JBC PeproTech; Our Business is Cytokines!

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M411473200 on December 7, 2004

J. Biol. Chem., Vol. 280, Issue 9, 7427-7434, March 4, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/9/7427    most recent
M411473200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, J.
Right arrow Articles by Westin, S. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, J.
Right arrow Articles by Westin, S. K.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Regulation of Complement C3 Expression by the Bile Acid Receptor FXR*

Jiali Li{ddagger}, Parinaz C. Pircher{ddagger}, Ira G. Schulman, and Stefan K. Westin§

From the Department of Biology, X-Ceptor Therapeutics Inc., San Diego, California 92121

Received for publication, October 7, 2004 , and in revised form, December 2, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The farnesoid X receptor (FXR; NR1H4) is an intracellular bile acid-sensing transcription factor that plays a critical role in the regulation of synthesis and transport of bile acids as well as lipid metabolism. Although the reciprocal relationship between bile acid and triglyceride levels is well known, the mechanism underlying this link is not clearly defined. In this study, we demonstrate that FXR regulates the expression of at least two secreted factors, complement component C3 and FGF15, the rat ortholog of FGF19, known to influence lipid metabolism. The analysis of the human complement C3 gene reveals the presence of functional FXR response elements in the proximal promoter of C3. Furthermore, rats given a single dose of an FXR agonist exhibit an increase in the plasma concentration of complement C3 protein. These studies demonstrate a mechanism by which FXR, a nuclear receptor with a limited tissue expression pattern, regulates secretion of factors that ultimately can affect lipid metabolism in an endocrine or paracrine manner.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Nuclear hormone receptors comprise a superfamily of transcription factors that is usually activated by small lipophilic ligands (1). These receptors bind to specific cis-acting elements in their target genes influencing development, differentiation, and physiological homeostasis (2). The nuclear receptor superfamily can be divided into three categories. The first category includes the classical steroid hormone receptors activated by high affinity ligands. The second group includes true orphan receptors for which no physiological ligand has been discovered. The third category corresponds to receptors such as peroxisome proliferator-activated receptors, liver X receptors, farnesoid X receptor (FXR),1 steroid xenobiotic receptor/pregnane X receptor, and constitutive androstane receptor. These receptors are activated by dietary low-affinity ligands and have recently been defined as metabolic sensors (3).

FXR (NR1H4) is a nuclear receptor that is bound and activated by specific bile acids at physiological concentrations (4–6). FXR controls bile acid concentrations in the liver by inhibiting the expression of CYP7A1 encoding cholesterol 7-{alpha}-hydroxylase, the rate-limiting enzyme in bile acid synthesis, and Na(+)/taurocholate cotransporting peptide, a transporter responsible for bile acid uptake. Additionally, FXR induces the expression of the bile salt export pump (BSEP). Together these changes in gene expression result in a net efflux of bile acids from the hepatocyte into bile (7–9). Furthermore, FXR controls the accumulation of toxic bile acids by inducing bile acid-amino acid conjugation and the conversion of hydrophobic bile acids into more hydrophilic less toxic glucuronide derivates (10, 11).

The recent identification of bile acids as physiological ligands for FXR may explain studies performed more than 20 years ago in which chenodeoxycholate (3{alpha},7{alpha}-dihydroxy-5{beta}-cholanic acid) (CDCA) given to patients with gallstones lowered plasma triglycerides (12, 13). In addition, bile acid-binding resins are known to induce the production of very low density lipoprotein triglycerides underscoring the importance of bile acids in maintaining triglyceride homeostasis (14). The demonstration that plasma triglycerides are elevated in FXR knock-out mice and that a synthetic FXR agonist causes a 50% reduction in triglycerides in rats clearly establish a role for FXR in lipid metabolism (15–17). Furthermore, the induction of apolipoprotein CII and the simultaneous repression of apolipoprotein CIII in the liver by FXR ligands represent an important pathway for the clearance of plasma triglycerides (18, 19). Nevertheless, the expression of apoCII and apoCIII is not significantly altered in FXR knock-out mice, suggesting that FXR may utilize multiple mechanisms to regulate plasma triglyceride levels. For instance, recent evidence suggests that FXR can regulate fattyacid synthesis through an indirect mechanism involving SHP, liver X receptor, and sterol regulatory element-binding protein-1C (20). Similarly, the identification of FGF19, a known regulator of metabolic rate, as an FXR target gene suggests that FXR may indirectly regulate lipid metabolism by controlling the expression of secreted factors (21). Interestingly, lipids in the form of polyunsaturated fatty acids may in fact be endogenous FXR ligands and thus may act to limit their own synthesis (22).

Here we report that complement C3 (C3) and fgf15, the mouse ortholog of FGF19 (23), are direct FXR target genes. C3 in addition to its role in innate immunity is a precursor for acylation stimulating protein (ASP) (24). Produced by adipocytes in response to a fat-containing meal, ASP acts in a paracrine fashion to increase fatty acid uptake and triglyceride synthesis. The identification of C3 as an FXR target gene suggests a previously unknown link between FXR and complement activation and further supports a described previously link among complement activation, lipid metabolism, and atherosclerosis.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Cultures—Fao (a designated rat hepatoma cell derived from rat H4IIE cells), Caco-2, and CV-1 cells were obtained from ATCC and maintained according to its depository. Cells were treated with vehicle (Me2SO) or the following FXR ligands: 100 µM 3{alpha},7{alpha}-dihydroxy-5{beta}-cholanic acid (CDCA) and 1 µM 3-(2,6-dichlorophenyl)-4-(3'-carboxy-2-chloro-stilben-4-yl)oxymethyl-5-isopropyl-isoxazole (GW4064) (17). After 20 h, total RNA was isolated from the FAO and Caco-2 cells.

RNA Isolation and mRNA Quantitation—Total RNA was isolated from rat and mouse liver, intestinal mucosa, mouse white adipocyte tissue (WAT), Fao, and Caco-2 cells using TRIzol reagent (Invitrogen) and further purified by using an RNeasy kit (Qiagen, Valencia, CA). For Northern analysis, total RNA (20 µg) was resolved on a 1% agarose/formaldehyde gel, transferred to nylon membrane, and cross-linked to the membrane with UV-light. cDNA probes were radiolabeled with [{alpha}-32P]dCTP using the Rediprime II labeling kit (Amersham Biosciences). Membranes were hybridized using the Rapid hybridization buffer (Amersham Biosciences), washed according to the manufacturer, and quantified using a Molecular Imager (Bio-Rad).

TaqMan Primers and Probes—Oligonucleotide primers and the probes for mouse complement C3, fgf15, SHP, IBABP, FXR, rat SHP and IBABP and human FGF19 were designed using the Primer Express program and synthesized by Integrated DNA Technologies Inc. The sequences (5'–3') were as follows: C3 (forward primer, AAGCCCAACACCAGCTACATC; probe, 6FAM-ACGTGGGTGGAGCACTGGCCT-TAMRA; and reverse primer; ACTTCTGATCCTGGCATTCTTCT); fgf15 (forward primer, GG-TCGCTCTGAAGACGATTG; probe, 6FAM-CATCAAGGACGTCAGCAG-CGTGC-TAMRA; and reverse primer, CGCGCTCATGCAGAGGTA); FGF19 (forward primer, GGAGGAAGACTGTGCTTTCGA; probe, 6FAM-AGCCATCTGGGCGGATCTCCT-TAMRA; and reverse primer, CTTCT-CGGATCGGTACACATTG; Rat SHP (forward primer, TTGGATTTCCT-CGGTTTGC; probe, 6FAM-CAGTGTTTGACTAADTGTCCAGCAGGCC-TAMRA; and reverse primer, ACCCAGGTAAGGGAAGGCATA); mouse SHP (forward primer, GTACCTGAAGGGCACGATCC; probe, 6FAM-AT-GTGCCAGGCCTCCGTGCC-TAMRA; and reverse primer, AGCCTCCT-GTTGCAGGTGT); rat IBABP (forward primer, CCTTCACCGGCAAAT-ACGA; probe, 6FAM-TTCATGAAGCGCCTGGGTCTTCC-TAMRA; and reverse primer, CGTCCCCTTTCAATCACATCT); mouse IBABP (forward primer, CAGGAGACGTGATTGAAAGGG; probe, 6FAM-CCAGCAGGA-CGGACAGGACTTCACC-TAMRA; and reverse primer, GCCCCCAGAG-TAAGACTGGG); and mouse FXR (forward primer, TCCAGGGTTTCAG-ACACTGG; probe, 6FAM-CCACGAAGATCAGATTGCTTTGCTCAA-TAMRA; and reverse primer, GCCGAACGAAGAAACATGG).

cDNA Probes and Reporter Genes—Rat cDNA for complement C3 was PCR-amplified from reverse-transcribed rat liver mRNA using primers 5'-CGATGATCCTTGACATCTGCACC-3' and 5'-GTGGTGGT-CAGTTGGGGCAGCCG-3' corresponding to nucleotides 4189 –5040 of the rat mRNA. The 850-base pair amplicon was radiolabeled and used as a probe for Northern analysis. Mouse cDNA for fgf15 was PCR-amplified from reverse-transcribed mouse intestinal mucosa mRNA using primers 5'-ATGGCGAGAAAGTGGAACGGGC-3' and 5'-TTTCT-GGAAGCTGGGACTC-3' corresponding to nucleotides 1– 653 of the coding sequence. The 653-base pair amplicon was radiolabeled and used as a probe for Northern analysis. The SHP promoter contains 2 kb of the human promoter and was a gift from Dr. David Moore (Baylor College of Medicine). Human BSEP promoter contains 1.5-kb upstream sequences cloned in pGL3b with primers as described previously (7). Human complement C3 and rodent fgf15 gene sequences were obtained from GenBankTM. A fragment spanning ~500 base pairs of promoter and 5'-flanking sequence of C3 gene was PCR-amplified from human genomic DNA using primers 5'-TTCCCCTCCCTCAGCATGGA-3' and 5'-ACAGAGGGAGAGGATGGGGAGGAGT-3' and cloned into HindIII-XhoI sites of pGL3-basic vector (Promega). Point mutation of the FXRE (IR-1) sequence in the C3 gene was done using the QuikChange mutagenesis kit from Stratagene with the antisense primer (5'-GGGAACA-TGCCCTCAAATTACTCATTCCATGGACATGTTGG-3') and a sense primer (5'-CCAACATGTCCATGGAATGAGTAATTTGAGGGCATGT-TCCC-3') (mutated bases are indicated in boldface) in a PCR according to the manufacturer's directions. All of the oligonucleotides primers were ordered from Integrated DNA Technologies Inc. The sequences of all of the constructs were verified by automated DNA sequencing.

Transient Transfections and Reporter Gene Assays—CV-1 cells were transfected using the FuGENE 6 reagent (Roche Applied Science). 30 ng of reporter plasmid, 10 ng of pCMX-hFXR, 10 ng of pCMX-hRXR{alpha}, and 10 ng of pCMV-{beta}-galactosidase and 0.28 µl of FuGENE 6 were used in a final volume of 10 µl. After a 15-min incubation at room temperature, the mixture was added to cells in 96-well plates and incubated for 5 h at 37 °C. The cells were then treated with medium containing 10% charcoal/dextran-stripped fetal bovine serum and vehicle (Me2SO) or one of the following ligands: 100 µM CDCA or 1 µM GW4064. After 20 h, cells were lysed and assayed for luciferase and {beta}-galactosidase activities. The normalized luciferase units were determined by dividing the luciferase activity by the {beta}-galactosidase activity.

Electrophoretic Mobility Shift Assays—Core sequences of C3 and fgf15 IR-1s are shown in Fig. 2A. Annealed double-stranded oligonucleotides were radiolabeled with [{alpha}-32P]dCTP using the Klenow fragment of DNA polymerase II. hFXR and hRXR{alpha} were synthesized from pCMX-FXR and pCMX-RXR{alpha} expression vectors using the TNT T7 Coupled reticulocyte system (Promega, Madison WI). Binding reactions contained 20 mM Hepes, pH 7.2, 75 mM KCl, 2 mM dithiothreitol, 0.2% Nonidet P-40, 15% glycerol, 1 µg of poly(dI-dC)·poly(dI-dC), 3 µl each of synthesized receptor protein, and 0.05 pmol of 32P-labeled double-stranded oligonucleotide. Competitor oligonucleotides were added at a 2.5–100-fold molar excess. The oligonucleotides used as follows: for the C3 IR-1, 5'-CACAAGCTTCCCTCAGGTTACTCACCCCATGGA-3'; for mouse fgf15 IR-1, 5'-AGCTTCTGCAGTTCAATGACCTCTG-3'; and for rat fgf15 IR-1, 5'-AGCTTCTGCAGGTCAGTGACCTCGG-3' (only one strand is shown, and the IR-1 is indicated in boldface). The oligonucleotides for human SHP and BSEP IR-1s were as described previously (1, 2).



View larger version (46K):
[in this window]
[in a new window]
  		FIG. 2.
Identification of FXRE in the human C3 and rodent fgf15 genes. A, comparison of FXR response elements from human, rat, and mouse C3 and FGF19/15 genes to an IR-1 found in the mouse IBABP gene and an idealized IR-1 consensus sequence. B, putative FXREs from the C3 and fgf15 genes bind FXR-RXR heterodimers. C, affinity comparison of FXR-RXR binding to C3 and SHP IR-1s. Only the C3 IR-1 electrophoretic mobility shift assay is shown on the left. Calculated IC50 for C3 IR-1 competed with unlabeled C3 (square) or SHP (triangle) or SHP IR-1 competed with unlabeled C3 (circle) are shown below graph to the right. D, EMSA comparing binding of FXR-RXR binding to BSEP and C3 IR-1s. E, calculated IC50 values for competition with unlabeled IR-1s from BSEP (square) or C3 (triangle). Electrophoretic mobility shift assays were performed using in vitro translated FXR-RXR proteins and radiolabeled IR-1s as outlined under "Experimental Procedures." Competitions were done using unlabeled oligonucleotides at 2.5–100-fold molar excess as indicated.

 
Western Blots—Plasma from rats (1 µg) was denatured by boiling in SDS-loading dye and run on an SDS-acrylamide gel, and proteins were blotted to a nylon membrane. The blot was incubated with a polyclonal antibody made against the C3a protein (Santa Cruz Biotechnology, Inc.) and then developed using a secondary antibody conjugated with horse-radish peroxidase.

Animal Studies—Animal care and experiments were conducted according to National Institutes of Health Guide for the Care and Use of Laboratory Animals. Male F344/NHsd rats and male C57BL/6 mice were fed ad libitum and were kept under standard light/dark cycle. The GW4064 compound was suspended in 0.5% carboxymethyl cellulose vehicle for a dosing volume of 1 ml for rats and 0.1 ml for mice. Animals were given a single dose with a feeding needle to give a final concentration of 100 mg/kg. The animals were sacrificed 8 h following the dose, and liver, small intestinal, and epididymal fat tissues were excised. The intestinal mucosa scraped from the lower 30% small intestine were frozen in liquid nitrogen and kept at –80 °C until RNA preparation. Liver and intestinal mucosa collected from FXR null mice (3) back-crossed more than four generations into C57BL/6 mice, and age-matched wild type C57BL/6 mice was a kind gift from Dr. David Moore.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Induction of Complement C3 and FGF19 by FXR Agonists—An analysis of microarray data from rat primary hepatocytes indicates that the gene encoding C3 is induced by both natural (CDCA) and synthetic FXR (GW4064) agonists (10). The induction of C3 was confirmed by Northern analysis in Fao, a rat hepatoma cell line (Fig. 1A), and in Caco-2, a human colorectal adenocarcinoma expressing FXR (Fig. 1B). The regulation of C3 in intestinal cells was unexpected, because the liver is considered the predominant site of expression. Therefore, we examined whether FGF19, another secreted factor previously identified to be a FXR target gene in hepatocytes (21), is also regulated in Caco-2 cells. As shown in Fig. 1C, FGF19 is significantly induced by FXR ligands in these cells, suggesting that FXR activity in the intestine may influence lipid metabolism by promoting the synthesis and secretion of these factors.



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 1.
FXR-dependent induction of complement C3 and FGF19 mRNA. FXR ligands induce C3 mRNA levels in FAO rat hepatoma cells (A) Caco-2 human colorectal adenocarcinoma cells (B). C, FGF19 mRNA levels were induced by GW4064 in Caco-2 cells. Cells were cultured as described under "Experimental Procedures" and treated with FXR ligands GW4064 (1 µM) and CDCA (100 µM) for 20 h. For Northern analysis, 20 µg of total RNA was loaded in each lane. After blotting, the filters were hybridized with radiolabeled C3 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA. Quantitative RT-PCR was performed on duplicate wells as outlined under "Experimental Procedures."

 
Identification of FXREs in Human Complement C3 and Rodent fgf15 Genes—The strong induction of C3 mRNA by GW4064 and CDCA suggests that this gene is a direct target of FXR activation. A search for FXR-responsive elements similar to an inverted repeat of the consensus sequence AGGTCA spaced by one nucleotide (IR-1) revealed a potential element located ~150 base pairs upstream of the transcriptional start site in the human C3 gene (Fig. 2A). This IR-1 sequence, as well as the location, is conserved in rat and mouse C3 genes. fgf15 has been suggested to be the mouse ortholog of human FGF19 despite the relatively low homology (51% amino acid identity). Nonetheless, rat and mouse fgf15 contain IR-1 sites in intron 2, a similar location that was reported for human FGF19 (Fig. 2A).

To demonstrate that FXR-RXR heterodimers directly bind the IR-1s identified in the proximal human C3 and in the rodent fgf15 genes, electrophoretic mobility shift assays were performed. Radiolabeled DNA fragments corresponding to the putative IR-1s from the human C3 and fgf15 (Fig. 2A) genes were prepared and examined for ability to bind FXR-RXR heterodimers. When added together, a significant FXR-RXR complex is formed on the C3 and fgf15 IR-1s that is not detected with either receptor alone. Additionally, binding is competed by an excess of their respective unlabeled IR-1 oligonucleotides (Fig. 2B). More detailed binding affinity studies revealed that FXR-RXR heterodimers bind to the SHP IR-1 with ~4 –5-fold higher affinity compared with the C3 IR-1 as evidenced by a lower IC50 value of the SHP IR-1 competing for binding to the C3 IR-1 (Fig. 2C). On the other hand, FXR-RXR binding affinities are similar on the IR-1s for C3 and BSEP (Fig. 2, D and E).

Chimeric human C3-luciferase reporter gene constructs were made, and the ability of FXR to transactivate luciferase expression was tested by transient transfections into CV-1 cells. The 450-base pair upstream sequences from the human C3 gene confer FXR responsiveness indicated by the increase in luciferase activity when cells are treated with CDCA and GW4064 ligands in the presence of co-transfected FXR and RXR (Fig. 3A). The maximal transcriptional activity mediated by FXR appears equal when comparing C3 to the known FXR target genes BSEP and SHP despite a higher FXR-RXR binding affinity on the SHP IR-1. However, the fold induction of the C3 promoter by FXR ligands is lower compared with the fold activation of BSEP and SHP because of higher basal activity of the C3 promoter. Mutation of the putative FXRE abolishes FXR activity but not the basal activity of the C3 promoter (Fig. 3B).



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 3.
FXR-response is mediated through putative IR-1 elements in the human C3 gene. A, the C3 IR-1 is a functional FXRE in the context of the native C3 gene. Comparison of FXR transcriptional activity on C3, BSEP, and SHP promoters. B, mutation of putative IR-1 in the human C3 promoter abolishes FXR activity. CV-1 cells were transfected with wild type or mutated C3, BSEP, or SHP reporter genes with or without pCMX-RXR{alpha}, pCMX-FXR, and pCMV-{beta}-galactosidase and treated with FXR ligands GW4064 (1 µM) and CDCA (100 µM) for 20 h. The results were normalized to {beta}-galactosidase activity and expressed as relative light units (RLU) and represent the mean ± S.D. of triplicate determinations. Transfections were performed at least three times, and one representative experiment is shown.

 
Regulation of Complement C3 and fgf15 Levels in Vivo—To determine whether FXR regulates C3 expression in vivo, C3 mRNA levels were compared in FXR+/+ and FXR–/– mice. In the intestine, deletion of FXR resulted in decreased levels of C3 mRNA (Fig. 4A). Although there is a trend for reduced levels of C3 mRNA in the liver of FXR–/– mice, expression levels were not significantly different from FXR+/+ mice (Fig. 4B). The relatively high levels of C3 expression in the liver, >100 times the level in the intestine, may make it difficult to detect an effect of deleting FXR. In C57Bl/6 mice treated with a single dose of GW4064, an ~2-fold induction of C3 mRNA was observed in intestinal mucosa, whereas a small but significant induction was again observed in the liver of these animals (Fig. 4, C and D). The basal expression of C3 mRNA in WAT, the target tissue for ASP (the cleaved product of C3), was also high compared with the intestine, but a significant increase in C3 mRNA expression was seen in response to GW4064 (Fig. 4E). The relatively low expression level of FXR mRNA in WAT compared with the liver and ileum may account for the modest increase in this tissue (Fig. 4F). Thus, a combination of genetic deletion and pharmacological activation of FXR identifies C3 as a target gene in vivo. Although expression levels did not differ significantly between FXR+/+ and FXR–/– mice (data not shown), fgf15 mRNA levels were dramatically increased by GW4064 in the intestine (Fig. 4G). Even though mouse fgf15 was suggested to be the ortholog of FGF19, it was not expressed in the liver (data not shown). The two established target genes SHP and IBABP were induced in liver and intestine, respectively, confirming significant exposure of GW4064 in these tissues (Fig. 4, H and I).



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 4.
FXR-dependent regulation of complement C3 and fgf15 in FXR knock-out and wild type mice. Total RNA was prepared from intestinal mucosa (A) and liver of FXR null mice (B), and mRNA levels of C3 were determined by quantitative RT-PCR. C57Bl/6 mice were given a single dose of GW4064 as described under "Experimental Procedures," and mRNA levels of C3 in intestinal mucosa (C), C3 in liver (D), C3 in WAT (E), FXR in liver, ileum, and WAT (F), fgf15 in intestinal mucosa (G), IBABP in intestinal mucosa (H), and SHP in the liver (I) were determined by quantitative RT-PCR. Data are the mean ± S.E. of 3– 4 mice/group. *, p < 0.05 (n = 3); **, p < 0.05 (n = 4); and ***, p < 0.001 in comparison with vehicle-treated animals.

 
Northern analysis also shows a robust induction of C3 and fgf15 mRNA expression in the intestine of rats that was given a single dose of GW4064 (Fig. 5A). The major source of C3 in plasma is traditionally believed to be the liver, although secretion from other tissues has been implicated (25). As was seen in mice, rat liver C3 levels were only modestly increased by an FXR ligand, presumably because of already high basal mRNA expression levels in this tissue (data not shown). Regardless of the source of C3, plasma levels were dramatically increased in rats treated with the FXR agonist GW4064 (Fig. 5B). As seen in mice, GW4064 increased SHP and IBABP mRNA levels in the liver and intestine, respectively (Fig. 5, C and D). Taken together, these data suggest that regulation of C3 in the intestine may indirectly influence lipid metabolism at other peripheral sites.



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 5.
Complement C3 and fgf15 mRNA and C3 plasma levels are increased by an FXR ligand in rats. Rats were given a single dose of vehicle (lanes 1–3) or GW4064 (lanes 4 – 6) as described under "Experimental Procedures." A, total RNA was prepared from intestinal mucosa, and 20 µg was loaded in each lane. After blotting, the filter was hybridized with the indicated radiolabeled cDNAs. B, plasma C3 levels were determined by Western blotting using a human C3a polyclonal antibody. C and D, IBABP and SHP in intestinal mucosa and the liver, respectively, were determined by quantitative RT-PCR. Data are the mean ± S.E. of 3– 4 rats/group. *, p < 0.05 (n = 4); **, p < 0.005 (n = 4) in comparison with vehicle-treated animals.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
In this study, we have identified complement C3 as a novel FXR target gene. Our results showed that C3 is induced in cell lines of hepatic and intestinal origin and that regulation of C3 by FXR occurs predominantly in the small intestine in vivo. Regulation of C3 was also observed in WAT; however, the observation that FXR mRNA levels are 50 –100-fold less in this tissue relative to liver and intestine (Fig. 4F) (26) may contribute to the relatively modest change seen with GW4064. High basal levels of hepatic and adipocyte C3 expression, perhaps resulting from tissue specific factors and/or endogenous fatty acid-derived FXR ligands (22), may also make it difficult to detect an effect of synthetic ligands in these tissues. We showed that the human and rodent C3 genes contain FXREs reminiscent of a an IR-1 sequence, that FXR-RXR heterodimers bind to this sequence, and that mutating the binding site abolishes FXR responsiveness of a C3 promoter-reporter construct. Likewise, the genes encoding mouse and rat fgf15 hold IR-1 elements at an almost identical position as the human FGF19 gene. Mice disrupted of FXR showed decreased expression of C3 in the intestine, confirming the importance of this nuclear receptor for regulation of C3. Finally, C3 and fgf15 mRNA levels were increased in response to the FXR agonist GW4064 in intestinal mucosa of mice and rats and C3 protein levels were increased in plasma of rats. The antibody to C3 used in these studies cannot unambiguously detect mouse C3; therefore, additional studies will be needed to determine whether FXR agonists increase plasma C3 levels in mice and whether FGF15 is secreted into plasma.

Taken together, our results establish that FXR directly regulates the genes encoding for C3 and fgf15 and also point to an important function of the intestine as a site of expression. Furthermore, the induction of human FGF19 in the colon-derived Caco-2 cell line similarly suggests the intestine as a site of expression for this factor. The question arising from these studies is whether activation of target genes and ultimately secretion of factors from the intestine play a role in the triglyceride-lowering activity of FXR ligands. FGF19 transgenic mice displayed increased metabolic rate and decreased adiposity (27). Importantly, although a muscle specific promoter (myosin light chain) was used to create the FGF19 transgenic animals, the major target tissue for FGF19 is believed to be the liver. This finding suggests that, in the transgenic mice, FGF19 is produced in muscle and secreted to its target tissue. The mouse counterpart of FGF19, fgf15, was induced by FXR in the intestine rather than in the liver. Although further studies are needed to establish whether fgf15 exerts similar functions as FGF19, our studies suggest that, in addition to C3, FXR regulates production of fgf15.

Studies have shown that, in adipose tissue, C3 is converted to C3a by the action of factors B and D (adipsin) and subsequently is des-arginated by carboxypeptidase N to yield C3adesArg, which is identical to ASP. ASP acts in a paracrine fashion to increase free fatty acid uptake and triglyceride synthesis in the adipocyte (24). Although C3 mRNA and protein levels are robustly increased by FXR, we found no evidence of an increase in plasma ASP after administration of the FXR ligand GW4064 in either mice or rats. The reason for this discrepancy may be that ASP is produced by cleavage of C3 locally in the adipose tissue, making it difficult to detect an increase in plasma ASP. Furthermore, in humans, the concentration of ASP in plasma is over 200-fold less than C3 (24). Apparently, only a relatively small fraction of C3 is converted to ASP in circulation and may be difficult to detect. On the same note, whereas the primary site of ASP production is believed to be in adipose tissue, the source of cleaved ASP may be derived from C3 synthesis in other tissues. Although it has traditionally been assumed that the liver is the primary site of synthesis for C3 (28), our results show FXR-dependent induction of C3 mRNA predominantly in the small intestine. Although an increase in plasma C3 protein and mRNA does not necessarily reflect the functional activity of ASP, it is tempting to speculate that an up-regulation of C3 expression leads to increased fatty acid uptake in the adipocyte. Hence, the reduction of plasma triglyceride levels by FXR ligands may in part be the consequence of increased fatty acid uptake and triglyceride storage in adipose tissue.

Mice lacking C3, thus also deficient in ASP, have delayed postprandial triglyceride clearance that can be normalized by administration of recombinant ASP (29). Although these mice lack both C3 and ASP, there is no evidence to suggest that intact C3 plays a direct role in lipid metabolism or fat storage. Nevertheless, serum concentrations of C3 have been associated with serum lipid and insulin levels (30–32). Patients with familial combined hyperlipidemia have elevated serum C3 but not ASP (33). These patients have, in addition to hyperlipidemia, metabolic abnormalities including prolonged postprandial lipemia with an excess of free fatty acids in serum. Although still controversial, increased C3 levels in familial combined hyperlipidemia may indicate a dysfunctional ASP signaling pathway in these patients. A blunted response due to impaired C3 cleavage and consequently impaired peripheral fatty acid uptake may explain the increased hepatic free fattyacid flux and very low density lipoprotein overproduction in familial combined hyperlipidemia.

The influence of complement activation on the development of atherosclerosis has also been explored. It is well known that atherosclerosis is associated with an inflammatory response to the accumulation of subendothelial lipids, and there is evidence that complement activation is involved in atheroma formation (34). Complement components have been identified in the walls of diseased vessels, and mRNAs of complement factors are expressed in atherosclerotic plaques (35–38). When C3 deficient mice were crossed with ldlr–/– mice and challenged with high fat diet, a greater lesion size in the ldlr–/–C3–/– compared with ldlr–/–C3–/+ mice was measured (39). C3-deficient mice crossed with mice deficient in both ldlr and apoe, have a lesion area that is 84% higher compared with apoe–/–ldlr–/– mice (40). The C3-deficient mice in an apoe–/–ldlr–/– background also had a more atherogenic lipoprotein profile than controls with elevated serum triglyceride levels and increased very low density lipoprotein triglycerides and LDL cholesterol. These results suggest that complement activation exerts atheroprotective effects through the regulation of lipid metabolism and also suggests that FXR ligands may be useful for the treatment of atherosclerosis.

In conclusion, FXR regulates complement component C3, a key factor in the alternative pathway of complement activation and fgf15, the mouse ortholog of human FGF19 through a direct mechanism at the transcriptional level. The activation of C3, a precursor of ASP, and fgf15 in the intestine may have profound effects on lipid metabolism and may in part explain the hypolipidemic effects of FXR ligands.


   FOOTNOTES
 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} Both authors contributed equally to this work. Back

§ To whom correspondence should be addressed: Dept. of Biology, X-Ceptor Therapeutics, 4757 Nexus Centre Dr., San Diego, CA 92121. Tel.: 858-458-4522; Fax: 858-458-4501; E-mail: swestin{at}x-ceptor.com.

1 The abbreviations used are: FXR, farnesoid X receptor; BSEP, bile salt export pump; CDCA, 3{alpha},7{alpha}-dihydroxy-5{beta}-cholanic acid; C3, complement C3; ASP, acylation stimulating protein; WAT, white adipocyte tissue; RT, reverse transcription; SHP, small heterodimer partner; IBABP, ileal bile acid-binding protein; 6FAM, 6-carboxyfluorescein; TAMRA, carboxytetramethylrhodamine; FXRE, farnesoid X receptor element; LDLR, low density lipoprotein receptor. Back


   ACKNOWLEDGMENTS
 
We thank Drs. Richard Martin and Jeff Kahl for the chemical synthesis of GW4064, Mary Petrowski and Amy Liu for Q-PCR assays, and Eric Bischoff, Chris Daige, and Calvin Vu for help with animal studies.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Nuclear Receptor Nomenclature Committee. (1999) Cell 97, 161–163[CrossRef][Medline] [Order article via Infotrieve]
  2. Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P., and Evans, R. M. (1995) Cell 83, 835– 839[CrossRef][Medline] [Order article via Infotrieve]
  3. Chawla, A., Repa, J. J., Evans, R. M., and Mangelsdorf, D. J. (2001) Science 294, 1866 –1870[Abstract/Free Full Text]
  4. Makishima, M., Okamoto, A. Y., Repa, J. J., Tu, H., Learned, R. M., Luk, A., Hull, M. V., Lustig, K. D., Mangelsdorf, D. J., and Shan, B. (1999) Science 284, 1362–1365[Abstract/Free Full Text]
  5. Parks, D. J., Blanchard, S. G., Bledsoe, R. K., Chandra, G., Consler, T. G., Kliewer, S. A., Stimmel, J. B., Willson, T. M., Zavacki, A. M., Moore, D. D., and Lehmann, J. M. (1999) Science 284, 1365–1368[Abstract/Free Full Text]
  6. Wang, H., Chen, J., Hollister, K., Sowers, L. C., and Forman, B. M. (1999) Mol. Cell 3, 543–553[Medline] [Order article via Infotrieve]
  7. Ananthanarayanan, M., Balasubramanian, N., Makishima, M., Mangelsdorf, D. J., and Suchy, F. J. (2001) J. Biol. Chem. 276, 28857–28865[Abstract/Free Full Text]
  8. Goodwin, B., Jones, S. A., Price, R. R., Watson, M. A., McKee, D. D., Moore, L. B., Galardi, C., Wilson, J. G., Lewis, M. C., Roth, M. E., Maloney, P. R., Willson, T. M., and Kliewer, S. A. (2000) Mol. Cell 6, 517–526[CrossRef][Medline] [Order article via Infotrieve]
  9. Lu, T. T., Makishima, M., Repa, J. J., Schoonjans, K., Kerr, T. A., Auwerx, J., and Mangelsdorf, D. J. (2000) Mol. Cell 6, 507–515[CrossRef][Medline] [Order article via Infotrieve]
  10. Pircher, P. C., Kitto, J. L., Petrowski, M. L., Tangirala, R. K., Bischoff, E. D., Schulman, I. G., and Westin, S. K. (2003) J. Biol. Chem. 278, 27703–27711[Abstract/Free Full Text]
  11. Barbier, O., Torra, I. P., Sirvent, A., Claudel, T., Blanquart, C., Duran-Sandoval, D., Kuipers, F., Kosykh, V., Fruchart, J. C., and Staels, B. (2003) Gastroenterology 124, 1926 –1940[CrossRef][Medline] [Order article via Infotrieve]
  12. Bateson, M. C., Maclean, D., Evans, J. R., and Bouchier, I. A. (1978) Br. J. Clin. Pharmacol. 5, 249 –254[Medline] [Order article via Infotrieve]
  13. Iser, J. H., and Sali, A. (1981) Drugs 21, 90 –119[Medline] [Order article via Infotrieve]
  14. Angelin, B., Einarsson, K., Hellstrom, K., and Leijd, B. (1978) J. Lipid Res. 19, 1017–1024[Abstract]
  15. Sinal, C. J., Tohkin, M., Miyata, M., Ward, J. M., Lambert, G., and Gonzalez, F. J. (2000) Cell 102, 731–744[CrossRef][Medline] [Order article via Infotrieve]
  16. Lambert, G., Amar, M. J., Guo, G., Brewer, H. B., Jr., Gonzalez, F. J., and Sinal, C. J. (2003) J. Biol. Chem. 278, 2563–2570[Abstract/Free Full Text]
  17. Maloney, P. R., Parks, D. J., Haffner, C. D., Fivush, A. M., Chandra, G., Plunket, K. D., Creech, K. L., Moore, L. B., Wilson, J. G., Lewis, M. C., Jones, S. A., and Willson, T. M. (2000) J. Med. Chem. 43, 2971–2974[CrossRef][Medline] [Order article via Infotrieve]
  18. Kast, H. R., Nguyen, C. M., Sinal, C. J., Jones, S. A., Laffitte, B. A., Reue, K., Gonzalez, F. J., Willson, T. M., and Edwards, P. A. (2001) Mol. Endocrinol. 15, 1720 –1728[Abstract/Free Full Text]
  19. Claudel, T., Inoue, Y., Barbier, O., Duran-Sandoval, D., Kosykh, V., Fruchart, J., Fruchart, J. C., Gonzalez, F. J., and Staels, B. (2003) Gastroenterology 125, 544 –555[CrossRef][Medline] [Order article via Infotrieve]
  20. Watanabe, M., Houten, S. M., Wang, L., Moschetta, A., Mangelsdorf, D. J., Heyman, R. A., Moore, D. D., and Auwerx, J. (2004) J. Clin. Investig. 113, 1408 –1418[CrossRef][Medline] [Order article via Infotrieve]
  21. Holt, J. A., Luo, G., Billin, A. N., Bisi, J., McNeill, Y. Y., Kozarsky, K. F., Donahee, M., Wang da, Y., Mansfield, T. A., Kliewer, S. A., Goodwin, B., and Jones, S. A. (2003) Genes Dev. 17, 1581–1591[Abstract/Free Full Text]
  22. Zhao, A., Yu, J., Lew, J. L., Huang, L., Wright, S. D., and Cui, J. (2004) DNA Cell Biol. 23, 519 –526[CrossRef][Medline] [Order article via Infotrieve]
  23. Wright, T. J., Ladher, R., McWhirter, J., Murre, C., Schoenwolf, G. C., and Mansour, S. L. (2004) Dev. Biol. 269, 264 –275[CrossRef][Medline] [Order article via Infotrieve]
  24. Cianflone, K., Xia, Z., and Chen, L. Y. (2003) Biochim. Biophys. Acta 1609, 127–143[Medline] [Order article via Infotrieve]
  25. Barnum, S. R., and Volanakis, J. E. (1989) Year Immunol. 6, 208 –228[Medline] [Order article via Infotrieve]
  26. Zhang, Y., Kast-Woelbern, H. R., and Edwards, P. A. (2003) J. Biol. Chem. 278, 104 –110[Abstract/Free Full Text]
  27. Tomlinson, E., Fu, L., John, L., Hultgren, B., Huang, X., Renz, M., Stephan, J. P., Tsai, S. P., Powell-Braxton, L., French, D., and Stewart, T. A. (2002) Endocrinology 143, 1741–1747[Abstract/Free Full Text]
  28. Alper, C. A., Johnson, A. M., Birtch, A. G., and Moore, F. D. (1969) Science 163, 286 –288[Abstract/Free Full Text]
  29. Murray, I., Sniderman, A. D., and Cianflone, K. (1999) J. Lipid Res. 40, 1671–1676[Abstract/Free Full Text]
  30. Messiha, N., and Watson, R. R. (1989) Life Sci. 44, 49 –55[CrossRef][Medline] [Order article via Infotrieve]
  31. Boggs, R. D., McCumbee, W. D., Cobbs, S. L., Todd, D. G., Kahle, E. B., Stewart, N. L., Bailey, M., and Reichenbecher, V. E. (1998) Obes. Res. 6, 361–367[Medline] [Order article via Infotrieve]
  32. Weyer, C., Tataranni, P. A., and Pratley, R. E. (2000) Diabetes Care 23, 779 –785[Abstract/Free Full Text]
  33. Ylitalo, K., Pajukanta, P., Meri, S., Cantor, R. M., Mero-Matikainen, N., Vakkilainen, J., Nuotio, I., and Taskinen, M. R. (2001) Arterioscler. Thromb. Vasc. Biol. 21, 838 – 843[Abstract/Free Full Text]
  34. Niculescu, F., and Rus, H. (1999) Mol. Immunol. 36, 949 –955[CrossRef][Medline] [Order article via Infotrieve]
  35. Pang, A. S., Katz, A., and Minta, J. O. (1979) J. Immunol. 123, 1117–1122[Abstract/Free Full Text]
  36. Hansson, G. K., Holm, J., and Kral, J. G. (1984) Acta Pathol. Microbiol. Scand. [A] 92, 429 – 435
  37. Vlaicu, R., Rus, H. G., Niculescu, F., and Cristea, A. (1985) Atherosclerosis 55, 35–50[CrossRef][Medline] [Order article via Infotrieve]
  38. Seifert, P. S., Messner, M., Roth, I., and Bhakdi, S. (1991) Atherosclerosis 91, 155–162[CrossRef][Medline] [Order article via Infotrieve]
  39. Buono, C., Come, C. E., Witztum, J. L., Maguire, G. F., Connelly, P. W., Carroll, M., and Lichtman, A. H. (2002) Circulation 105, 3025–3031[Abstract/Free Full Text]
  40. Persson, L., Boren, J., Robertson, A. K., Wallenius, V., Hansson, G. K., and Pekna, M. (2004) Arterioscler. Thromb. Vasc. Biol. 24, 1062–1067[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Endocrinol.Home page
Y.-K. Lee, D. R. Schmidt, C. L. Cummins, M. Choi, L. Peng, Y. Zhang, B. Goodwin, R. E. Hammer, D. J. Mangelsdorf, and S. A. Kliewer
Liver Receptor Homolog-1 Regulates Bile Acid Homeostasis but Is Not Essential for Feedback Regulation of Bile Acid Synthesis
Mol. Endocrinol., June 1, 2008; 22(6): 1345 - 1356.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
R. A. Davis and A. D. Attie
Deletion of the ileal basolateral bile acid transporter identifies the cellular sentinels that regulate the bile acid pool
PNAS, April 1, 2008; 105(13): 4965 - 4966.
[Full Text] [PDF]

Home page
 Pharmacol. Rev.Home page
D. D. Moore, S. Kato, W. Xie, D. J. Mangelsdorf, D. R. Schmidt, R. Xiao, and S. A. Kliewer
International Union of Pharmacology. LXII. The NR1H and NR1I Receptors: Constitutive Androstane Receptor, Pregnene X Receptor, Farnesoid X Receptor {alpha}, Farnesoid X Receptor beta, Liver X Receptor {alpha}, Liver X Receptor beta, and Vitamin D Receptor
Pharmacol. Rev., December 1, 2006; 58(4): 742 - 759.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
G. Rizzo, M. Disante, A. Mencarelli, B. Renga, A. Gioiello, R. Pellicciari, and S. Fiorucci
The Farnesoid X Receptor Promotes Adipocyte Differentiation and Regulates Adipose Cell Function in Vivo
Mol. Pharmacol., October 1, 2006; 70(4): 1164 - 1173.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B. Cariou, K. van Harmelen, D. Duran-Sandoval, T. H. van Dijk, A. Grefhorst, M. Abdelkarim, S. Caron, G. Torpier, J.-C. Fruchart, F. J Gonzalez, et al.
The Farnesoid X Receptor Modulates Adiposity and Peripheral Insulin Sensitivity in Mice
J. Biol. Chem., April 21, 2006; 281(16): 11039 - 11049.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
T. Inagaki, A. Moschetta, Y.-K. Lee, L. Peng, G. Zhao, M. Downes, R. T. Yu, J. M. Shelton, J. A. Richardson, J. J. Repa, et al.
Regulation of antibacterial defense in the small intestine by the nuclear bile acid receptor
PNAS, March 7, 2006; 103(10): 3920 - 3925.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
H. Lee, Y. Zhang, F. Y. Lee, S. F. Nelson, F. J. Gonzalez, and P. A. Edwards
FXR regulates organic solute transporters {alpha} and {alpha} in the adrenal gland, kidney, and intestine
J. Lipid Res., January 1, 2006; 47(1): 201 - 214.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/9/7427    most recent
M411473200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, J.
Right arrow Articles by Westin, S. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, J.
Right arrow Articles by Westin, S. K.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS