Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M410899200 on December 3, 2004

J. Biol. Chem., Vol. 280, Issue 7, 5378-5390, February 18, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An addition or correction has been published
Right arrow All Versions of this Article:
280/7/5378    most recent
M410899200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martinez, M.
Right arrow Articles by Spertini, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martinez, M.
Right arrow Articles by Spertini, O.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Regulation of PSGL-1 Interactions with L-selectin, P-selectin, and E-selectin

ROLE OF HUMAN FUCOSYLTRANSFERASE-IV AND -VII*

Manuel Martinez, Magali Joffraud, Sylvain Giraud, Bénédicte Baïsse, Michael Pierre Bernimoulin, Marc Schapira, and Olivier Spertini{ddagger}

From the Service and Central Laboratory of Hematology, Centre Hospitalier Universitaire Vaudois, Bugnon 46, 1011 Lausanne, Switzerland

Received for publication, September 22, 2004


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
P-selectin glycoprotein ligand-1 (PSGL-1) interactions with selectins regulate leukocyte migration in inflammatory lesions. In mice, selectin ligand activity regulating leukocyte recruitment and lymphocyte homing into lymph nodes results from the sum of unequal contributions of fucosyltransferase (FucT)-IV and FucT-VII, with FucT-VII playing a predominant role. Here we have examined the role of human FucT-IV and -VII in conferring L-selectin, P-selectin, and E-selectin binding activities to PSGL-1. Lewis x (Lex) carbohydrate was generated at the CHOdhfr– cell surface by FucT-IV expression, whereas sialyl Lex (sLex) was synthesized by FucT-VII. Both human FucT-IV and -VII had the ability to generate carbohydrate ligands that support L-selectin-, P-selectin-, and E-selectin-dependent rolling on PSGL-1, with FucT-VII playing a major role. Cooperation was observed between FucT-IV and -VII in recruiting L-, P-, or E-selectin-expressing cells on PSGL-1 and in regulating cell rolling velocity and stability. Additional rolling adhesion assays were performed to assess the role of Thr-57-linked core-2 O-glycans in supporting L-selectin-, P-selectin-, and E-selectin-dependent rolling on PSGL-1. These studies confirmed that core-2 O-glycans attached to Thr-57 play a critical role in supporting L- and P-selectin-dependent rolling and revealed that additional binding sites support >75% of E-selectin-mediated rolling. The observations presented here indicate that human FucT-IV and -VII both contribute and cooperate in regulating L-selectin-, P-selectin-, and E-selectin-dependent rolling on PSGL-1, with FucT-VII playing a predominant role in conferring selectin binding activity to PSGL-1.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Selectins sequentially cooperate to support leukocyte tethering and rolling along inflamed vascular walls by mediating leukocyte interactions with glycoconjugated counter-receptors expressed by endothelium, adherent platelets, or leukocytes (1–8). L-selectin is present on most leukocytes, whereas P-selectin and E-selectin expression is induced following platelet and/or endothelial cell activation. P-selectin supports leukocyte rolling along postcapillary venules at the earliest time of inflammation (6) by interacting with its ligand P-selectin glycoprotein ligand-1 (PSGL-1),1 a mucin-like glycoprotein expressed on the microvilli of most leukocytes (9–13). PSGL-1 is also a major ligand for L-selectin (14–17) and E-selectin (18–24). By interacting with L-selectin, PSGL-1 mediates free flowing leukocyte rolling on leukocytes already adherent to the vascular wall (25). Human PSGL-1 binding to human L-selectin and P-selectin is dependent on tyrosine sulfation of amino-terminal residues 46, 48, and 51 and on {alpha}1,3-fucosylation of core-2 O-glycans attached to Thr-57 (20, 26–30). Core-2 O-glycans linked to Thr-57 are also involved in E-selectin binding to PSGL-1, whereas tyrosine sulfate residues are not required (19, 20, 31–33). Of note, additional ligands of E-selectin (31, 34–36) may also support leukocyte rolling and participate in hematopoietic progenitor growth and apoptosis (37).

Leukocyte {alpha}1,3-fucosyltransferases (FucT) synthesize Lex, sLex, and cutaneous lymphocyte antigen (CLA), which are essential to confer an activity to selectin ligands (38–42). FucT-IV and -VII are constitutively expressed in neutrophils, whereas lymphocytes express FucT-VII after cell activation (43–45). Human FucT-VII is involved in the synthesis of sLex and CLA, whereas human FucT-IV generates Lex and VIM-2 carbohydrate determinants; the physiological role of human FucT-IV in synthesizing sLex is uncertain (38, 40, 41, 46–49). Biochemical studies showed that FucT-IV fucosylates all N-acetyllactosamine units in neutral polylactosamines and internal lactosamine units in {alpha}2,3-sialylated polylactosamines, whereas FucT-VII transfers fucose only to distal {alpha}2,3-sialylated lactosamine units to generate the sLex terminus (50). Studies performed in FucT-VII-deficient mice revealed that FucT-VII confers P-selectin and E-selectin binding activity to PSGL-1 as well as L-selectin binding activity to ligands expressed on high endothelial venules of peripheral lymph nodes (51–53). FucT-VII-deficient mice exhibit a defect in leukocyte migration in inflammatory lesions and lymphocyte homing into peripheral lymph nodes (51, 52). In contrast, FucT-IV null mice presents only subtle defects in leukocyte adhesion with an increase in rolling velocities along inflamed vessels (52, 53). Unlike FucT-VII null mice, mice deficient in both FucT-IV and -VII exhibit an extreme leukocytosis with leukocytes virtually devoid of E-selectin and P-selectin ligand activity and an almost abrogated lymphocyte homing in peripheral lymph nodes (52). These observations indicated that both FucT-IV and -VII contribute to regulate leukocyte recruitment and lymphocyte homing in mouse (52). More recently, observations made with leukocytes obtained from FucT-VII-deficient patients suggested that human FucT-IV may play a role in generating P- and E-selectin ligands (49, 54). Thus, despite a near complete absence of sLex synthesis, neutrophils from these patients display normal rolling on P-selectin and E-selectin (49). However, a compensatory increase in FucT-IV activity was observed in human neutrophils deficient in FucT-VII that may have rescued their rolling capacity on P-selectin and E-selectin (49).

Because differences in carbohydrate synthesis produced by human and mouse glycosyltransferases have been observed (39, 55–57), we compared human FucT-IV and -VII in generating selectin ligand activity on human PSGL-1, and in particular we examined the role of FucT-IV in regulating L-selectin interactions with its major ligand PSGL-1 (25). In addition, as the complimentary acceptor site specificities of FucT-IV and -VII suggest that they may cooperate in generating selectin ligands, we examined whether human FucT-IV and -VII collaborate in regulating PSGL-1 interactions with L-, P-, or E-selectin. These points had not been examined in studies previously devoted to the relative role of FucT-IV or -VII in generating E-selectin or P-selectin counter-receptor activities (18, 26, 43, 46, 47, 49, 58–61). Of note, previous observations showed that CHOdhfr– cells and CHOPro-5 cells (41, 42, 46, 62) and leukocytic cell lines (43) may differ in their capacity to synthesize selectin ligands. This property may limit the physiological relevance of assays performed with cell lines. By taking into account this limitation, we chose to study the specific involvement of human FucT-IV and the cooperation of human FucT-IV and -VII in conferring selectin binding activity to PSGL-1 in CHOdhfr– cells, because these cells, when co-transfected with C2GnT, FucT-IV, or -VII and PSGL-1 cDNAs, have the ability to generate ligands for the three selectins (26, 46, 58, 63). In addition, results presented here with CHOdhfr– cells expressing FucT-IV are close to those reported with human FucT-VII-deficient neutrophils (49). Our observations show that the expression of human FucT-IV or/and -VII in CHOdhfr– cells generate selectin binding activity on PSGL-1 and that FucT-IV and -VII unequally contribute but cooperate in supporting L-, P-, and E-selectin-mediated rolling on PSGL-1. Additional experiments have been performed to examine the role of core-2 O-glycans attached to Thr-57 in regulating E-selectin-dependent rolling on PSGL-1. Results indicate that Thr-57-core-2 O-linked glycans are not the sole E-selectin-binding sites; additional binding sites support >75% of E-selectin-dependent rolling present on PSGL-1.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Antibodies and Chimeric Selectins—mAbs LAM 1-3, LAM 1-14 (anti-L-selectin) (64), WAPS 12.2 (anti-P-selectin, ATCC HB-299), H18/7 (anti-E-selectin, ATCC HB-11684), HECA-452 (anti-CLA; ATCC HB-11485), and CSLEX-1 (ATCC HB-10135) were purified from hybridoma culture medium. FITC-labeled mAb 80H6 (anti-CD15) and PL2 (anti-PSGL-1) were purchased from Immunotech (Marseille, France), and blocking anti-PSGL-1 mAb KPL1 was from Pharmingen. The hybridoma-secreting PS5 mAb was generated in our laboratory by the fusion of PX63Ag8 myeloma cells with Balb/c splenocytes that were immunized with KG1 cells. Flow cytometry analysis, immunoadsorption, and Western blot analysis performed with transfectants and cell lines expressing PSGL-1 demonstrated that PS5 mAb specifically recognizes PSGL-1. Phycoerythrin-conjugated goat anti-mouse Ig antibody and fluorescein isothiocyanate (FITC)-conjugated rabbit anti-rat IgM antibody were from Dako (Glostrup, Denmark). L-, P-, and E-selectin/IgM heavy chain chimera (L-, P-, and E-selectin/µ) were produced by stably transfected CHOdhfr– cells and used for immunostaining, as described previously (14, 63).

cDNAs—PSGL-1 and FucT-IV cDNAs were gifts from the Genetics Institute (Boston, MA) (10); human FucT-VII cDNA was from J-.B. Lowe (Howard Hughes Institutes, Ann Harbor, MI), and core-2 {beta}1,6-N-acetylglucosaminyltransferase transferase (C2GnT) was from M. Fukuda (the Burnham Institute, La Jolla Cancer Research Center, San Diego). The cDNA sequence encoding the internal ribosome entry site (IRES) of the encephalomyocarditis virus sequence was a gift from P. Aebischer (Swiss Federal Institute of Technology, Ecublens, Switzerland) (26). The pZeoSV and the pcDNA3.1 vectors were from Invitrogen. The sequence encoding the IRES was inserted in the multiple cloning site of the pZeoSV vector (pIRES ZeoSV vector). C2GnT and FucT-VII cDNAs were then subcloned in the pIRES ZeoSV vector to permit the translation of C2GnT and FucT-VII or FucT-IV cDNA sequences from one messenger RNA, as described (26). This vector allows the expression of the target gene (C2GnT) and of the selection marker (sLex versus Lex expression associated to FucT-VII versus FucT-IV activity) from the same promoter so that virtually all transfected cells expressing the selection marker also express the gene of interest (65–67). FucT-IV cDNA sequence was also inserted into the pcDNA3.1-hygromycin vector (Invitrogen) and used to transfect CHOdhfr– cells co-expressing C2GnT and both FucT-IV and -VII cDNAs.

PSGL-1T57A cDNA was obtained by substituting Thr-57 by Ala using the QuikChange site-directed mutagenesis kit (Stratagene, Amsterdam, The Netherlands) (26). PSGL-1/µ and PSGL-1T57A/µ chimeras were generated by amplifying sequences encoding the whole extracellular part of PSGL-1 (from Met-1 to Lys-308) using wild-type PSGL-1 and PSGL-1T57A, respectively, cDNAs as templates (26); TCGCGATATCAAGCTTCTCGAGCCACCATGCCTCTGCAACTCCTC was used as the forward primer, and TATAGATATCAAGCTTACCTGAGATGTGGTCTGGGGC, containing an artificial splice donor site, was used as the reverse primer. PCRs were performed using Pfu polymerase (Stratagene) by conducting 30 cycles (1 min at 94 °C, 1 min at 65 °C, and 1 min 30 s at 72 °C) as described previously (14). PCR products were subcloned in pcDNA3.1/IgM heavy chain (µ) expression vector containing the CH2, CH3, and CH4 domains of IgM heavy chain in genomic configuration (14). Sequences of all constructs were verified by dideoxynucleotide sequencing.

Cells and Transfections—Neutrophils were isolated from normal heparinized blood samples by Ficoll-Paque centrifugation, dextran sedimentation, and erythrocyte hypotonic lysis (14). CHOdhfr– cells (ATCC number CRL 9096) were stably transfected with pCDNA3.1 vector expressing the cDNA sequences of wild-type PSGL-1, PSGL-1/µ chimera, or PSGL-1T57A/µ mutant. When indicated, CHOdhfr– cells were co-transfected with the following: 1) FucT-VII cDNA sequence subcloned in pZeoSV vector (Invitrogen); 2) FucT-IV cDNA sequence subcloned in pCDNA3.1 vector (Invitrogen); or 3) the pIRES ZeoSV expression vector that allows the simultaneous translation of C2GnT and FucT-VII or FucT-IV sequences (26). Transfections were performed using Gene Porter (Core BioServices) or Trans-IT LT1 (Mirus Corp., Madison, WI). CHOdhfr– were cultured in minimum Eagle's {alpha}-medium containing ribonucleosides, deoxyribonucleosides, 10% fetal calf serum (FCS), and 1% penicillin/streptomycin. Transfectants were selected in medium containing 400 µg/ml G418 (Invitrogen) and, when required, 200 µg/ml Zeocin (Invitrogen) and 650 µg/ml hygromycin (Calbiochem-Novabiochem). Individual clones co-expressing high levels of PSGL-1 and FucT-IV or -VII-dependent expression of Lex, sLex, or CLA were isolated by limiting dilution and identified by immunophenotypic analysis using PL2, CSLEX-1, HECA-452, and 80H6 mAbs. CHOdhfr– cells that were selected for adhesion studies expressed similar levels of PSGL-1, sLex, CLA, and/or Lex. The expression levels of the various PSGL-1 glycoforms of Lex and sLex determinants were measured (68) on CHO cell transfectants, mentioned in Figs. 1, 2, 3, 4, 5, with the DAKO QIFIKIT® (Dako, Glostrup, Denmark). The anti-PSGL-1 mAb PS5 was used to assess PSGL-1 expression, the 80H6 mAb to measure Lex expression, and CSLEX-1 mAb to assess sLex expression. 443 ± 34 (mean ± S.D., n = 3) PS5 binding sites/µm2 were detected on CHO-C2F4PSGL-1 cells, 345 ± 14 on CHO-C2F7PSGL-1 cells, and 335 ± 8 on CHO-C2F4F7PSGL-1 cells. 93 ± 16 (mean ± S.D., n = 3) 80H6 binding sites/µm2 were detected on CHO-C2F4PSGL-1 cells, 103 ± 3on CHO-C2F4F7PSGL-1 cells, and 97 ± 9 on CHO-C2F4F7 cells. 150 ± 10 (mean ± S.D., n = 3) CSLEX-1 binding sites/µm2 were detected on CHO-C2F7PSGL-1 cells, 130 ± 5 on CHO-C2F4F7PSGL-1 cells, and 142 ± 10 on CHO-C2F4F7 cells.



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 1.
Flow cytometry analysis of CHO transfectants. CHODHFR– cells were stably transfected with various combinations of C2GnT (C2), FucT-VII (F7), FucT-IV (F4), and PSGL-1 (PS) cDNAs. CHO cells were stained with isotype-matched control mAbs (open histogram) or with the anti-Lex mAb 80H6, the anti-sLex mAb CSLEX-1, the anti-CLA mAb HECA-452, or the anti-PSGL-1 mAb KPL1 (filled histogram). The proportion of positive cells is indicated in each histogram. The mean fluorescence intensity is indicated by italic numbers. CSLEX-1, HECA-452, and KPL1 mAbs did not significantly bind to mock-transfected CHO cells and to CHO-C2GnT cells expressing C2GnT (not illustrated).

 



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 2.
Role of FucT-IV, -VII, and PSGL-1 in supporting L-, P-, and E-selectin/µ chimera binding to CHO transfectants. Binding of L-, P-, and E-selectin/µ chimera was completely inhibited by the presence of 5 mM EDTA (open histogram). The proportion of positive cells is indicated in each histogram. The mean fluorescence intensity is indicated by italic numbers. L-, P-, and E-selectin/µ chimera did not significantly bind (<2%) to mock-transfected CHO cells (not illustrated).

 



View larger version (43K):
[in this window]
[in a new window]
  		FIG. 3.
FucT-IV and -VII regulate L-selectin- and P-selectin-dependent rolling on PSGL-1. a, K-562-P cells, 300.19-L cells, or neutrophils were perfused under a constant shear stress of 1.5 dynes/cm2 on CHO cells stably expressing the indicated combinations of C2GnT, FucT-IV, FucT-VII, and PSGL-1 cDNAs. Cell recruitment was assessed by videomicroscopy at 2–5 min of perfusion. Results represent the mean ± S.E. of 3–4 experiments (*, p < 0.05; ***, p < 0.001; ****, p < 0.0001). b, CHO transfectants were perfused under 1.5 dynes/cm2 on recombinant human P-selectin (0.25 µg in 50 µl of 0.1 M borate buffer, pH 8.5; R & D Systems) or L-selectin/µ chimera (1.0 µg in 50 µl of borate buffer) adsorbed on a coverslip, coated with goat anti-human IgM, and bound to the bottom of the flow chamber. Cell recruitment was assessed as described in a. Results represent the mean ± S.E. of 3 experiments (*, p < 0.05; ***, p < 0.001). c, rolling velocity of 300.19-L cells and of K-562-P cells on CHO transfectants. Cell rolling was analyzed after 2–5 min of perfusion. Curves were constructed using 288–894 independent determinations of rolling velocities and are representative of four experiments.

 



View larger version (42K):
[in this window]
[in a new window]
  		FIG. 4.
FucT-VII expression stabilizes L-selectin-dependent rolling on PSGL-1. a, frame-by-frame rolling velocity of 300.19-L cells on CHO cells stably expressing the indicated combinations of C2GnT, FucT-IV, FucT-VII, and PSGL-1 cDNAs. The velocity of tracked cells was determined by measuring cell displacements within successive video frames (0.032 s) in the flow direction, under a shear stress of 1.5 dynes/cm2. Cells were tracked for 2.7 s. Data are representative of 3–6 experiments. b, distribution of distances traveled by 300.19-L cells on CHO transfectants during successive 0.032-s observation periods. Data are representative of 100–128 determinations.

 



View larger version (46K):
[in this window]
[in a new window]
  		FIG. 5.
CHO cells expressing human FucT-IV and/or -VII support E-selectin-dependent rolling. a, K-562-E cells (0.5 x 106/ml) or (c) neutrophils (0.5 x 106/ml), suspended in RPMI 1640, 1% FCS, were perfused on CHO transfectants expressing the indicated PSGL-1 glycoforms. b, recruitment of CHO-PSGL-1 transfectants on recombinant E-selectin (0.25 µg in 50 µl of borate buffer; R&D Systems, Minneapolis, MN) adsorbed on the bottom of the flow chamber. Experiments were performed under a constant shear stress of 1.5 dynes/cm2. Cell recruitment was assessed at 2–5 min of perfusion. Results represent the mean ± S.E. of three experiments (*, p < 0.05; ***, p < 0.001; ****, p < 0.0001). d, velocity of K-562-E cells on CHO transfectants. Cell rolling was analyzed after 2–5 min of perfusion. Curves were constructed using 194–331 independent determinations of rolling velocity and are representative of three experiments.

 
The levels of C2GnT mRNAs were compared in stable transfectants by semi-quantitative reverse transcription-PCR. Total RNA was extracted from each CHO transfectant (5 x 106 cells) using Trizol LS Reagent (Invitrogen). After treatment with DNase I, 100 ng of RNA was amplified for 30 min at 50 °C (30 cycles) using the Superscript One-Step RT-PCR with Platinum® Taq System (Invitrogen). C2GnT cDNA was detected with the sense primer GGCAGTGCCTACTTCGTGGTC and the antisense primer ATGCTCATCCAAACACTGGATGGCAAA. The number of PCR cycles was titered below the plateau phase of amplification to reflect the relative starting concentrations of analyzed mRNAs. Cycles were performed in a Primus 96 Plus Thermal Cycler (MWG Biotec, Germany) at 94 °C for 30 s, 56 °C for 45 s, and 72 °C for 50 s. The final extension was performed at 72 °C for 10 min. {beta}-Actin was detected using the sense primer GAGACCTTCAACACCCC and the antisense primer GTGGTGGTGAAGCTGTAGCC. PCR products were separated by agarose gel electrophoresis containing ethidium bromide. Similar levels of {beta}-actin and of C2GnT mRNAs were observed in CHO-C2F4F7, CHO-C2F4PSGL-1, CHO-C2F7PSGL-1, and CHO-C2F4F7PSGL-1 cells (not illustrated).

P-selectin, E-selectin, and L-selectin cDNA sequences were subcloned in pcDNA3.1 vector (Invitrogen) and used to transfect K-562 cells, CHOdhfr– cells, or pre-B murine 300.19 cells by lipofection. K-562-P-selectin cells (K-562-P cells), CHO-P-selectin cells (CHO-P cells), K-562-E-selectin cells (K-562-E cells), and 300.19-L-selectin cells (300.19-L cells) were selected in medium containing 0.4 mg/ml G418 (geneticin, Invitrogen) and isolated by limiting dilution. K-562-P, K-562-E, and 300.19-L transfectants expressing high levels of selectins were cultured in RPMI 1640 medium containing 10% FCS, 1% penicillin/streptomycin, and 400 µg/ml G418. 300.19-L cells used to perform the experiments described here expressed L-selectin levels similar to those of human neutrophils; K-562-E cells expressed E-selectin levels that were similar to those of human umbilical vein endothelial cells exposed for 6 h to 50 units/ml tumor necrosis factor-{alpha} (not illustrated).

Immunophenotypic Analysis—Expression of PSGL-1, sLex, CLA, Lex on transfected CHOdhfr– cells, and of L-, P-, or E-selectin on 300.19, K-562, or CHOdhfr– cells was detected by flow cytometry using saturating concentrations of appropriate FITC- or PE-conjugated mAbs or unlabeled mAbs (26). When required, PE-conjugated goat anti-mouse Ig (Dako), FITC-labeled goat anti-mouse IgM (Jackson ImmunoResearch Laboratories, West Grove, PA), or rabbit anti-rat IgM were used as secondary antibodies (Rockland Immunochemicals, Gilberts, PA). Cells were incubated on ice for 30 min with appropriate antibodies, washed, fixed in 1% paraformaldehyde, and analyzed on an Epics XL-MCL cytofluorimeter (Beckman Instruments, Nyon, Switzerland). A total of 5000 cells was analyzed in each experiment.

L-, P-, E-selectin/µ binding to CHOdhfr– transfectants was assessed by incubating CHO cells, for 30 min on ice, with chimeric proteins used at optimal concentrations for immunostaining, in RPMI 1640 supplemented with 1% FCS. Cell surface binding of chimera was revealed using a polyclonal PE-conjugated goat anti-human IgM heavy chain antibody (10 µg/ml; Dako) (14, 26). The specificity of L-, P-, or E-selectin/µ chimera binding to PSGL-1 was indicated by the abrogation of binding in the presence of 5 mM EDTA or 100 µg/ml of appropriate anti-L-, -P-, or -E-selectin blocking mAb (LAM1–3, WAPS 12.2, and H18/7). 5000 cells were analyzed in each experiment on an Epics XL-MCL cytofluorimeter (Beckman Instruments).

Chimera—The concentration of L-, P-, E-selectin, and PSGL-1/µ chimera was measured by ELISA, using a goat anti-human IgM antibody (Caltag, Burlingame, CA) to capture the chimeric molecules, biotinylated goat anti-human IgM (Caltag), streptavidin-horseradish peroxidase (Sigma), 0.67 mg/ml o-phenylenediamine dihydrochloride (Sigma) and 0.16 {per thousand} H2O2 to reveal the captured chimera, as described (14). Purified human IgM was used as standard (Caltag, Burlingame, CA). Samples were diluted to obtain a measure in the linear range of our assay. Absorbance at 490 nm was measured using a Dynatech MR-500 ELISA reader (Dynatech, Microtec Produkte, Embrach-Embraport, Switzerland).

The ability of the various fucosylated forms of PSGL-1/µ chimera to inhibit P-selectin/µ binding to sLex/BSA (Calbiochem-Novabiochem) was studied by ELISA. 96-Well ELISA microtiter plates (96-well ELISA plate, Costar, Corning, NY) were coated overnight at 4 °C with sLex coupled to bovine serum albumin (sLex/BSA, 0.15 µg/well in sodium carbonate/bicarbonate buffer, pH 9.4) and blocked with PBS containing BSA (10 mg/ml). P-selectin/µ chimera (2 µg/ml), precomplexed with biotinylated goat anti-human IgM (0.5 µg/ml), horseradish peroxidase-conjugated streptavidin (0.3 µg/ml), and serial diluted concentrations of PSGL-1/µ chimera were co-incubated in sLex/BSA-coated ELISA microtiter wells, for 4 h, at room temperature. After extensive washing with PBS/Tween 20 (0.05%), P-selectin binding to sLex/BSA was revealed by the addition of 0.67 mg/ml o-phenylenediamine dihydrochloride (Sigma) and 0.16{per thousand} H2O2. The chromogenic reaction was stopped by the addition of 50 µlof3 M H2SO4/well. Absorbance was read at 490 nm. IC50 values of PSGL-1/µ glycoforms on P-selectin/µ chimera binding to sLex/BSA were calculated using the GraphPad Prism 3.0 software (GraphPad Software Inc., San Diego).

The involvement of core-2 O-glycans linked to Thr-57 in the presentation of Lex, sLex, and CLA was examined by comparing the expression levels of Lex, sLex, and CLA on PSGL-1/µ, C2F7PSGL-1/µ, and C2F7PSGL-1T57A/µ chimera adsorbed on 10.0-µm polystyrene microspheres (2.5 x 107 microspheres/ml, Polysciences Inc., Warrington, PA) coated with goat anti-human IgM (Caltag). Microspheres (15 µl/sample) were washed twice with 0.1 M borate buffer, pH 8.5, and incubated overnight with 100 µl of goat anti-human IgM (100 µg/ml, Caltag) with end-to-end rotation. Microspheres were then washed, blocked for 1 h at 20 °C with 0.1 M borate buffer, pH 8.5, containing 2% BSA, and incubated for 1 h at 4 °C with 50 µl of PSGL-1/µ chimera (50 µg/ml). The expression of Lex, sLex, and CLA on PSGL-1 chimera was detected with the anti-sLex mAb CSLEX-1 or the anti-CLA mAb HECA-452 and PE-labeled secondary antibodies (Dako). Microspheres were then washed and fixed with 1% paraformaldehyde in PBS. PE fluorescence was assessed on a Cytomics FC 500 cytofluorimeter (Beckman Instruments) by analyzing the fluorescence of 10,000 microspheres.

Cell Adhesion Assays—Adhesion assays were performed as described previously (26, 63). A laminar flow was generated in a parallel plate flow chamber (GlycoTech Corp., Rockville, MD) mounted on a glass coverslip covered with a confluent monolayer of transfected CHOdhfr– cells or coated with L-selectin/µ chimera (1.0 µg diluted in 50 µl of 0.1 M borate buffer, pH 8.5), or recombinant E-selectin or P-selectin (0.25 µg in 50 µl of borate buffer, R&D Systems, Minneapolis, MN), or wild-type PSGL-1/µ versus PSGL-1T57A/µ chimera (0.75 µg in 50 µl of borate buffer) adsorbed for 1 h at 37 °Con coverslips coated with rabbit anti-human IgM antibody (Dako, 1 µgin50 µl of 0.1 M carbonate buffer, pH 9.4, with a 75-mm2 surface). Neutrophils, 300.19-L cells, or K-562-P cells (0.5 x 106/ml in RPMI 1640, 1% FCS) were perfused through the chamber using a syringe pump (Harvard Apparatus, Indulab AG, Gams, Switzerland) for 6 min, at room temperature, under a constant shear stress. Leukocyte interactions with CHOdhfr– cells were recorded during the entire period of cell perfusion with a phase contrast microscope (Leica Leitz DM IL, Renens, Switzerland), a high resolution Sony CCD-IRIS video camera (Japan), and an S-VHS recorder (Panasonic MD 830, Telecom, Lausanne, Switzerland). Leukocyte interactions with transfected CHOdhfr– cells or chimeric molecules were analyzed by manually tracking the motion of individual cells for 2–3 min. Leukocyte rolling interactions with CHOdhfr–cells were considered for the analysis when the interaction time was >2.0 s and when the distance traveled by leukocytes during observation periods (20 s) was >1 cell diameter. Rolling velocities were determined with a digital image analysis system (Mikado software, GPIL SA, Martigny, Switzerland) and a Power-Macintosh 8600/200 workstation equipped with a Scion LG-3 board (Scion, Frederick, MD) (63). Cell interactions were analyzed from videotapes at 2–5 min of perfusion. Experiments were performed in triplicate under constant shear stress. Cell recruitment was determined in 32–64 microscopic fields (0.08 mm2) for each tested condition. Rolling velocities illustrated in Figs. 3c, 5d, 6b, and 8b were measured in the direction of flow by tracking individual cells every 0.25 s, for 1–20 s, using digitized images of 0.7-mm2 microscopic fields. 194–894 independent determinations of cell rolling velocity were measured for each tested condition. Frame-by-frame velocity data obtained by tracking cells every 0.032 s, within 0.7-mm2 microscopic fields, are illustrated in Fig. 4a and were used to assess the mean velocity ± S.D. of each tracked cell over 2.7-s observation periods. The mean velocity of frame-by-frame tracked cells was included between percentile 40 and 60 of the velocity of each cell population illustrated in Fig. 3c. The S.D. value of the mean velocity of each tracked cell was then used to calculate the mean S.D. of cell rolling velocities of each cell population. The mean S.D. was used as an indicator of the variation of cell rolling velocity. 93–131 independent determinations of frame-by-frame velocity were measured for each tested condition. The specificity of L-, P-, and E-selectin-dependent cell interactions was indicated by the complete inhibition (>95%) of cell rolling by LAM 1-3, WAPS 12.2, and H18/7 mAbs. Isotype-matched mAbs were used as controls. Cell recruitment was not supported by mock-transfected CHOdhfr– cells. Adhesion assays performed at various shear stress (0.5–4.0 dynes/cm2) indicated that 300.19-L and K-562-P cell recruitment on PSGL-1 was optimal at 1.5–2.0 dynes/cm2 (data not shown). Experiments analyzing neutrophil rolling on CHOdhfr– cells expressing PSGL-1 were performed in the presence of the adhesion-blocking anti-CD18 mAb TS1/18 (Endogen, Woburn, MA) to prevent CD18-dependent neutrophil arrest on CHOdhfr– cells. 300.19-L, CHO-P, K-562-P, and K-562-E cells did not arrest on CHO transfectants.



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 6.
Regulation of E-selectin-dependent rolling on PSGL-1 by FucT-IV and -VII. a, K-562-E cells were perfused under a constant shear stress of 1.5 dynes/cm2 on PSGL-1/µ chimera glycosylated by C2GnT, FucT-IV, and/or FucT-VII. Cell recruitment was assessed at 2–4 min of perfusion. Results represent the mean ± S.E. of four experiments (***, p < 0.001). b, E-selectin-dependent rolling velocity on indicated PSGL-1/µ glycoforms. Cell rolling was analyzed after 2–5 min of perfusion. Curves were constructed using 200–257 independent determinations of rolling velocity and are representative of four experiments.

 



View larger version (35K):
[in this window]
[in a new window]
  		FIG. 8.
Role of core-2 O-glycans attached to Thr-57 in regulating L-, P-, and E-selectin-dependent rolling on PSGL-1. a, 300.19-L, CHO-P, and K-562-E cells were perfused under a constant shear stress of 2.0 dynes/cm2 on PSGL-1/µ and PSGL-1T57A/µ chimera glycosylated by C2GnT and FucT-VII. Thr-57 was substituted by Ala in PSGL-1T57A/µ chimera. The non-fucosylated PSGL-1/µ chimera was used as control. Cell recruitment was assessed at 2–5 min of perfusion. Results represents the mean ± S.E. of four experiments. b, rolling velocities of CHO-P and K-562-E cells on C2F7PSGL-1/µ and mutant C2F7PSGL-1T57A/µ chimera. Rolling velocities were measured after 2–5 min of perfusion. Curves were constructed using 300 independent determinations of rolling velocity and are representative of three experiments.

 
CHO transfectants used to perform rolling assays (Fig. 1) and human neutrophils expressed similar levels of cell surface PSGL-1 (mean fluorescence intensity ± S.D.: CHO-PSGL-1 transfectants, 81 ± 12 versus neutrophils, 72 ± 8, n = 5). However, they expressed lower sLex levels and Lex levels (Fig. 1) than neutrophils (sLex expression on neutrophils, 166 ± 52 versus 47 ± 6; Lex expression, 79 ± 25 versus 18 ± 3, n = 5).

CHO-C2F4PSGL-1, CHO-C2F7PSGL-1, and CHO-C2F4F7PSGL-1 used to perform adhesion studies slightly differed in Lex, sLex, and PSGL-1 expression levels (Fig. 1). The impact of the expression levels of sLex on the ability of CHO-C2F7PSGL-1 to roll on P-, L-, or E-selectin was examined by performing rolling adhesion assays on recombinant P-selectin (0.25 µg in 50 µl of 0.1 M borate buffer, pH 8.5, adsorbed on a surface of 75 mm2), L-selectin/µ chimera (1.0 µg), or E-selectin (0.25 µg) using CHO-C2F7PSGL-1 clones expressing various levels of cell surface PSGL-1 and sLex (sLex versus PSGL-1 expression (mean fluorescence intensity), clone 1, 7.3 versus 54.2; clone 2, 17.1 versus103.2; clone 3, 6.5 versus 40.1; clone 4, 6.1 versus 38.2; and clone 5, 16.6 versus 39.4). Despite significant differences in sLex expression, cell recruitment on recombinant P-selectin was not correlated to sLex expression levels and did not significantly differ among CHO clones (cell recruitment/min/mm2 (mean ± S.D.): clone 1, 184 ± 6; clone 2, 172 ± 9; clone 3, 145 ± 24; clone 4, 196 ± 19; and clone 5, 152 ± 17). Similar observations were made on L-selectin/µ chimera (clone 1, 406 ± 76; clone 2, 438 ± 21; clone 3, 357 ± 26; and clone 4, 415 ± 18) or on E-selectin (clone 1, 164 ± 32; clone 2, 178 ± 9; clone 3, 148 ± 28; and clone 4, 156 ± 35). These results suggest that the heterogeneity in sLex expression observed on CHO transfectants used in the present study (Fig. 1) should not affect PSGL-1-dependent rolling on L-, P-, or E-selectin.

Statistical Analysis—Analysis of variance and the Bonferroni multiple comparison test or the Kruskal-Wallis non-parametric analysis of variance test was used to assess statistical significance of differences between groups. The non-parametric Mann-Whitney test was used to compare the medians of two unpaired groups. p values < 0.05 were considered as significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
FucT-IV and -VII Generate Lex, sLex, and CLA Carbohydrate Determinants That Mediate L-, P-, and E-selectin Binding to PSGL-1—The ability of Lex and sLex to support L-, P-, and E-selectin-mediated interactions was examined by analyzing L-, P-, and E-selectin/µ chimera binding and leukocyte rolling on CHOdhfr– cells co-transfected with or without PSGL-1, FucT-IV, and/or FucT-VII cDNAs. When indicated, C2GnT was co-expressed with FucT-VII or FucT-IV cDNAs subcloned in the pIRES ZeoSV vector allowing the simultaneous translation of C2GnT and FucT-VII or FucT-IV sequences from one messenger RNA (26). Eight different transfectants expressing the following were obtained: 1) FucT-IV alone (CHO-F4 cells); 2) FucT-VII alone (CHO-F7 cells); 3) C2GnT and FucT-IV (CHO-C2F4 cells); 4) C2GnT and FucT-VII (CHO-C2F7 cells); 5) C2GnT, FucT-IV and FucT-VII (CHO-C2F4F7 cells); 6) C2GnT, FucT-IV and PSGL-1 (CHO-C2F4PSGL-1 cells); 7) C2GnT, FucT-VII, and PSGL-1 (CHO-C2F7PSGL-1 cells); and 8) C2GnT, FucT-IV, FucT-VII, and PSGL-1 (CHO-C2F4F7PSGL-1 cells). CHOdhfr– cells stably expressed similar levels of PSGL-1, Lex, and/or sLex/CLA as ascertained by immunostaining of CHO cell monolayers with mAbs PL2 (anti-PSGL-1), 80H6 (Lex), CSLEX-1 (anti-sLex), or HECA-452 (anti-CLA) (Fig. 1) and measurement of antigen site density with the DAKO QIFIKIT as described under "Experimental Procedures." CHOdhfr– cells expressing FucT-IV strongly produced Lex but generated only low levels of sLex and CLA (CHO-F4, CHO-C2F4, and CHOC2F4PSGL-1; see Fig. 1). CHOdhfr– cells expressing FucT-VII cDNA exhibited high levels of sLex and CLA but did not express Lex (CHO-F7, Fig. 1, central left panel). The co-expression of PSGL-1 with C2GnT and FucT-IV and/or FucT-VII (Fig. 1) did not increase the level of Lex and/or sLex and/or CLA expression, indicating that only a minor fraction of these oligosaccharides is carried by PSGL-1. As expected, mock-transfected CHO cells and CHO-C2 cells transfected with pZeoSV vector containing C2GnT cDNA sequence did not react with 80H6, CSLEX-1, HECA-452, or KPL1 mAbs (not illustrated).

CHOdhfr– cells expressing similar levels of Lex and/or sLex/CLA and/or PSGL-1 were examined for their ability to bind L-, P-, or E-selectin/µ chimera (Fig. 2). L-selectin/µ and P-selectin/µ chimera weakly interacted with CHO-C2F7 (mean fluorescence intensity, 1.4 ± 0.1 versus and 2.5 ± 0.3, n = 3, not illustrated) or CHO-C2F4 (1.4 ± 0.3 and 2.7 ± 0.2, n = 3, not illustrated) or CHO-C2F4F7 cells (1.6 ± 0.2 and 2.0 ± 0.2, n = 3, Fig. 2). L- and P-selectin/µ bound much more efficiently to CHOdhfr– cells co-expressing PSGL-1 with Lex and sLex (CHO-C2F4F7PSGL-1) or sLex alone (CHO-C2F7PSGL-1) than to CHOdhfr– cells co-expressing PSGL-1 and Lex alone (CHO-C2F4PSGL-1). Thus, higher levels of L-selectin/µ and P-selectin/µ chimera bound to CHO-C2F4F7PSGL-1 cells (L-selectin/µ binding (mean fluorescence intensity), 16 ± 1, and P-selectin/µ binding, 63 ± 3, n = 4) and CHO-C2F7PSGL-1 cells (15 ± 1 and 62 ± 3, n = 4, Fig. 2) than CHO-C2F4PSGL-1 cells (4 ± 1 and 16 ± 2, n = 4, Fig. 2, p < 0.001 for both parameters). E-selectin/µ chimera exhibited a higher reactivity with CHO-C2F7PSGL-1 cells (59 ± 2, n = 4, p < 0.001) or CHO-C2F4F7PSGL-1 (58 ± 2, n = 4, p < 0.01) than with CHO-C2F4PSGL-1 cells (26 ± 1, n = 4).

FucT-IV and -VII Regulate L-selectin- and P-selectin-dependent Rolling on PSGL-1—The role of PSGL-1 fucosylation in regulating L-selectin interactions with PSGL-1 was studied by analyzing neutrophils and 300.19-L-selectin cell rolling on CHO cell monolayers expressing PSGL-1. This assay mimicked L-selectin-dependent leukocyte rolling on PSGL-1-expressing adherent leukocytes. Adhesion assays comparing side by side L-selectin- and P-selectin-dependent rolling assays on human PSGL-1 glycoforms were performed under the same conditions using flowing K-562-P cells, 300.19-L cells, or human neutrophils that roll on CHO-PSGL-1 cell monolayers. Cell recruitment on PSGL-1 glycoforms was compared by expressing results as mean (± S.E.) percentage of the cell recruitment observed on CHO-C2F4F7PSGL-1 cells (Fig. 3a). Cell recruitment was maximal on CHO-C2F4F7PSGL-1 cells (mean number of rolling cells/min/mm2± S.E.: (a) neutrophils, 574 ± 28 (100 ± 4%), n = 3; (b) 300.19-L cells, 850 ± 11 (100 ± 1%), n = 3; (c) K-562-P cells, 360 ± 11 (100 ± 3%), n = 4). Neutrophil, 300.19-L, and K-562-P cell recruitment was significantly higher on CHO-C2F4F7PSGL-1 than on CHO-C2F7PSGL-1 cells (mean percentage of rolling cells on CHO-C2F7PSGL-1: (a) neutrophils (mean ± S.E.), 87.8 ± 6.1%, number of experiments (n) = 3, p < 0.05; (b) 300.19-L cells, 73.5 ± 3.4%, n = 4, p < 0.001; (c) K-562-P cells, 71.0 ± 3.1%, n = 5, p < 0.001; Fig. 3a) or on CHO-C2F4PSGL-1 cells (mean percentage of rolling cells: (a) neutrophils (± S.E.), 51.9 ± 3.8%, n = 3, p < 0,001; (b) 300.19-L cells, 44.9 ± 1.8%, n = 4, p < 0.001; (c) K-562-P cells: 40.0 ± 2.1%, n = 4, number of examined microscopic fields in all studied conditions: 128, p < 0.001; Fig. 3a). Only a few cells rolled in the absence of PSGL-1 on CHO-C2F4F7 cells underlining the critical role played by this molecule in regulating cell interactions with L-selectin and P-selectin (mean percentage of rolling cells ± S.E.: (a) neutrophils, 2.3 ± 0.5%, n = 4, p < 0.0001; (b) 300.19-L cells: 7.4 ± 0.6%, n = 3, p < 0.001; (c) K-562-P cells/min/mm2, 4.3 ± 0.6%, p < 0.001, n = 4; Fig. 3a).

As P-selectin is most often expressed by adherent cells, we performed additional assays to examine whether our observations were reproducible in the reverse setting. Similar results were obtained (Fig. 3b). The recruitment of CHO-C2F4F7PSGL-1 cells on L-selectin (mean number of rolling CHO-C2F4F7PSGL-1 cells/min/mm2± S.E.: 320 ± 37; 100 ± 5%, n = 3) or on P-selectin (480 ± 11; 100 ± 2%) was higher than that of CHO-C2F7PSGL-1 cells (89 ± 2%, n = 3, p < 0.05 versus 91 ± 2%, n = 3, p < 0.05) or that of CHO-C2F4PSGL-1 cells (71 ± 5%, n = 3, p < 0.001 versus 71 ± 2%, n = 3, p < 0.001) on L- and P-selectin.

Because immunophenotypic analysis (Fig. 1) disclosed a weak expression of sLex on CHO-C2F4PSGL-1 cells, we examined the role of this determinant in regulating L-selectin- and P-selectin-dependent rolling on these cells by treating CHO-C2F4PSGL-1 cells with 0.1 unit/ml Vibrio cholerae neuraminidase (Roche Applied Science). The exposure of CHO-C2F4PSGL-1 cells to neuraminidase for 20 min at 37 °C induced the complete loss sLex expression by CHO-C2F4PSGL-1 cells but did not change the ability of CHO-C2F4PSGL-1 cells to roll on human L-selectin (mean number ± S.E. of rolling cell on L-selectin/µ: 367 ± 27 versus 367 ± 12 cells/min/mm2, n = 3) or human P-selectin (163 ± 8 versus 161 ± 16 cells/min/mm2, n = 3). In contrast, the exposure of CHO-C2F7PSGL-1 cells to V. cholerae neuraminidase inhibited 300.19 L-selectin cell rolling by 80 ± 5% (mean ± S.E., n = 3, p < 0.001) and P-selectin-dependent rolling by 72 ± 7% (n = 3, p < 0.001). These observations indicate that, in our adhesion assay, the sLex determinant is not required to support CHO-C2F4PSGL-1 cell rolling on L- or P-selectin, although it plays a critical role in mediating CHO-C2F7PSGL-1 cell rolling on these selectins.

Rolling velocities of 300.19-L and K-562-P cells on CHO-C2F4F7, CHO-C2F4PSGL-1, CHO-C2F7PSGL-1, and CHO-C2F4F7PSGL-1 cells were measured under a constant shear stress of 1.5 dynes/cm2. L- and P-selectin-dependent rolling velocities were slower on CHO-C2F4F7PSGL-1 cells (median rolling velocity of 300.19-L cells: 81 µm/s, range 19.8–252 µm/s, P25 = 54 µm/s, P75 = 83.2 µm/s, n = 4; median rolling velocity of K-562-P cells: 12.3 µm/s, range 0.3–109 µm/s, P25 = 7.4 µm/s, P75 = 19 µm/s, n = 4; Fig. 3b) than on CHO-C2F7PSGL-1 cells (median rolling velocity of 300.19-L cells: 89.5 µm/s, range 14–262 µm/s, P25 = 66 µm/s, P75 = 101 µm/s, n = 4, p < 0.01; median rolling velocity of K-562-P cells: 14.6 µm/s, range 0.2–99.4 µm/s, P25 = 8.5 µm/s, P75 = 24.2 µm/s, n = 4; p < 0.0001) or on CHO-C2F4PSGL-1 cells (median rolling velocity of 300.19-L cells: 138 µm/s, range 49–337 µm/s, P25 = 114 µm/s, P75 = 161 µm/s, n = 4, p < 0.0001; median rolling velocity of K-562-P cells: 21 µm/s, range 1,3–132 µm/s, P25 = 13 µm/s, P75 = 29 µm/s, n = 4; the number of analyzed rolling events in all mentioned conditions ranged from 288 to 894, p < 0.0001). These results indicate that FucT-IV and -VII cooperate in regulating L- and P-selectin-dependent cell rolling velocity, slowest rolling velocities, and maximal cell recruitment being observed when PSGL-1 O-glycans were proximally and distally fucosylated. Rolling velocities were significantly slower on CHO-C2F7PSGL-1 cells than on CHO-C2F4PSGL-1 cells (p < 0.001), suggesting that the generation of sLex and CLA by FucT-VII on PSGL-1 is more efficient than Lex and CLA synthesis by FucT-IV in supporting L- and P-selectin-dependent cell rolling.

Stabilization of L-selectin-dependent Rolling on PSGL-1; Role of FucT-IV and -VII—The stability of rolling velocities on PSGL-1, under a constant shear stress of 1.5 dynes/cm2, was examined by measuring distances traveled by tracked cells within successive video frames (0.032 s) for 2.7 s in the flow direction. The mean velocity of tracked cells was included between percentile 40 and 60 of velocity curves illustrated in Fig. 3c. Each increase in velocity of tracked cells is represented in Fig. 4a by a peak and each decrease by a valley. The instability of rolling velocity of each tracked cell, within successive video frames, was quantified by calculating the S.D. of the mean velocity. The pooled data obtained from the whole cell population were used to determine the mean S.D. ± S.D. of cell rolling velocities on transfected CHOdhfr– cells. These analyses indicate that the rolling velocity is more unstable, in the absence of PSGL-1, on CHO-C2F4F7 cells than in the presence of PSGL-1 on CHO-C2F7PSGL-1 cells or on CHO-C2F4F7PSGL-1 cells (mean S.D. ± S.D. of 300.19-L cells on CHO-C2F4F7 cells: 103 ± 37 µm/s, range 66–169 µm/s, n = 6 versus 53 ± 14 µm/s, range 30–73 µm/s, n = 6, on CHO-C2F7PSGL-1 cells versus 42 ± 12 µm/s, range 33–68 µm/s, n = 6, on CHO-C2F4F7PSGL-1 cells, p < 0.001, Fig. 4a). Cell rolling was more stable on CHO cells expressing recombinant PSGL-1 fucosylated by both FucT-IV and -VII than by FucT-IV alone (mean S.D. ± S.D. of 300.19-L cells on CHO-C2F4F7PSGL-1 cells: 42 ± 12 µm/s, range 33–68 µm/s, n = 6 versus 76 ± 30 µm/s, range 31–123 µm/s, n = 6 on CHO-C2F4PSGL-1 cells, p < 0.01).

The distribution of travel distances illustrated in Fig. 4b was assessed by measuring cell displacements within successive video frames (100–128 determinations for each cell category). Data obtained for each cell category were pooled and illustrated in Fig. 4b. Cell displacements observed among compared cell categories were significantly different (p < 0.0001). Cell displacements were strongly affected by the pattern of PSGL-1 fucosylation. A higher percentage of 300.19-L cells rolled >3.0 µm, within a video frame, on CHO-C2F4F7 and on CHO-C2F4PSGL-1 (76.0 and 59% respectively, number of determinations 119 and 100) than on CHO-C2F7PSGL-1 or on CHO-C2F4F7PSGL-1 (28 and 18%, respectively, n = 128 and 100; Fig. 4b).

Regulation of E-selectin-dependent Rolling on CHO Transfectants; Role of FucT-IV, -VII, C2GnT, and PSGL-1—The role of PSGL-1, C2GnT, FucT-IV, and -VII in supporting K-562-E cell and neutrophil rolling on CHOdhfr– cell monolayers was studied under a constant shear stress of 1.5 dynes/cm2 (Fig. 5a). CHOdhfr– transfectants expressed similar levels of Lex and/or sLex and/or CLA and/or PSGL-1. In contrast to observations made with neutrophils (Fig. 5c), the co-expression of PSGL-1 was not required to support the recruitment of K-562-E cells (mean percentage of rolling cells ± S.E.: (a) CHO-F4, 88 ± 6%, n = 3; (b) CHO-C2F4, 124 ± 8%, n = 3; CHO-F7, 114 ± 10%, n = 3; (c) CHO-C2F7, 100 ± 8%, n = 3; (d) CHO-C2F4F7, 118 ± 12%, n = 3; (e) CHO-C2F4PSGL-1, 142 ± 14%, n = 3; CHO-C2F7PSGL-1, 145 ± 11%, n = 3; CHO-C2F4F7PSGL-1, 100 ± 7%, number of examined microscopic fields in all studied conditions 128; Fig. 5a). These results also indicate the following: 1) that both FucT-IV and -VII generate carbohydrate determinants that efficiently support E-selectin-dependent rolling; 2) that core-2 O-glycans attached to PSGL-1 are not required to present Lex and sLex carbohydrates and to support cell rolling on CHO transfectants; and 3) that the co-expression of both FucT-IV and -VII in CHOdhfr–-PSGL-1 transfectants does not increase cell recruitment over that observed on cells expressing only one fucosyltransferase.

As E-selectin is physiologically expressed by adherent endothelial cells, we examined if similar results were observed when flowing CHO transfectants rolled on recombinant E-selectin. CHO transfectants expressing FucT-IV and/or -VII were similarly recruited on E-selectin, and PSGL-1 expression was not required to support E-selectin-dependent rolling of flowing CHO transfectants (CHO cell recruitment on E-selectin (mean number of rolling cells/min/mm2± S.E.): CHO-C2F4F7PSGL-1 cells, 506 ± 15; 100 ± 3%, n = 3; CHO-C2F7PSGL-1, 94 ± 2%, n = 3; CHO-C2F4PSGL-1, 91 ± 4%, n = 3; CHO-C2F4F7 cells, 105 ± 3%, n = 3; Fig. 5b). The treatment of CHOdhfr–-C2F4PSGL-1 cells with neuraminidase (0.1 units/ml), for 20 min at 37 °C, abrogated sLex expression but did not change the ability of the treated cells to roll on E-selectin (number of rolling cells on E-selectin (mean ± S.E.): 208 ± 12 versus 214 ± 12 cells/min/mm2, n = 3). In contrast, CHOdhfr–-C2F7PSGL-1 cell exposure to neuraminidase inhibited CHO cell rolling on E-selectin by 69 ± 3% (n = 3, not illustrated).

E-selectin-dependent rolling velocities did not significantly differ on the various PSGL-1 glycoforms expressed by CHOdhfr– cells (Fig. 5d; median rolling velocity of K-562-E cells: (a) CHO-F4 cells, 4.7 µm/s, P25 = 2.6 µm/s, P75 = 8.4 µm/s; (b) CHO-C2F4 cells, 4.6 µm/s, P25 = 2.6 µm/s, P75 = 8.4 µm/s; (c) CHO-F7, 4.6 µm/s, P25 = 2.2 µm/s, P75 = 7.9 µm/s; (d) CHO-C2F7 cells, 4.1 µm/s, P25 = 1.8 µm/s, P75 = 7.9 µm/s; (e) CHO-C2F4F7 cells, 3.8 µm/s, P25 = 2.0 µm/s, P75 = 7.2 µm/s; (f) CHO-C2F4PS, 4.9 µm/s, P25 = 2.5 µm/s, P75 = 8.9 µm/s; (g) CHO-C2F7PS, 4.7 µm/s, P25 = 2.4 µm/s, P75 = 9.5 µm/s; (h) CHO-C2F4F7PS cells, 4.7 µm/s, P25 = 1.8 µm/s, P75 = 8.8 µm/s; the number of analyzed rolling events in all mentioned conditions ranged from 194 to 331 and are representative of three experiments). These results are in contrast with observations made with neutrophils, 300.19-L cells, and K-562-P cells that showed slower rolling velocities on PSGL-1 glycoforms fucosylated by FucT-VII (Fig. 3).

Several observations previously indicated the involvement of PSGL-1 in mediating leukocyte rolling on E-selectin (19, 21). However, the role of FucT-IV or -VII had not been assessed. To evaluate this point, we studied the interactions of K-562-E cells with PSGL-1/µ chimeric glycoforms adsorbed on glass coverslips bound to the bottom of the flow chamber. Rolling assays were performed under a constant shear stress of 1.5 dynes/cm2. Most interestingly, as observed for L- and P-selectin-dependent rolling (Fig. 3), cell recruitment mediated by E-selectin was significantly lower when PSGL-1 was fucosylated by FucT-IV (mean % of rolling cells ± S.E. on C2F4PSGL-1/µ:61 ± 3%, n = 4, p < 0.001) than by FucT-VII (C2F7PSGL-1/µ: 78 ± 3%, n = 4, p < 0.001) or both FucT-IV and -VII (C2F4F7PSGL-1/µ: 100 ± 3%, n = 4, p < 0.001, mean number of rolling cells/min/mm2 on C2F4F7PSGL-1/µ: 504 ± 17, number of examined microscopic fields in all studied conditions 128; Fig. 6). Most importantly, in contrast to observations made on CHOdhfr– transfectants (Fig. 5a), the pattern of PSGL-1/µ chimera fucosylation affected the rolling velocity of K-562-E cells. E-selectin-dependent rolling velocities were higher on C2F4PSGL-1/µ chimera (median rolling velocity = 2.3 µm/s, range 0.1–32.5 µm/s, P25 = 1.1 µm/s; P75 = 4.9 µm/s, n = 3) than on C2F7PSGL-1/µ (median = 0.8 µm/s, range 0.0–26.1 µm/s, P25 = 0.3 µm/s; P75 = 2.2 µm/s, n = 3, p < 0.05) or on C2F4F7PSGL-1/µ chimera (median = 1.0 µm/s, range 0.0–25.1 µm/s, P25 = 0.6 µm/s; P75 = 2.3 µm/s, n = 3, p < 0.001, the number of analyzed rolling cells in all mentioned conditions ranged from 200 to 257).

Anti-P-selectin Activity of PSGL-1; Role of Distal and Proximal Fucosylation—Because recombinant PSGL-1 has a major anti-selectin activity (69, 70), we examined the inhibitory activity of PSGL-1/µ glycoforms on P-selectin binding to sLex/BSA. The maximal inhibitory activity was defined by the complete inhibition of P-selectin interaction with sLex/BSA observed in presence of the anti-P-selectin mAb WAPS 12.2 (inhibitory activity 100%), whereas the lack of inhibitory activity (0%) was defined by the reactivity of P-selectin with sLex/BSA in the presence of the non-blocking anti-P-selectin mAb S12. The fucosylation of PSGL-1/µ chimera by FucT-IV generated a chimeric molecule whose inhibitory activity was weaker than that obtained through PSGL-1 fucosylation by FucT-VII or both by FucT-IV and -VII (inhibitory activity of C2F4PSGL-1/µ (IC50): 0.88 ± 0.13 µg/ml (n = 4) versus (a) 0.37 ± 0.04 µg/ml for C2F7PSGL-1/µ (n = 3) and (b) 0.26 ± 0.06 µg/ml for C2F4F7PSGL-1/µ, n = 2, p < 0.03; Fig. 7).



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 7.
Inhibition of P-selectin binding to sLex/BSA by PSGL-1/µ chimera glycosylated by C2GnT, FucT-IV, and/or FucT-VII. P-selectin/µ chimera binding to sLex/BSA was detected by ELISA as described under "Experimental Procedures." Results are expressed as mean ± S.E. and are representative of 3–4 experiments.

 
Role of Core-2 O-Glycans Attached to Thr-57 in Supporting L-, P-, and E-selectin-dependent Rolling—Previous studies performed with CHO cells expressing PSGL-1 mutants have shown that core-2 O-glycans attached to Thr-57, terminated by sLex/CLA residues, play a critical role in supporting L- and P-selectin-dependent rolling (26, 27, 71). However, the role of the fucosylation of core-2 O-glycans linked to Thr-57 in supporting E-selectin-mediated rolling has not been studied. This point was examined by performing rolling assays on wild-type C2F7PSGL-1/µ and mutant C2F7PSGL-1T57A/µ chimera, in which Thr-57 was substituted by Ala. Chimera were adsorbed on coverslips bound to the bottom of the flow chamber. The specificity of PSGL-1 interactions with 300.19-L, CHO-P, and K-562-E cells was verified by the complete inhibition of cell rolling observed after treatment of transfectants with blocking anti-L-selectin (LAM 1-3), anti-P-selectin (WAPS 12.2), or anti-E-selectin (7A9) mAbs or in the presence of 5 mM EDTA. As expected, 300.19-L cell rolling on C2F7PSGL-1/µ chimera was abolished by the substitution of Thr-57 by Ala (mean number of rolling cells/min/mm2± S.E.: 587 ± 12 (100 ± 2%) versus 2.2 ± 0.4 (0.4 ± 0.07%), n = 4, p < 0.001; Fig. 8a). The recruitment of CHO-P cells on C2F7PSGL-1T57A/µ chimera was also strongly decreased (mean number of rolling cells/min/mm2± S.E.: 128 ± 6 (100 ± 5%) versus 27.1 ± 0.5 (21 ± 0.4%), n = 4, p < 0.001; Fig. 8a); however, a significant number of rolling cells was still observed on C2F7PSGL-1T57A/µ chimera. Most interestingly, the recruitment of K-562-E cells was not abrogated by Thr-57 substitution by Ala but was only decreased by 24 ± 3% (mean number of rolling cells/min/mm2± S.E.: 2080 ± 64 (100 ± 3%) versus 1580 ± 47 (76 ± 3%), number of examined microscopic fields in all studied conditions: 128, n = 4, p < 0.001; Fig. 8a).

Rolling velocities of CHO-P cells were significantly faster on C2F7PSGL-1T57A/µ than on C2F7PSGL-1/µ chimera (median rolling velocity on C2F7PSGL-1T57A/µ: 36.6 µm/s, range 0.2–163.4 µm/s, P25 = 24.3 µm/s; P75 = 48.9 µm/s versus 4.5 µm/s, range 0.3–50.5 µm/s, P25 = 2.5 µm/s; P75 = 7.8 µm/s on C2F7PSGL-1/µ, n = 4, p < 0.0001; Fig. 8b). Rolling velocities of K-562-E cells were also strongly affected by Thr-57 substitution by Ala. Thus, higher rolling velocities were observed on C2F7PSGL-1T57A/µ than on C2F7PSGL-1/µ chimera (median rolling velocity on C2F7PSGL-1T57A/µ: 17.2 µm/s, range 3.6–66.7 µm/s, P25 = 12.5 µm/s; P75 = 23.1 µm/s versus 4.0 µm/s, range 0.0–23.4 µm/s, P25 = 2.1 µm/s; P75 = 7.0 µm/s on C2F7PSGL-1/µ, number of analyzed rolling cells in all mentioned conditions: 300, n = 4; Fig. 8b).

Most importantly, 300.19-L, CHO-P, or K-562-E cells did not roll on non-fucosylated PSGL-1/µ chimera (mean number of rolling cells/min/mm2± S.E.: (a) 300.19-L cells, 0.2 ± 0.1%; (b) CHO-P cells, 0.1 ± 0.1%, number of examined microscopic fields 64, n = 2; and (c) K-562-E cells, 0.02 ± 0.02%, number of examined microscopic fields 128, n = 2; Fig. 8). The lack of 300.19 cell recruitment on C2F7PSGL-1T57A/µ chimera confirms that core-2 O-glycans attached to Thr-57 are essential to support L-selectin-dependent rolling and indicate that they support also ~80% of P-selectin-mediated rolling. In contrast, they may play a lesser role in mediating E-selectin-dependent rolling, cell recruitment being only weakly decreased (by ~24%) on C2F7PSGL-1T57A/µ chimeras.

Location of sLex, CLA, and Lex Epitopes on PSGL-1; Role of Thr-57—Because experiments illustrated in Fig. 8 showed that an important part of E-selectin-mediated rolling does not depend on core-2 O-glycans linked to Thr-57, we examined if sLex/CLA residues are expressed on C2F7PSGL-1T57A/µ chimera. In keeping with the results of adhesion assays illustrated in Fig. 8, sLex residues, identified by CSLEX-1 mAb, and CLA, recognized by HECA-452 mAb, were detected on both C2F7PSGL-1/µ and C2F7PSGL-1T57A/µ chimera indicating that O-glycans attached to Thr-57 are not the sole lactosamine chains decorated by sLex and CLA (Fig. 9).



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 9.
Presentation of sLex, CLA, and Lex by PSGL-1; role of core-2 O-glycans attached to Thr-57. Chimera were adsorbed on 10.0-µm polystyrene microspheres, coated with goat anti-human IgM, and analyzed for CLA, sLex, and PSGL-1 expression using HECA-452, CSLEX-1, and KPL1 mAbs (filled histograms). Isotype-matched mouse or rat immunoglobulins were used as negative control (open histograms). The proportion of positive microspheres (%) and the mean fluorescence intensity are indicated in each histogram. Results are representative of three experiments.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Core-2-O-glycans attached to Thr-57 and terminated by sLex determinants play a critical role in supporting L-selectin and P-selectin interactions with PSGL-1 (20, 26, 27, 71–73). Although the role of human FucT-VII and of C2GnT in supporting leukocyte rolling was well characterized, the involvement of human FucT-IV in regulating PSGL-1 interactions with L-selectin and the potential cooperation of human FucT-IV and -VII in generating selectin ligand activity on PSGL-1 had not been examined previously. Results presented here indicate the following: 1) that both human FucT-IV and -VII confer to PSGL-1 the ability to support L-selectin-, P-selectin-, and E-selectin-dependent rolling; 2) that the contribution of these two human fucosyltransferases is unequal, FucT-VII playing a predominant role in regulating L-selectin-, P-selectin-, and E-selectin-dependent rolling on PSGL-1; and 3) in addition, we show that core-2 O-glycans attached to Thr-57 are not the sole E-selectin-binding sites on PSGL-1, additional binding site supporting >75% of E-selectin-dependent rolling interactions with PSGL-1.

FucT-IV controls the synthesis of Lex residues by mediating the proximal or internal {alpha}1,3-fucosylation of polylactosamines linked to PSGL-1, whereas FucT-VII preferentially mediates the distal fucosylation of mono- or polylactosamines (38, 50). The importance of FucT-IV and FucT-VII in generating Lex and sLex determinants was indicated by observations made with cell lines or transfectants expressing FucT-IV or -VII cDNAs (18, 26, 40, 42, 43, 45–48, 57, 58, 62, 74) and with leukocytes isolated from mice deficient in {alpha}1,3-fucosyltransferases (18, 51–53). Our observations confirm that the transfection of CHO cells with human FucT-IV cDNA is sufficient to induce Lex expression, whereas CHO cells expressing FucT-VII generate sLex (26, 38, 40–42, 46, 47, 57, 58, 62, 71, 75). CHOdhfr– cells used in this study strongly expressed CLA and sLex when they were transfected with FucT-VII cDNA, whereas they synthesized only low levels of sLex when they expressed FucT-IV (Fig. 1). The generation of sLex by CHO cells expressing FucT-IV has been observed previously (41, 46, 62) in CHOdhfr– cells but not in CHOPro-5 cells. The biochemical basis of sLex synthesis of CHOdhfr– cells still remains unexplained. In the present study, the lack of the inhibitory effect of V. cholerae neuraminidase on the ability of CHO-C2F4PSGL-1 cell to roll on L-, E-, and P-selectin indicates that sLex expression is not required to support CHOdhfr–-C2F4PSGL-1 cell rolling on L- and P-selectin. In contrast, the exposure of CHO-C2F7PSGL-1 cells to neuraminidase strongly decreased cell recruitment on selectins underlining the critical role played by sLex in regulating C2F7PSGL-1 interactions with selectins. A similar lack of requirement in sLex for mediating C2F4PSGL-1 interactions with selectins was observed in adhesion assays performed with human neutrophils deficient in FucT-VII that do not synthesize sLex and efficiently interact with P- and E-selectin (49).

Functional studies performed with chimeric selectins showed that the co-expression of PSGL-1 with human FucT-IV or -VII is required to support L- and P-selectin binding (Fig. 2), whereas FucT-IV or -VII expression was sufficient to generate E-selectin ligand activity on CHOdhfr– cells. The PSGL-1-independent reactivity of E-selectin most likely results from E-selectin binding to E-selectin ligand-1 (ESL-1) or other potential ligand(s) to which both FucT-IV and -VII confer a functional activity (47). L-selectin/µ and P-selectin/µ significantly bound to CHOdhfr– cells co-expressing human FucT-IV, C2GnT, and PSGL-1 (Fig. 2). However, the reactivity of L-selectin/µ and P-selectin/µ chimera with CHO-C2F4PSGL-1 cells was weaker than with CHO-C2F7PSGL-1 or CHOC2F4F7PSGL-1, indicating that the distal fucosylation of PSGL-1 by FucT-VII may generate binding sites that bind L- and P-selectin more efficiently than the proximal and/or internal fucosylation promoted by FucT-IV (Fig. 2).

In keeping with results obtained with chimeric selectins (Fig. 2), we observed a contribution of both FucT-IV and -VII in regulating L-selectin- and P-selectin-dependent rolling on PSGL-1 (Fig. 3). The crucial role played by PSGL-1 was confirmed by the strong increase in cell recruitment observed in its presence (Fig. 3, a and b). The side by side comparison of L-selectin- and P-selectin-dependent rolling on PSGL-1 (Fig. 3a) and of PSGL-1-dependent rolling on L-selectin and P-selectin (Fig. 3b) indicated that FucT-IV and -VII unequally contribute to support L- and P-selectin-dependent rolling. Indeed, L- and P-selectin-dependent cell recruitment was lower when C2PSGL-1 was fucosylated in CHO cells by FucT-IV, suggesting a predominant role for FucT-VII (Fig. 3). These adhesion studies also indicated that FucT-IV and -VII cooperate in supporting cell rolling on PSGL-1, cell recruitment being maximal when PSGL-1 is synthesized in cells that co-express both fucosyltransferases (Fig. 3, a and b). The critical involvement of FucT-VII in controlling leukocyte trafficking and in synthesizing selectin ligands was established in FucT-VII-deficient mice that exhibit an impaired E-selectin- and P-selectin-dependent leukocyte extravasation in inflammatory lesions and lymphocyte homing in peripheral lymph nodes (51, 52) and more recently in a model of atherogenesis in apolipoprotein E–/– mice deficient in FucT-IV or -VII (76). A minor role was attributed to mouse FucT-IV in synthesizing P-selectin and E-selectin ligands, mice deficient in FucT-VII exhibiting only a weak residual leukocyte rolling along postcapillary venules and migration in inflamed tissues (52, 53) and a subtle reduction of atherosclerotic lesions (76). Results presented here show that human FucT-IV can generate L- and P-selectin binding activities on PSGL-1. Further studies will be required, however, to establish the physiological role of FucT-IV in human leukocytes. Our results parallel observations made with leukocytes isolated from individuals presenting a missense mutation G329A of the FucT-VII gene that abolishes FucT-VII enzyme activity (54). Neutrophils isolated from these patients do not significantly express sLex but conserve a significant E-selectin and an unchanged P-selectin ligand activity that was attributed to FucT-IV (49). However, the detection of a compensatory overexpression of FucT-IV mRNA (>100-fold increase) in human neutrophils deficient in FucT-VII suggested that it may have rescued their rolling capacity (49). In contrast to patients with leukocyte adhesion deficiency II, who present a large defect in fucosylation secondary to a disabled GDP-fucose transporter (77–80), patients deficient in FucT-VII do not suffer from recurrent severe infections (79). These clinical observations suggested that the overexpressed FucT-IV activity may have compensated for the lack of FucT-VII activity (54).

Rolling velocities were significantly slower when PSGL-1 was fucosylated by FucT-VII instead of FucT-IV (Fig. 3c). In addition, L-selectin-dependent rolling was more stable on PSGL-1 glycoforms fucosylated by FucT-VII than by FucT-IV (Fig. 4). These results further indicate that FucT-VII serves as the main human {alpha}1,3-fucosyltransferase that regulates leukocyte rolling on PSGL-1. However, at a lesser extent than FucT-VII, FucT-IV may also participate in the regulation of leukocyte rolling on PSGL-1. Most interestingly, the analyses of cell recruitment and of rolling velocities on PSGL-1, illustrated in Fig. 3, show that human FucT-IV and -VII cooperate in regulating L- and P-selectin-dependent rolling. These results are in agreement with observations made in fucosyltransferase-deficient mice, which showed that leukocyte E- and P-selectin ligand activities result from the sum of unequal contributions provided by FucT-IV and -VII (52). Our results are, however, in contrast to the results of binding studies performed with PSGL-1 amino-terminal peptides expressing core-2 O-glycans containing sialylated and polyfucosylated polylactosamine, which exhibit a decreased binding affinity to P-selectin (73). Distinct requirements between peptides and the whole extracellular domain of PSGL-1 for binding to P-selectin as well as heterogeneity in fucosylated PSGL-1 molecules produced by CHOdhfr– cells might explain these results.

In agreement with previous studies, CHOdhfr– cells expressing human FucT-IV or -VII generated E-selectin ligands (26, 42, 46, 47, 58) that supported E-selectin-dependent rolling (Fig. 5). Of note, CHOdhfr– cells and CHOPro-5 cells expressing human FucT-IV were shown previously (46) to differ in their ability to synthesize cell surface E-selectin binding activity. Human FucT-IV generated E-selectin ligands at the surface of CHOdhfr– cells but not on CHOPro-5 cells (41, 42, 62). These observations and studies performed with leukocytic cell lines (43) indicated that the glycosylation phenotype of cell lines contributes to the ability of FucT-IV to synthesize E-selectin ligands. This may limit the physiological relevance of assays performed with cell lines. However, our observations made in CHOdhfr– cells are consistent with observations made with leukocytes obtained from patients with FucT-VII deficiency that exhibit a conserved leukocyte rolling on E-selectin despite a lack of FucT-VII activity (49). C2GnT co-expression with FucT-IV or -VII did not increase E-selectin-mediated rolling suggesting that E-selectin mainly interacts with N-glycosylated ligands modified with sLex or Lex determinants, such as ESL-1, present on CHO cells expressing FucT-IV and/or -VII (34, 47).

As several reports indicated the involvement of PSGL-1 in regulating leukocyte rolling on E-selectin (21–23), we examined the importance of PSGL-1 fucosylation by analyzing E-selectin-dependent rolling on PSGL-1/µ chimera. As observed for L-selectin and P-selectin, FucT-VII played a predominant role in regulating E-selectin-dependent recruitment and rolling velocities on PSGL-1 (Fig. 6). As illustrated in Fig. 6a, FucT-IV and -VII cooperate in recruiting E-selectin-expressing cells on PSGL-1. These observations indicate that FucT-IV and -VII do not contribute equally in conferring E-selectin ligand activity to PSGL-1, and, as illustrated in Fig. 5; however, they do not differ in their ability to generate E-selectin ligand activities on CHOdhfr– cells.

Recombinant soluble PSGL-1 is a potent inhibitor of leukocyte migration that reduces leukocyte adhesion and migration into inflamed tissues and that exhibits broad anti-inflammatory properties (69, 70, 81–85). Because fucosylation may affect the inhibitory activity of soluble PSGL-1, we compared the anti-P-selectin activities of PSGL-1/µ glycoforms in a P-selectin/µ binding assay to sLex/BSA. The inhibitory activity of PSGL-1/µ chimera was higher when the chimera was fucosylated by FucT-VII or both FucT-IV and -VII than by FucT-IV (Fig. 7). These results show that FucT-VII is more efficient than FucT-IV in conferring an inhibitory activity to recombinant PSGL-1 and suggest that maximal anti-P-selectin activity is obtained when the recombinant molecule is produced in CHOdhfr– cells co-expressing both fucosyltransferases.

The importance of core-2 O-glycans linked to Thr-57 in supporting L-selectin-, P-selectin-, and in particular E-selectin-mediated rolling was examined on isolated C2F7PSGL-1/µ and C2F7PSGL-1T57A/µ chimeras. Consistent with previous studies (26, 27), L-selectin-dependent rolling was abrogated in the absence of Thr-57. P-selectin-mediated rolling was strongly decreased on C2F7PSGL-1T57A/µ, but some residual rolling remained, suggesting that P-selectin may react with additional binding site(s) distinct from the major P-selectin-binding site located at the amino-terminal end of PSGL-1 (Fig. 8a) (20, 28, 71). Most importantly, E-selectin-dependent rolling was reduced by only 24% on PSGL-1T57A/µ chimera indicating that additional E-selectin-binding sites, distinct from core-2 O-glycans linked to Thr-57, are expressed on wild-type PSGL-1. Because the expression of CLA and sLex was correlated to the capacity of E-selectin to react with PSGL-1 (31, 33, 86, 87), we examined whether PSGL-1s express these carbohydrate determinants at sites distinct from O-glycans attached to Thr-57. Flow cytometry analysis using HECA-452 and CSLEX-1 mAbs confirmed the presence of CLA and sLex determinants on C2F7PSGL-1T57A/µ chimera (Fig. 9).

In conclusion, the data presented here indicate that human FucT-IV and -VII have both the ability to confer to PSGL-1 ligand activity for L-selectin, P-selectin, and E-selectin. However, FucT-VII plays a predominant role. Most importantly, E-selectin-mediated rolling on PSGL-1 was only partially dependent on core-2 O-glycans attached to Thr-57, additional binding sites expressing CLA and sLex mediating >75% of E-selectin-dependent rolling. These data enlighten the role played by human FucT-IV and -VII in regulating L-, P-, and E-selectin-mediated interactions with PSGL-1, a key initial event of the inflammatory response (1, 38).


   FOOTNOTES
 
* This work was supported by Grant 32-065177.01 from the Swiss National Foundation for Scientific Research. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed: Service of Hematology, BH 18-544, CHUV, 1011 Lausanne, Switzerland. E-mail: olivier.spertini{at}chuv.ch.

1 The abbreviations used are: PSGL-1, P-selectin glycoprotein ligand-1; FucT, fucosyltransferase; mAb, monoclonal antibody; FCS, fetal calf serum; FITC, fluorescein isothiocyanate; CHO, Chinese hamster ovary; PE, phosphatidylethanolamine; PBS, phosphate-buffered saline; BSA, bovine serum albumin; ELISA, enzyme-linked immunosorbent assay; Lex, Lewis x; sLex, sialyl Lex; IRES, internal ribosome entry site; C2GnT, core-2 {beta}1,6-N-acetylglucosaminyltransferase transferase; CLA, cutaneous lymphocyte antigen. Back


   ACKNOWLEDGMENTS
 
We thank Dr. J. Lowe (University of Michigan, Ann Arbor, MI) for generously providing cDNA of human FucT-VII cDNA, Dr. M. Fukuda (Glycobiology Program, The Burnham Institute, La Jolla, CA) for C2GnT cDNA, and the Genetics Institute (Cambridge, MA) for human FucT-IV cDNA.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Lowe, J. B. (2003) Curr. Opin. Cell Biol. 15, 531–538[CrossRef][Medline] [Order article via Infotrieve]
  2. McEver, R. P. (2002) Curr. Opin. Cell Biol. 14, 581–586[CrossRef][Medline] [Order article via Infotrieve]
  3. Ley, K. (2003) Trends Mol. Med. 9, 263–268[CrossRef][Medline] [Order article via Infotrieve]
  4. Vestweber, D., and Blanks, J. E. (1999) Physiol. Rev. 79, 181–213[Abstract/Free Full Text]
  5. Giuffrè, L., Cordey, A.-S., Monai, N., Tardy, Y., Schapira, M., and Spertini, O. (1997) J. Cell Biol. 136, 945–956[Abstract/Free Full Text]
  6. Ley, K., Bullard, D. C., Arbonés, M. L., Bosse, R., Vestweber, D., Tedder, T. F., and Beaudet, A. L. (1995) J. Exp. Med. 181, 669–675[Abstract/Free Full Text]
  7. Davenpeck, K. L., Steeber, D. A., Tedder, T. F., and Bochner, B. S. (1997) J. Immunol. 159, 1977–1986[Abstract]
  8. Jung, U., Bullard, D. C., Tedder, T. F., and Ley, K. (1996) Am. J. Physiol. 271, H2740–H2747
  9. Moore, K. L., Patel, K. D., Bruehl, R. E., Li, F., Johnson, D. A., Lichenstein, H. S., Cummings, R. D., Bainton, D. F., and McEver, R. P. (1995) J. Cell Biol. 128, 661–671[Abstract/Free Full Text]
  10. Sako, D., Chang, X.-J., Barone, K. M., Vachino, G., White, H. M., Shaw, G., Veldman, G. M., Bean, K. M., Ahern, T. J., Furie, B., Cumming, D. A., and Larsen, G. R. (1993) Cell 75, 1179–1186[CrossRef][Medline] [Order article via Infotrieve]
  11. McEver, R. P., and Cummings, R. D. (1997) J. Clin. Investig. 100, 485–491[Medline] [Order article via Infotrieve]
  12. Moore, K., Stults, N., Diaz, S., Smith, D., Cummings, R., Varki, A., and McEver, R. (1992) J. Cell Biol. 118, 445–456[Abstract/Free Full Text]
  13. Laszik, Z., Jansen, P. J., Cummings, R. D., Tedder, T. F., McEver, R. P., and Moore, K. L. (1996) Blood 88, 3010–3021[Abstract/Free Full Text]
  14. Spertini, O., Cordey, A.-S., Monai, N., Giuffrè, L., and Schapira, M. (1996) J. Cell Biol. 135, 523–531[Abstract/Free Full Text]
  15. Walcheck, B., Moore, K. L., Mcever, R. P., and Kishimoto, T. K. (1996) J. Clin. Investig. 98, 1081–1087[Medline] [Order article via Infotrieve]
  16. Tu, L. L., Chen, A. J., Delahunty, M. D., Moore, K. L., Watson, S. R., McEver, R. P., and Tedder, T. F. (1996) J. Immunol. 157, 3995–4004[Abstract]
  17. Guyer, D. A., Moore, K. L., Lynam, E. B., Schammel, C. M. G., Rogelj, S., McEver, R. P., and Sklar, L. A. (1996) Blood 88, 2415–2421[Abstract/Free Full Text]
  18. Huang, M. C., Zollner, O., Moll, T., Maly, P., Thall, A. D., Lowe, J. B., and Vestweber, D. (2000) J. Biol. Chem. 275, 31353–31360[Abstract/Free Full Text]
  19. Goetz, D. J., Greif, D. M., Ding, H., Camphausen, R. T., Howes, S., Comess, K. M., Snapp, K. R., Kansas, G. S., and Luscinskas, F. W. (1997) J. Cell Biol. 137, 509–519[Abstract/Free Full Text]
  20. Somers, W. S., Tang, J., Shaw, G. D., and Camphausen, R. T. (2000) Cell 103, 467–479[CrossRef][Medline] [Order article via Infotrieve]
  21. Xia, L., Sperandio, M., Yago, T., McDaniel, J. M., Cummings, R. D., Pearson-White, S., Ley, K., and McEver, R. P. (2002) J. Clin. Investig. 109, 939–950[CrossRef][Medline] [Order article via Infotrieve]
  22. Norman, K. E., Katopodis, A. G., Thoma, G., Kolbinger, F., Hicks, A. E., Cotter, M. J., Pockley, A. G., and Hellewell, P. G. (2000) Blood 96, 3585–3591[Abstract/Free Full Text]
  23. Hirata, T., Merrill-Skoloff, G., Aab, M., Yang, J., Furie, B. C., and Furie, B. (2000) J. Exp. Med. 192, 1669–1676[Abstract/Free Full Text]
  24. Katayama, Y., Hidalgo, A., Furie, B. C., Vestweber, D., Furie, B., and Frenette, P. S. (2003) Blood 102, 2060–2067[Abstract/Free Full Text]
  25. Sperandio, M., Smith, M. L., Forlow, S. B., Olson, T. S., Xia, L., McEver, R. P., and Ley, K. (2003) J. Exp. Med. 197, 1355–1363[Abstract/Free Full Text]
  26. Bernimoulin, M. P., Zeng, X. L., Abbal, C., Giraud, S., Martinez, M., Michielin, O., Schapira, M., and Spertini, O. (2003) J. Biol. Chem. 278, 37–47[Abstract/Free Full Text]
  27. Ramachandran, V., Nollert, M. U., Qiu, H. Y., Liu, W. J., Cummings, R. D., Zhu, C., and McEver, R. P. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 3771–13776
  28. Leppanen, A., White, S. P., Helin, J., McEver, R. P., and Cummings, R. D. (2000) J. Biol. Chem. 275, 39569–39578[Abstract/Free Full Text]
  29. Sperandio, M., Forlow, S. B., Thatte, J., Ellies, L. G., Marth, J. D., and Ley, K. (2001) J. Immunol. 167, 2268–2274[Abstract/Free Full Text]
  30. Wilkins, P. P., McEver, R. P., and Cummings, R. D. (1996) J. Biol. Chem. 271, 18732–18742[Abstract/Free Full Text]
  31. Fuhlbrigge, R. C., King, S. L., Dimitroff, C. J., Kupper, T. S., and Sackstein, R. (2002) J. Immunol. 168, 5645–5651[Abstract/Free Full Text]
  32. Borges, E., Pendl, G., Eytner, R., Steegmaier, M., Zollner, O., and Vestweber, D. (1997) J. Biol. Chem. 272, 28786–28792[Abstract/Free Full Text]
  33. Fuhlbrigge, R. C., Kieffer, J. D., Armerding, D., and Kupper, T. S. (1997) Nature 389, 978–981[CrossRef][Medline] [Order article via Infotrieve]
  34. Steegmaier, M., Levinovitz, A., Isenmann, S., Borges, E., Lenter, M., Kocher, H. P., Kleuser, B., and Vestweber, D. (1995) Nature 373, 615–620[CrossRef][Medline] [Order article via Infotrieve]
  35. Jutila, M. A., Kurk, S., Jackiw, L., Knibbs, R. N., and Stoolman, L. M. (2002) J. Immunol. 169, 1768–1773[Abstract/Free Full Text]
  36. Zollner, O., Lenter, M. C., Blanks, J. E., Borges, E., Steegmaier, M., Zerwes, H. G., and Vestweber, D. (1997) J. Cell Biol. 136, 707–716[Abstract/Free Full Text]
  37. Winkler, I. G., Snapp, K. R., Simmons, P. J., and Levesque, J. P. (2004) Blood 103, 1685–1692[Abstract/Free Full Text]
  38. Lowe, J. B. (2002) Immunol. Rev. 186, 19–36[CrossRef][Medline] [Order article via Infotrieve]
  39. Kannagi, R. (2002) Curr. Opin. Struct. Biol. 12, 599–608[CrossRef][Medline] [Order article via Infotrieve]
  40. Natsuka, S., Gersten, K. M., Zenita, K., Kannagi, R., and Lowe, J. B. (1994) J. Biol. Chem. 269, 16789–16794[Abstract/Free Full Text]
  41. Lowe, J. B., Kukowska-Latallo, J. F., Nair, R. P., Larsen, R. D., Marks, R. M., Macher, B. A., Kelly, R. J., and Ernst, L. K. (1991) J. Biol. Chem. 266, 17467–17477[Abstract/Free Full Text]
  42. Goelz, S. E., Hession, C., Goff, D., Griffiths, B., Tizard, R., Newman, B., Chi-Rosso, G., and Lobb, R. (1990) Cell 63, 1349–1356[CrossRef][Medline] [Order article via Infotrieve]
  43. Wagers, A. J., Stoolman, L. M., Kannagi, R., Craig, R., and Kansas, G. S. (1997) J. Immunol. 159, 1917–1929[Abstract]
  44. Wagers, A. J., Waters, C. M., Stoolman, L. M., and Kansas, G. S. (1998) J. Exp. Med. 188, 2225–2231[Abstract/Free Full Text]
  45. Knibbs, R. N., Craig, R. A., Maly, P., Smith, P. L., Wolber, F. M., Faulkner, N. E., Lowe, J. B., and Stoolman, L. M. (1998) J. Immunol. 161, 6305–63015[Abstract/Free Full Text]
  46. Goelz, S., Kumar, R., Potvin, B., Sundaram, S., Brickelmaier, M., and Stanley, P. (1994) J. Biol. Chem. 269, 1033–1040[Abstract/Free Full Text]
  47. Zollner, O., and Vestweber, D. (1996) J. Biol. Chem. 271, 33002–33008[Abstract/Free Full Text]
  48. Yago, K., Zenita, K., Ginya, H., Sawada, M., Ohmori, K., Okuma, M., Kannagi, R., and Lowe, J. B. (1993) Cancer Res. 53, 5559–5565[Abstract/Free Full Text]
  49. Bengtson, P., Lundblad, A., Larson, G., and Pahlsson, P. (2002) J. Immunol. 169, 3940–3946[Abstract/Free Full Text]
  50. Niemela, R., Natunen, J., Majuri, M. L., Maaheimo, H., Helin, J., Lowe, J. B., Renkonen, O., and Renkonen, R. (1998) J. Biol. Chem. 273, 4021–4026[Abstract/Free Full Text]
  51. Maly, P., Thall, A., Petryniak, B., Rogers, C. E., Smith, P. L., Marks, R. M., Kelly, R. J., Gersten, K. M., Cheng, G., Saunders, T. L., Camper, S. A., Camphausen, R. T., Sullivan, F. X., Isogai, Y., Hindsgaul, O., von Andrian, U. H., and Lowe, J. B. (1996) Cell 86, 643–653[CrossRef][Medline] [Order article via Infotrieve]
  52. Homeister, J. W., Thall, A. D., Petryniak, B., Maly, P., Rogers, C. E., Smith, P. L., Kelly, R. J., Gersten, K. M., Askari, S. W., Cheng, G., Smithson, G., Marks, R. M., Misra, A. K., Hindsgaul, O., von Andrian, U. H., and Lowe, J. B. (2001) Immunity 15, 115–126[CrossRef][Medline] [Order article via Infotrieve]
  53. Weninger, W., Ulfman, L. H., Cheng, G., Souchkova, N., Quackenbush, E. J., Lowe, J. B., and von Andrian, U. H. (2000) Immunity 12, 665–676[CrossRef][Medline] [Order article via Infotrieve]
  54. Bengtson, P., Larson, C., Lundblad, A., Larson, G., and Pahlsson, P. (2001) J. Biol. Chem. 276, 31575–31582[Abstract/Free Full Text]
  55. Mitsuoka, C., Sawada-Kasugai, M., Ando-Furui, K., Izawa, M., Nakanishi, H., Nakamura, S., Ishida, H., Kiso, M., and Kannagi, R. (1998) J. Biol. Chem. 273, 11225–11233[Abstract/Free Full Text]
  56. Kobzdej, M. M., Leppanen, A., Ramachandran, V., Cummings, R. D., and McEver, R. P. (2002) Blood 100, 4485–4494[Abstract/Free Full Text]
  57. Huang, M. C., Laskowska, A., Vestweber, D., and Wild, M. K. (2002) J. Biol. Chem. 277, 47786–47795[Abstract/Free Full Text]
  58. Li, F., Wilkins, P. P., Crawley, S., Weinstein, J., Cummings, R. D., and McEver, R. P. (1996) J. Biol. Chem. 271, 3255–3264[Abstract/Free Full Text]
  59. Kumar, R., Camphausen, R. T., Sullivan, F. X., and Cumming, D. A. (1996) Blood 88, 3872–3879[Abstract/Free Full Text]
  60. Snapp, K. R., Wagers, A. J., Craig, R., Stoolman, L. M., and Kansas, G. S. (1997) Blood 89, 896–901[Abstract/Free Full Text]
  61. Smith, M. J., Smith, B. R., Lawrence, M. B., and Snapp, K. R. (2004) J. Biol. Chem.
  62. Kumar, R., Potvin, B., Muller, W. A., and Stanley, P. (1991) J. Biol. Chem. 266, 21777–21783[Abstract/Free Full Text]
  63. Xie, X., Rivier, A.-S., Zakrzewicz, A., Bernimoulin, M., Zeng, X.-L., Wessel, H. P., Schapira, M., and Spertini, O. (2000) J. Biol. Chem. 275, 34818–34825[Abstract/Free Full Text]
  64. Spertini, O., Kansas, G. S., Reimann, K. A., Mackay, C. R., and Tedder, T. F. (1991) J. Immunol. 147, 942–949[Abstract]
  65. Rees, S., Coote, J., Stables, J., Goodson, S., Harris, S., and Lee, M. G. (1996) BioTechniques 20, 102–110
  66. Jackson, R. J., Howell, M. T., and Kaminski, A. (1990) Trends Biochem. Sci. 15, 477–483[CrossRef][Medline] [Order article via Infotrieve]
  67. Jang, S. K., Krausslich, H. G., Nicklin, M. J., Duke, G. M., Palmenberg, A. C., and Wimmer, E. (1988) J. Virol. 62, 2636–2643[Abstract/Free Full Text]
  68. Ting-Beall, H. P., Needham, D., and Hochmuth, R. M. (1993) Blood 81, 2774–2780[Abstract/Free Full Text]
  69. Hicks, A. E., Nolan, S. L., Ridger, V. C., Hellewell, P. G., and Norman, K. E. (2003) Blood 101, 3249–3256[Abstract/Free Full Text]
  70. Bienvenu, J. G., Tanguay, J. F., Theoret, J. F., Kumar, A., Schaub, R. G., and Merhi, Y. (2001) Circulation 103, 1128–1134[Abstract/Free Full Text]
  71. Liu, W., Ramachandran, V., Kang, J., Kishimoto, T. K., Cummings, R. D., and McEver, R. P. (1998) J. Biol. Chem. 273, 7078–7087[Abstract/Free Full Text]
  72. Leppanen, A., Yago, T., Otto, V. I., McEver, R. P., and Cummings, R. D. (2003) J. Biol. Chem. 278, 26391–26400[Abstract/Free Full Text]
  73. Leppanen, A., Penttila, L., Renkonen, O., McEver, R. P., and Cummings, R. D. (2002) J. Biol. Chem. 277, 39749–39759[Abstract/Free Full Text]
  74. Lowe, B., Stoolman, L. M., Rajan, P. N., Larsen, R. D., Berhend, T. L., and Marks, R. M. (1990) Cell 63, 475–484[CrossRef][Medline] [Order article via Infotrieve]
  75. Mitoma, J., Petryniak, B., Hiraoka, N., Yeh, J. C., Lowe, J. B., and Fukuda, M. (2003) J. Biol. Chem. 278, 9953–9961[Abstract/Free Full Text]
  76. Homeister, J. W., Daugherty, A., and Lowe, J. B. (2004) Arterioscler. Thromb. Vasc. Biol. 24, 1897–1903[Abstract/Free Full Text]
  77. Luhn, K., Wild, M. K., Eckhardt, M., Gerardy-Schahn, R., and Vestweber, D. (2001) Nat. Genet. 28, 69–72[CrossRef][Medline] [Order article via Infotrieve]
  78. Lubke, T., Marquardt, T., Etzioni, A., Hartmann, E., von Figura, K., and Korner, C. (2001) Nat. Genet. 28, 73–76[CrossRef][Medline] [Order article via Infotrieve]
  79. Etzioni, A., Frydman, M., Pollack, S., Avidor, I., Phillips, M. L., Paulson, J. C., and Gershoni-Baruch, R. (1992) N. Engl. J. Med. 327, 1789–1792[Medline] [Order article via Infotrieve]
  80. Marquardt, T., Brune, T., Luhn, K., Zimmer, K. P., Korner, C., Fabritz, L., van der Werft, N., Vormoor, J., Freeze, H. H., Louwen, F., Biermann, B., Harms, E., von Figura, K., Vestweber, D., and Koch, H. G. (1999) J. Pediatr. 134, 681–688[CrossRef][Medline] [Order article via Infotrieve]
  81. Takada, M., Nadeau, K. C., Shaw, G. D., Marquette, K. A., and Tilney, N. L. (1997) J. Clin. Investig. 99, 2682–2690[Medline] [Order article via Infotrieve]
  82. Eppihimer, M. J., and Schaub, R. G. (2001) Microcirculation 8, 15–24[CrossRef][Medline] [Order article via Infotrieve]
  83. Hayward, R., Campbell, B., Shin, Y. K., Scalia, R., and Lefer, A. M. (1999) Cardiovasc. Res. 41, 65–76[Abstract/Free Full Text]
  84. Phillips, J. W., Barringhaus, K. G., Sanders, J. M., Hesselbacher, S. E., Czarnik, A. C., Manka, D., Vestweber, D., Ley, K., and Sarembock, I. J. (2003) Circulation 107, 2244–2249[Abstract/Free Full Text]
  85. Kumar, A., Villani, M. P., Patel, U. K., Keith, J. C., and Schaub, R. G. (1999) Circulation 99, 1363–1369[Abstract/Free Full Text]
  86. Austrup, F., Vestweber, D., Borges, E., Lohning, M., Brauer, R., Herz, U., Renz, H., Hallmann, R., Scheffold, A., Radbruch, A., and Hamann, A. (1997) Nature 385, 81–83[CrossRef][Medline] [Order article via Infotrieve]
  87. Hirata, T., Furie, B. C., and Furie, B. (2002) J. Immunol. 169, 4307–4313[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Immunol.Home page
W. W. S. Kum, S. Lee, G. A. Grassl, R. Bidshahri, K. Hsu, H. J. Ziltener, and B. B. Finlay
Lack of Functional P-Selectin Ligand Exacerbates Salmonella Serovar Typhimurium Infection
J. Immunol., May 15, 2009; 182(10): 6550 - 6561.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. Tauxe, X. Xie, M. Joffraud, M. Martinez, M. Schapira, and O. Spertini
P-selectin Glycoprotein Ligand-1 Decameric Repeats Regulate Selectin-dependent Rolling under Flow Conditions
J. Biol. Chem., October 17, 2008; 283(42): 28536 - 28545.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. C. Kerr, C. B. Fieger, K. R. Snapp, and S. D. Rosen
Endoglycan, a Member of the CD34 Family of Sialomucins, Is a Ligand for the Vascular Selectins
J. Immunol., July 15, 2008; 181(2): 1480 - 1490.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
J. Shin, S. Monti, D. J. Aires, M. Duvic, T. Golub, D. A. Jones, and T. S. Kupper
Lesional gene expression profiling in cutaneous T-cell lymphoma reveals natural clusters associated with disease outcome
Blood, October 15, 2007; 110(8): 3015 - 3027.
[Abstract] [Full Text] [PDF]

Home page
 Br J AnaesthHome page
C. C. McGown and Z. L. S. Brookes
Beneficial effects of statins on the microcirculation during sepsis: the role of nitric oxide
Br. J. Anaesth., February 1, 2007; 98(2): 163 - 175.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
C. Abbal, M. Lambelet, D. Bertaggia, C. Gerbex, M. Martinez, A. Arcaro, M. Schapira, and O. Spertini
Lipid raft adhesion receptors and Syk regulate selectin-dependent rolling under flow conditions
Blood, November 15, 2006; 108(10): 3352 - 3359.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An addition or correction has been published
Right arrow All Versions of this Article:
280/7/5378    most recent
M410899200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martinez, M.
Right arrow Articles by Spertini, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martinez, M.
Right arrow Articles by Spertini, O.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement