc. Biol., March 1, 2008; 83(3): 718 - 727. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mishra, J. P. Mishra, and A. Kumar Activation of JNK-dependent Pathway Is Required for HIV Viral Protein R-induced Apoptosis in Human Monocytic Cells: INVOLVEMENT OF ANTIAPOPTOTIC BCL2 AND c-IAP1 GENES J. Biol. Chem., February 16, 2007; 282(7): 4288 - 4300. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |