Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M408799200 on December 23, 2004

J. Biol. Chem., Vol. 280, Issue 9, 7469-7476, March 4, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/9/7469    most recent
M408799200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nakamura, Y.
Right arrow Articles by Ohta, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakamura, Y.
Right arrow Articles by Ohta, H.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A Novel Phosphatidylcholine-hydrolyzing Phospholipase C Induced by Phosphate Starvation in Arabidopsis*

Yuki Nakamura{ddagger}§, Koichiro Awai{ddagger}||, Tatsuru Masuda{ddagger}**, Yasushi Yoshioka{ddagger}{ddagger}, Ken-ichiro Takamiya{ddagger}, and Hiroyuki Ohta{ddagger}§§

From the {ddagger}Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, 4259-B-14 Nagatsuta-cho, Midori-ku, Yokohama, 226-8501, Japan, the Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, Michigan, 48824, and the {ddagger}{ddagger}Graduate School of Science, Nagoya University, Furo-cho, Chikusa-ku, Nagoya, 464-8602, Japan

Received for publication, August 2, 2004 , and in revised form, December 21, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
During phosphate starvation, it is known that phospholipids are degraded, and conversely, a nonphosphorus galactolipid digalactosyldiacylglycerol accumulates in the root plasma membrane of plants. We report a novel phospholipase C that hydrolyzes phosphatidylcholine and is greatly induced in response to phosphate deprivation in Arabidopsis. Since phosphatidylcholine-hydrolyzing activity by phospholipase C was highly up-regulated in phosphate-deprived plants, gene expression of some phospholipase C was expected to be induced during phosphate starvation. Based on amino acid sequence similarity to a bacterial phosphatidylcholine-hydrolyzing phospholipase C, six putative phospholipase Cs were identified in the Arabidopsis genome, one of which, NPC4, showed significant transcriptional activation upon phosphate limitation. Molecular cloning and functional expression of NPC4 confirmed that the NPC4 gene encoded a functional phosphatidylcholine-hydrolyzing phospholipase C that did not require Ca2+ for its activity. Subcellular localization analysis showed that NPC4 protein was highly enriched in the plasma membrane. Analyses of transferred DNA-tagged npc4 mutants revealed that disruption of NPC4 severely reduces the phosphatidylcholine-hydrolyzing phospholipase C activity in response to phosphate starvation. These results suggest that NPC4 plays an important role in the supply of both inorganic phosphate and diacylglycerol from membrane-localized phospholipids that would be used for phosphate supplementation and the replacement of polar lipids in the root plasma membrane during phosphate deprivation.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Phosphorus is an essential element for plant growth, development, and reproduction. It plays decisive roles not only in regulation of various enzymes but also in constitutive components such as membrane phospholipids and nucleic acids. In most soils, despite its abundance, phosphorus is not freely available for assimilation by roots (1). Therefore, plants have developed distinct systems to cope with phosphate deficiency.

When plants suffer from phosphate limitation, highly integrated systems are activated both for assimilation of Pi and supplementation of Pi from innermost phosphorus storage. The former action is represented by a morphological modification of root architecture upon Pi starvation, which presumably facilitates Pi uptake by enlargement of absorptive root surface areas (2). On the other hand, the latter has been described by the dynamic evolution of metabolism that is altered toward the supply of free Pi. During Pi starvation, overall phospholipid content that corresponds to 30% of total Pi storage is decreased, and conversely, contents of nonphosphorus galactolipid, digalactosyldiacylglycerol (DGDG),1 increase significantly (3). Galactolipids such as monogalactosyldiacylglycerol (MGDG) and DGDG are ubiquitous in plants, but are typically found only in plastids, especially in photosynthetic membranes (4). These galactolipids are synthesized by the galactosylation of diacylglycerol (DAG) by MGDG synthase and DGDG synthase in the plastid envelope membranes. During Pi starvation, however, the increased DGDG is reported to accumulate in extraplastidic membranes (3), replacing most of the constitutive phospholipids in the root plasma membrane (5). In this context, a phospholipid hydrolysis for DAG production is considered as a key step that provides a valuable Pi source and the primary substrate for galactolipid biosynthesis under Pi starvation.

A recent study showed that, in response to Pi deprivation, transient increase in phosphatidylcholine (PC) content was followed by its rapid decrease and a concomitant increase of both DAG and DGDG (6). This newly accumulated DAG had a fatty acid composition very similar to that of PC, suggesting that it is derived mainly from PC. Although some studies have reported a PC-hydrolyzing activity that yields DAG in plants (7–11), molecular biological analysis for such activity has not yet been reported (6, 12). In addition, it is unclear whether the reaction is mediated by the direct hydrolysis by a phospholipase C (PLC) or an indirect two-step production, the first step by a phospholipase D (PLD) that yields phosphatidic acid (PA) and the second step of PA dephosphorylation mediated by a PA phosphatase.

In this report, we cloned a novel PLC from Arabidopsis thaliana, designated nonspecific phospholipase C4 (NPC4), which was prominently induced during Pi starvation. On the basis of detailed analyses, this novel enzyme was shown to play a functional role in the phosphate starvation-inducible PC hydrolysis for Pi and DAG supply in vivo.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Plant Material and Treatments—A. thaliana (Columbia-0) was used in this study. For Pi deprivation experiments, plants were prepared according to Härtel et al. (3). In brief, seeds were germinated on Murashige and Skoog medium (13) under continuous light at 22 °C. Ten-day-old plants were transferred onto either Pi-deprived or replete medium and grown for the necessary duration. For subcellular fractionation, 10-day-old seedlings were subjected to Pi starvation for another 10 days in a liquid Murashige and Skoog medium.

Assay for Phospholipid-hydrolyzing Activity—Total proteins of each sample were extracted with assay buffer (50 mM Tris-HCl (pH 7.3), 50 mM NaCl, 5% glycerol). Protein concentration in the enzyme extracts was quantified by the method of Bensadoun and Weinstein (14) with bovine serum albumin as a standard. Fifty microliters of protein extract was mixed with 100 µl of substrate solution and 50 µl of assay buffer. The substrate solution was prepared as follows. Forty-five nanocuries of L-3-PC, 1,2-di[1-14C]palmitoyl (PerkinElmer Life Sciences) was dispersed together with 18 nmol of L-3-PC, 1,2-dipalmitoyl, in 100 µl of suspension buffer (250 mM Tris-HCl (pH 7.3), 0.25% (w/v) deoxycholate). As for phosphatidylethanolamine (PE), PA, or phosphatidylinositol 4,5-bisphosphate (PIP2), L-3-PE, 1-palmitoyl-2-[1-14C]linoleoyl (Amersham Biosciences), L-3-PA[glycerol-14C(U)], 1,2-dipalmitoyl, (PerkinElmer Life Sciences) or PIP2, myo-inositol-2-3H, (PerkinElmer Life Sciences) together with L-3-PE, dipalmitoyl, L-3-PA, dipalmitoyl, or PIP2, respectively, were used. For assays in the presence of EGTA or n-butyl alcohol (n-BuOH), 50 µl of EGTA or n-BuOH dissolved in the assay buffer was added instead of assay buffer to make the final concentration 2 mM (EGTA) or 0.75% (v/v; n-BuOH), respectively. The assay was initiated by vigorous vortex of protein extract and substrate solution, and the mixture was incubated at 37 °C for 1 h. The reaction was stopped by vigorous vortex with 0.5 ml of ethyl acetate and centrifuged twice at 1,500 x g for 5 min with 0.5 ml of 0.45% NaCl. The upper layer was dried and dissolved in 40 µl of chloroform/methanol (2:1, v/v) for one-dimensional TLC analyses. The product solutions were developed in petroleum ether/ethyl ether/acetic acid (50:50:1, v/v/v) for DAG isolation and ethyl acetate/iso-octane/formic acid/water (13:2:3:10, v/v/v/v) for isolation of PA, phosphatidylbutanol (PBu), or other polar lipids. Radioactive spots were quantitatively analyzed by Image Plate (Fuji Photofilm, Tokyo, Japan) and Image Analyzer (Storm; Amersham Biosciences). For assay with PIP2, incubation was stopped with ethyl acetate 10 min after the addition of enzyme, the lower layer of reaction product was extracted, and radioactivity was measured by scintillation counting.

Enzyme Activity Assay of NPC4 Expressed in E. coli—NPC4 was amplified by PCR using LA-Taq DNA polymerase (TaKaRa, Tokyo, Japan) and specific primers designed for NPC4 (AGGCCTATGATCGAGACGACCAAAGGC and AGGCCTTTCAATCATGGCGAATAAAGCAAGAG). The PCR product was cloned into pPICT2 vector (15) by a TA cloning method to screen a clone with correct nucleic acid sequence. Then the fragment was further cloned into pET24b(+) expression vector (Novagen, Madison, WI) and transformed into Escherichia coli BL21(DE3) (Novagen, Madison, WI). When the A600 of E. coli culture reached around 0.4, the culture was treated with 1 mM isopropyl {beta}-D-thiogalactopyranoside and incubated for 12 h at 20 °C to induce the expression of NPC4. Cells were collected by centrifugation (15,000 x g, 1 min) and suspended in the assay buffer to lyse the cells by sonication (output 2, duty 60, 3 s, five times; Ultrasonic Disruptor UD-201; TOMY, Tokyo, Japan). The lysed cell suspension was centrifuged (1,500 x g, 10 min), and supernatant was used for an enzyme activity assay as described above.

Northern Blot Hybridization—Total RNA was prepared from A. thaliana grown either on Pi-deprived or -replete medium using the RNA-easy preparation kit (Qiagen, Valencia, CA). Two micrograms of RNAs were run in 20 mM MOPS (pH 7.0), 1.25% agarose gel and transferred to a Hybond-N membrane (Amersham Biosciences). The membranes were probed with [{alpha}-32P]dCTP-labeled DNA that specifically recognizes each NPC. Hybridization was carried out at 65 °C with Church phosphate buffer (16), and probed membranes were washed twice with 0.2x SSC, 0.1% SDS at 65 °C for 15 min. Hybridized RNA bands were visualized by Image Plate (Fuji Photofilm, Tokyo, Japan) and an Image Analyzer (Storm; Amersham Biosciences).

Preparation of Anti-NPC4 Antibody and Western Blot Analyses—To avoid a cross-detection with NPC5, which shows markedly high amino acid similarity to NPC4, a polypeptide consisting of the C-terminal 120 amino acid residues of NPC4 was used to raise an anti-NPC4 polyclonal antibody in rabbits. A polynucleotide sequence that corresponds to the polypeptide was amplified with specific primers (CATATGGGGACAATGGCAAAAGAAAATGCA and CTCGAGATCATGGCGAATAAAGCAAGAGAA) and cloned into pET24a(+) to express it as a His-tagged polypeptide in E. coli BL21 (DE3). Cells were lysed, and supernatant was purified with Ni2+-nitrilotriacetic acid matrix (Invitrogen). The purified protein was further separated by SDS-PAGE to eliminate any minor contamination. Four milligrams of purified polypeptide was used to raise a rabbit polyclonal antibody (Kitayama Labes, Nagano, Japan).

For Western blot analyses, 50 µg of proteins were separated by 12.5% acrylamide SDS-PAGE and transferred to a PROTORAN nitrocellulose membrane (Schleicher & Schuell). NPC4 was detected with the antibody at a 1:1,000 dilution by using a secondary antibody coupled to alkaline phosphatase. Preimmune sera gave no signal. For plasma membrane marker, plasma membrane aquaporin (PAQ) antibody (17) was used at a 1:1,000 dilution.

Isolation of Plasma Membrane—Cellular membranes were prepared as described previously with minor modifications (18). Liquid-grown Arabidopsis plants that suffered 10-day Pi starvation were homogenized in a mortar with 2 ml of homogenization buffer (50 mM Tris-HCl (pH 7.3), 50 mM NaCl, 15% glycerol, 1 mM phenylmethylsulfonyl fluoride, 1 mM dithiothreitol). Homogenates were filtrated through Miracloth (Calbiochem) and centrifuged at 5,000 x g for 5 min. The supernatant was further centrifuged at 125,000 x g for 30 min to pellet microsomes. The remaining supernatant contains primarily soluble proteins. An aqueous two-phase system (19) was used to separate plasma membrane from microsomes. Total microsomes were resuspended in 500 µl of SPK buffer (0.33 M sucrose, 5 mM potassium phosphate, and 3 mM KCl, pH 7.8) and added to a 4-g phase system prepared in the same buffer. The final composition of the phase system was 6.3% (w/w) dextran (Mr 413,000) and 6.3% (w/w) polyethylene glycol (Mr 3,350). After thorough mixing by inverting the tube 20–30 times, the phases were separated by centrifugation at 1,400 x g for 5 min. The upper phase, enriched in plasma membrane, was transferred to a clean tube and repartitioned twice with lower phase. Fresh upper phase was centrifuged at 125,000 x g for 30 min again to pellet plasma membrane. All procedures were conducted at 4 °C.

Isolation of Intact Chloroplast—Intact chloroplasts were isolated basically according to Douce and Joyard (20) with minor modification described by Yamaryo et al. (21).

Lipid Analysis—Lipid analysis was performed as described by Nakamura et al. (22). Briefly, total lipids were extracted according to Bligh and Dyer (23) and separated by two-dimensional TLC with the following solvent systems: chloroform/methanol/7 N ammonia (120:80:8, v/v/v) and chloroform/methanol/acetic acid/water (170:20:15:3, v/v/v/v). Each lipid was collected separately from TLC plates and then hydrolyzed and methylesterified together with 100 µl of 1 mM pentadecanoic acid (internal standard) by 5% HCl in methanol at 85 °C for 150 min to obtain fatty acid methyl esters. Fatty acid composition was determined with gas chromatography (GC14 gas chromatograph, Shimadzu, Kyoto, Japan; ULBON HR-SS-10 capillary column, 25 m x 0.25 mm, Shinwa Chemical Industries, Kyoto, Japan), and then the amounts of each lipid were calculated.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
PC-hydrolyzing Activity Mediated by a Novel PLC Was Up-regulated during Pi Starvation—To investigate whether PC-hydrolyzing activity is induced under Pi deprivation, both 10-day Pi-deprived or replete plants were analyzed with radiolabeled PC as a substrate. First, we measured radioactive recovery in possible derivatives of PC, namely DAG, PA, lyso-PA, monoacylglycerol (MAG), and free fatty acid by TLC. After a 1-h incubation of crude enzyme extract with radiolabeled PC, we found that production of radioactive DAG is highly induced by Pi starvation (Fig. 1A). Production of radioactive MAG and free fatty acid also increased in response to Pi starvation, although to a much lower extent than DAG. Those increases occurred concomitantly with that of DAG, suggesting that DAG is subsequently deacylated by an acylhydrolase activity present in the reaction mixture. As for the radioactivity in PA and lyso-PA, they were low and not significantly changed between Pi-starved and -replete plants. These results suggest that PC is mainly converted to DAG in Pi-deprived plants. We also compared DAG-producing activity of crude extract from shoots and roots. As seen in Fig. 1B, production of radiolabeled DAG was strongly induced by phosphate starvation, especially in roots, whereas there was no difference between roots and shoots in Pi-replete plants. Therefore, the activity to produce DAG from PC is highly up-regulated specifically in roots during phosphate starvation.



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 1.
Enzymatic activity assay for PC hydrolysis by PLC or PLD. A, TLC images of radiolabeled PC-derived reaction products with crude enzyme extracts. Crude enzyme solution was prepared with Pi-starved or -replete Arabidopsis roots and incubated together with [14C]PC at 37 °C for 1 h. Reaction products were isolated by TLC, and radioactive spots were visualized. FFA, free fatty acid. B, PC-hydrolyzing activity to produce DAG in Pi-deprived or -replete plants. Total protein was extracted from each sample as described under "Materials and Methods." The extracts were incubated with 14C-labeled PC at 37 °C for 1 h. Reaction products were analyzed with TLC, and radioactive DAG was quantified with Image Analyzer. Pi+, samples grown on medium with 1.0 mM Pi; Pi–, samples grown under 0 mM Pi concentration. Results are representative of four independent experiments. C, PLD activity assay of Pi-deprived or -replete plants. PBu-synthesizing activity of both Pi-deprived or -replete roots were assayed in the presence of n-BuOH as described under "Materials and Methods." Pi+, samples grown on medium with 1.0 mM Pi; Pi–, samples grown under 0 mM Pi concentration. Results are the average of three independent experiments.

 
As mentioned in the Introduction, two pathways are considered for the production of DAG from PC; one is by a PLC, whereas the other is a combinatory two-step reaction by PLD and PA phosphatase. Therefore, it is necessary to investigate which pathway is responsible for PC hydrolysis upon Pi starvation. To monitor PLD activity, it is suitable to employ the distinct property of transphosphatidylation (24). PLD is reported to preferentially select n-BuOH as a substrate over H2O, and thus PLD activity in the presence of n-BuOH results in the accumulation of PBu (25). PC hydrolysis of Pi-starved root extract showed considerable accumulation of PBu in the presence of 0.75% n-BuOH (Fig. 1C). However, it was not obviously induced upon Pi starvation compared with the PC-hydrolyzing activity in Fig. 1B. The DAG-producing activity was not affected by the addition of n-BuOH, although PA production from PC was suppressed in part under this condition (data not shown). Therefore, PLD activity is not significantly induced by phosphate limitation. Indeed, Northern blot analyses showed that five representative PLDs so far cloned from Arabidopsis (PLD{alpha}1, PLD{beta}1, PLD{gamma}1, PLD{delta}, and PLD{zeta}1) were not transcriptionally activated upon Pi deficiency (data not shown). According to these results, the high DAG-producing activity in response to Pi deprivation is mainly mediated not by PLD but by PLC. Although two PLCs have been cloned and characterized in Arabidopsis, they are categorized as phosphoinositide-specific PLCs (PI-PLC) that have substrate preference for phosphoinositides, not for constitutive phospholipids such as PC (26, 27). This strongly implied the existence of a novel PLC that could hydrolyze PC.

Identification of Six Putative Homologues of a Bacterial PC-PLC in Arabidopsis—In order to identify the novel PC-hydrolyzing PLC (PC-PLC) in Arabidopsis, we referred to the bacterial PC-PLCs. To date, several types of PC-PLC have been cloned and characterized from a wide variety of bacteria (28). Among them, homologous genes to that of Ralstonia solanacearum or Mycobacterium tuberculosis were found in the Arabidopsis genome as well as that of other higher plants. Based on the amino acid sequence similarity to Ralstonian PC-PLC (protein accession number NP_518440 [GenBank] ), six putative PLCs were newly identified in Arabidopsis using a BLAST data base search provided by TAIR (available on the World Wide Web at www.arabidopsis.org/). They were numerically named A. thaliana nonspecific phospholipase C1 to -6 (AtNPC1 to -6) by MIPS code number (Table I). These NPCs are ~60-kDa proteins consisting of 514–538 amino acid residues. NPC1 and NPC2 are located on chromosome I and II, respectively, whereas others are on chromosome III. In particular, NPC3, -4, and -5 are positioned in tandem. The amino acid identities among these isogenes vary from 52.8% (NPC3 and NPC6) to 64.2% (NPC3 and NPC4) except for a prominently higher identity of 84.7% between NPC4 and NPC5. A multiple alignment of AtNPCs and bacterial PC-PLC (M. tuberculosis, Swissprot accession number P95246 [GenBank] ) (29) revealed that there are three domains highly conserved among bacteria and plants, but none corresponded to any known motifs (Fig. 2). Comparison of the domain organization of AtNPCs with that of PI-PLC showed that there are no domains similar to the X,Y-domains or EF-hand motif in PI-PLC. Furthermore, a Ca2+-binding or lipid-binding motif, such as the C2 domain, PX/PH domains, or IYIENQFF motif in the Arabidopsis PLD family was not found by data base search (MOTIF; available on the World Wide Web at motif.genome.ad.jp). Hydropathy plots of NPC1 to -6 revealed no apparent membrane-spanning domains, suggesting that they are soluble or membrane-associated proteins. Among the six isozymes, NPC1, -2, and -6 have putative transit peptides that were predicted to be signal peptide for the secretory pathway by the TargetP program (available on the World Wide Web at www.cbs.dtu.dk/services/TargetP/). The Massively Parallel Signature Sequencing data base (available on the World Wide Web at mpss.udel.edu/at/GeneAnalysis.php/) showed that several NPCs had relatively high expression levels in nonphotosynthetic organs: NPC1 in floral organs, NPC6 in floral organs and siliques, and NPC3/4 in roots. The expression levels of NPC2 and -5 are too low to discern significant differences among organs. Unlike PI-PLC that hydrolyzes only a small portion of membrane lipids, PC-PLC is capable of hydrolyzing the major component of cellular membranes. Since nonphotosynthetic organs like flowers have considerably high membrane lipid biosynthetic activities (22, 30), some of these NPCs might play roles in the lipid turnover or membrane degradation in such organs.


View this table:
[in this window]
[in a new window]
  		TABLE I
Arabidopsis NPC family: gene loci, molecular weights, and their predicted localization

 



View larger version (122K):
[in this window]
[in a new window]
  		FIG. 2.
Deduced amino acid sequence alignment of the Arabidopsis NPC family and a bacterial PC-PLC (M. tuberculosis; Swissprot accession number P95246 [GenBank] ). I–III showed highly conserved regions between bacterial and Arabidopsis PC-PLC. Identical and similar amino acid residues are shaded black and gray, respectively.

 
Expression of NPC4 Was Induced in Response to Pi Limitation—To clarify whether gene expression of these putative PLCs is induced during Pi starvation, Northern blot analysis was conducted with Pi-starved plants. As shown in Fig. 3, only expression of NPC4 was markedly induced upon Pi starvation. This induction was detected both in roots and shoots (data not shown), although stronger PC-hydrolyzing activity was observed in roots (Fig. 1A). The analysis further revealed that this induction was observed when Pi concentration in the medium fell to less than 0.1 mM (Fig. 3A). A time course experiment showed that NPC4 was highly induced 6 days after Pi starvation (Fig. 3B), which matched well that of Pi deficiency-inducible galactolipid synthase genes such as MGD2/3 (31). These results suggest that NPC4 is a strong candidate for a Pi starvation-inducible PC-PLC.



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 3.
Northern blot analysis of NPC4 expression in response to Pi limitation. MGD1, -2, and -3, MGDG synthase 1, 2, and 3; Ubq10, ubiquitin 10. A, expression of NPC4 was induced under Pi limitation. Ten-day-old plants were transferred onto the medium with the Pi concentration shown in the figure. Two micrograms of RNA were used for hybridization as described under "Materials and Methods." B, time course analysis of transcriptional activation on NPC4. Pi+, samples grown on medium with 1.0 mM Pi; Pi–, samples grown under 0 mM Pi concentration.

 
NPC4 Encoded a Functional PC-PLC That Prefers PC for the Substrate in a Ca2+-independent Manner—To ascertain whether the NPC4 gene encodes a functionally active PLC, NPC4 protein was expressed in E. coli. Truncated NPC4 polypeptide ({Delta}-NPC4), which was made to raise the NPC4 antibody, was used to discern the background PC-PLC activity of E. coli. The results of the expression experiments showed that NPC4 had significant DAG-producing activity from PC, whereas the negative control had only a trace amount (Fig. 4). Although NPC4 also hydrolyzed PE, the other major membrane phospholipid, it showed substrate preference for PC. This agreed with the fact that PC was decreased more significantly than any other membrane phospholipids in Pi-starved roots (6). As for PA, no activity was detected. These results suggest that NPC4 belongs to a phosphodiesterase family that can hydrolyze PC and PE but not PA. Because PIP2 is a primary substrate for plant PI-PLC, we further examined whether NPC4 hydrolyzes PIP2. As seen in Fig. 4, NPC4 showed very low activity for PIP2 (<10% of PC-hydrolyzing activity), suggesting that NPC4 has different substrate selectivity from PI-PLC (32, 33). Next, we analyzed the effect of divalent cations on the enzyme activity, since many plant phospholipases are characterized as Ca2+-dependent enzymes. We first tested whether NPC4 activity can be affected by the addition of EGTA (2 mM) and found that EGTA did not inhibit but instead increased the activity (Fig. 4). This result suggests that NPC4 does not require Ca2+ for activity. To address why the addition of EGTA slightly increased NPC4 activity, we examined effects of divalent cations to NPC4 activity. The result showed that whereas 1 mM Ca2+, Mg2+, or Cu2+ did not affect the activity, Co2+, Mn2+, and Zn2+ severely (about 70%) inhibited it. These results imply that the addition of EGTA might chelate some of these inhibitory divalent cations in the crude extract, resulting in the increase of NPC4 activity slightly. According to these results, NPC4 was shown to encode a functional PC-PLC that possesses different substrate selectivity from PI-PLC in a Ca2+-independent manner.



View larger version (12K):
[in this window]
[in a new window]
  		FIG. 4.
PLC activity of recombinant NPC4 expressed in E. coli. The activity was assayed in the presence or absence of 2 mM EGTA and was compared between different substrates, PC, PE, PA, and PIP2 (90 µM each). For negative control, truncated polypeptide corresponding to the C-terminal 120 amino acids of NPC4 ({Delta}NPC4) was expressed and assayed with PC as a substrate. NPC4, full-length NPC4. Results are average of three independent experiments.

 
NPC4 Was Enriched in Plasma Membranes—Because NPC4 is thought to be involved in the hydrolysis of membrane phospholipid where it sits, its subcellular localization was analyzed. Whole Arabidopsis plants that suffered 10-day Pi starvation were used for fractionation, and NPC4 protein was detected with an anti-NPC4 antibody. As can be seen in Fig. 5A, NPC4 and PC-PLC activity were both highly enriched in the microsomal fraction, whereas they were hardly detectable in intact plastid fraction. Taking the hydropathy profile of amino acid sequence into consideration, NPC4 is a membrane-associated protein localized in extraplastidic membranes. To further analyze localization, plasma membranes were purified from the microsomal fraction, which resulted in further enrichment of NPC4 protein and PC-PLC activity, as well as PAQ, a marker protein for plasma membranes (Fig. 5B). This result shows that NPC4 is mainly localized to the plasma membrane. Plasma membranes are known to be abundant in PC and PE, the substrates for NPC4 and the lipids that are degraded upon Pi starvation (5). These results suggest that NPC4 is involved in the degradation of plasma membrane-localized phospholipids.



View larger version (36K):
[in this window]
[in a new window]
  		FIG. 5.
Subcellular localization of NPC4. Intact plastids and other membranes were fractionated as described under "Materials and Methods." NPC4 was detected by Western blot analysis, and relative PC-hydrolyzing activity was measured by production of radiolabeled DAG in each fraction. The activities relative to that of crude extracts (100%) are shown as percentages. Results are representative of three independent experiments. A, subcellular fractionation of Pi-starved Arabidopsis plants. NPC4 and PC-PLC activity were both enriched in the microsomal fraction. Light-harvesting chlorophyll-binding protein (LHCP) is a marker for plastids. B, purification of plasma membrane from total microsomal fraction. NPC4 and PC-PLC activity were highly enriched in the plasma membrane fraction. PAQ is a marker for plasma membranes (17).

 
Disruption of NPC4 Strongly Affected the Activation of PC Hydrolysis during Pi Starvation—To analyze whether NPC4 plays a role in PC-hydrolyzing activity during Pi starvation, transferred DNA (T-DNA)-tagged npc4 mutants were isolated. The first mutant allele, npc4-1, was screened from a massive T-DNA mutant superpool provided by Kazusa DNA Research Institute (Chiba, Japan) whereas the second one, npc4-2, was obtained from the SALK Institute (San Diego, CA) (34). Both were confirmed to be homozygous mutants by PCR amplification with specific primers for the NPC4 gene and border sequence of T-DNA. DNA sequencing of the border revealed that both lines had a T-DNA insertion in the NPC4 gene, npc4-1 in the second intron and npc4-2 in the fifth exon (Fig. 6A). To ascertain the defect of NPC4 expression by the insertions, Northern blot analysis was carried out with both mutants under Pi starvation. Even in the Pi-starved condition, however, NPC4 gene expression was not detectable in both mutants (Fig. 6B). We also conducted Western blot analysis and found that NPC4 protein was undetectable in Pi-starved npc4 mutants (Fig. 6C). According to these results, npc4-1 and npc4-2 are null mutants of NPC4 gene.



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 6.
Isolation and analyses of T-DNA-tagged NPC4 disruptants. A, location of T-DNA insertion in two T-DNA-tagged NPC4 disruptants, npc4-1 and npc4-2. B, Northern blot analysis of NPC4 expression in Pi-starved wild type (WT) and two npc4 disruptants. Total RNA was obtained from roots of Pi-starved plants, and 2 µg of the RNA were used for hybridization as described under "Materials and Methods." C, Western blot analysis of total crude protein from wild type or npc4 mutants that suffered 10-day Pi starvation. Fifty micrograms of proteins were used for the analyses. D, PC-hydrolyzing PLC activity in the root of wild type and two npc4 mutants that suffered 10-day Pi starvation. The activities of npc4 mutants relative to that of wild type are shown as percentages.

 
When we analyzed the PC-hydrolyzing activity of these mutants, induction upon Pi deprivation could not be observed compared with that of wild type plants (Fig. 6D). The activity in the mutants was almost as low as that observed in Pi-replete wild type plants, indicating that the increased PC-hydrolyzing activity upon Pi starvation is attributable to NPC4. To evaluate whether the NPC4-mediated pathway is primarily involved in the DGDG accumulation, we further analyzed the lipid contents of Pi-starved npc4-1. The result showed that membrane lipid composition, as well as the respective fatty acid profiles, was not significantly changed by the disruption of NPC4, although a slight decrease in DGDG was observed (Fig. 7 and Table II). This alteration suggests possible involvement of NPC4 in the DGDG accumulation. However, since the change was not obvious, there must be other contributors of DAG for DGDG synthesis during Pi starvation. To support this idea, we analyzed gene expression of other NPCs in the Pi-starved npc4 mutants but found no induction of other NPC isogene expressions (data not shown). Analysis of PLD activity using n-BuOH in the mutants resulted in no activation in npc4-1 (data not shown). Thus, there is no alternative induction of PLC/PLD. It was therefore confirmed that the PC-hydrolyzing activity that is up-regulated upon Pi deprivation is largely attributable to NPC4, although it is unlikely to be a major factor for DGDG accumulation.



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 7.
Lipid composition of Pi-starved wild type and npc4-1 mutant. Total lipid was extracted from the shoots of 10-day Pi-starved wild type and npc4-1 mutant. Each lipid was separated by two-dimensional TLC and quantified with gas chromatography as described under "Materials and Methods." White bars, wild type; black bars, npc4-1. Results are the average of three independent experiments.

 


View this table:
[in this window]
[in a new window]
  		TABLE II
Fatty acid composition (mol %) of membrane lipids in Pi-starved wild type and npc4-1 mutant

Values represent averages of three independent measurements. S.D. values were all within 6%.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
During Pi starvation, the activity to produce DAG from PC was highly up-regulated. Because membrane phospholipids, particularly PC, were reported to be markedly decreased during Pi deprivation (6), this activation was thought to contribute to the Pi-inducible PC degradation for Pi and DAG supplementation. A PLD activity assay showed no significant induction upon Pi starvation, suggesting that the PC-hydrolyzing activity is mainly due to the activation of a PC-PLC. Based on the amino acid sequence similarity to bacterial PC-PLC, we detected six functionally unknown genes, one of which, NPC4, showed significant transcriptional activation in response to Pi starvation. Molecular cloning and functional expression of NPC4 confirmed that it encoded a functional PC-PLC that acts in a Ca2+-independent manner. The recombinant NPC4 showed broad substrate specificity with preference for constitutive membrane phospholipids such as PC or PE, in contrast to PI-PLC as reported to date (35). Subcellular fractionation analysis showed that NPC4 was not detectable in intact plastids but was highly enriched in plasma membranes. Analyses of T-DNA-tagged npc4 mutants revealed that disruption of NPC4 severely reduced the induction of PC-PLC activity in response to Pi starvation. Therefore, these results indicate that NPC4 is involved in the hydrolysis of plasma membrane phospholipids to supply Pi and DAG during Pi deprivation.

PC-hydrolyzing activity of recombinant NPC4 was not affected when 2 mM EGTA was added to the reaction mixture. Furthermore, the assay using crude enzyme extract of Pi-deprived plants showed no change in PC-hydrolyzing activity regardless of EGTA addition (data not shown). A data base search for specific Ca2+-binding motif, such as the C2 domain, in most of Arabidopsis PLDs (36) yielded no hit for NPC4. In Arabidopsis, 12 PLDs were identified and categorized into five subfamilies. All isozymes studied to date were Ca2+-dependent and contained the C2 domain except for most recently cloned PLD1 (36). These enzymes are characterized as functioning in signaling cascades (36, 37), playing a role in the supply of PA that is widely acknowledged as a second messenger in plants (38). In animals, DAG is also known as a second messenger that activates protein kinase C. Animal PLC is considered to play a major role in DAG signaling cascades since PLC yields DAG in a direct hydrolysis of phospholipids. In plants, on the other hand, protein kinase C has not been identified so far, whereas various effector enzymes in PA signaling have been elucidated (39). Therefore, PLD that yields PA directly from phospholipids is characterized as an enzyme for signaling rather than that for phospholipid catabolism. Although Ca2+-dependent PI-PLC yields DAG, these PI-PLCs hydrolyze only phosphoinositides, a minor component of membrane phospholipids (35). In addition, the DAG produced by PI-PLC is readily phosphorylated to yield PA for signal transduction (40). By contrast, the present study showed that a major portion of DAG produced upon Pi starvation is not converted to PA (Fig. 1A). The broad substrate specificity of NPC4 indicates that this enzyme is capable of degrading biological membranes. Indeed, the bacterial ortholog of NPC4 was first isolated from toxic bacteria as an enzyme enabling them to invade host cells by digesting the surrounding membranes (28). Thus, it is likely that NPC4 is mainly involved in membrane lipid degradation rather than signal transduction. The reason for relatively low expression levels, especially in photosynthetic organs, of NPCs is probably because conventionally high levels of NPC4 activity might be toxic to plants. Therefore, these enzymes may function mainly in certain organs like flowers that showed intensive lipid turnover or in a particular environmental condition that requires urgent membrane degradation, such as Pi starvation.

Localization of NPC4 to the plasma membranes suggests that NPC4 is involved in the degradation of plasma membrane phospholipids to yield two products, Pi-containing head groups and DAG. Whereas detaching hydrophilic Pi-containing head groups from plasma membranes could supply a valuable Pi source for Pi-starved plants, DAG might be either used directly or further deacylated to recover free fatty acids for lipid reconstruction. Both fates of DAG may contribute to the DGDG accumulation in the plasma membrane of Pi-starved roots. In Arabidopsis, three MGDG synthases (AtMGD1 to -3) and two DGDG synthases (AtDGD1/2) have been identified to date. During Pi starvation, expression of MGD2/3 and DGD1/2 are induced, causing activation of a galactolipid biosynthetic pathway for DGDG accumulation (30, 31, 41, 42). The dgd1dgd2 double knockout mutant showed undetectable accumulation of DGDG even in the Pi-deprived condition, indicating that this pathway is crucial for Pi starvation-inducible DGDG accumulation (42). The induction of NPC4 during Pi starvation synchronized well with that of Pi-inducible galactolipid synthases such as MGD2/3, suggesting that these enzymes may cooperatively play roles in the alteration of membrane lipid composition during Pi starvation. However, because DGDG accumulated during Pi starvation is thought to be derived from the endoplasmic reticulum-localized pathway (3), the plasma membrane-localized NPC4 is unlikely to be largely involved in DGDG production. Indeed, we observed the accumulation of DGDG almost to the same level as wild type in Pi-starved npc4 mutant. During Pi starvation, growth of shoots is severely affected, whereas that of roots is highly accelerated in both wild type and the npc4 mutants, although DGDG is a major component of Pi-starved root plasma membrane (5). Since NPC4 can convert membrane phospholipids only to the equivalent amount of DAG, it is unlikely that NPC4 alone provides sufficient DAG for the significant development of plasma membrane in Pi starvation-inducible root growth. Thus, in phosphate-starved conditions, we suggest that NPC4 is mainly involved in the degradation of plasma membrane-localized phospholipids to rescue Pi from polar head groups and DAG for lipid reconstruction (recycling pathway), with simultaneous accumulation of DGDG mediated by the endoplasmic reticulum-localized pathway (de novo pathway) (Fig. 8). The possible contribution of the de novo pathway to DGDG accumulation should be evaluated in a future study.



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 8.
Possible involvement of NPC4 in the replacement of membrane lipids during Pi starvation. P-Cho, phosphocholine; G3P, glycerol-3-phosphate; FFA, free fatty acid.

 
In conclusion, the analyses of NPC4 revealed the first molecular identity of a PC-PLC in eukaryotes and provided evidence for the involvement of this enzyme in the hydrolysis of plasma membrane phospholipids during Pi starvation. Further studies are anticipated to elucidate the enzymatic characteristics and physiological significance of other NPC family members.


   FOOTNOTES
 
* This work was supported in part by Ministry of Education, Sports, Science, and Culture of Japan Grant-in-aid for Scientific Research on Priority Areas 15380049. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§ Supported by the Grant of the 21st Century COE Program. Back

|| Supported by JSPS Postdoctoral Fellowships for Research Abroad, the Ministry of Education, Sports, Science and Culture of Japan. Back

** Present address: Dept. of General Systems Studies, Graduate School of Arts and Sciences, The University of Tokyo, 3-8-1 Komaba, Meguro, Tokyo 153-8902, Japan. Back

§§ To whom correspondence should be addressed: Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, 4259-B-14 Nagatsuta-cho, Midori-ku, Yokohama, Kanagawa 226-8501, Japan. Tel.: 81-45-924-5736; Fax: 81-45-924-5823; E-mail: hohta{at}bio.titech.ac.jp.

1 The abbreviations used are: DGDG, digalactosyldiacylglycerol; DAG, 1,2-sn-diacylglycerol; MAG, monoacylglycerol; MGDG, monogalactosyldiacylglycerol; n-BuOH, n-butyl alcohol; NPC, nonspecific phospholipase C; PA, phosphatidic acid; PAQ, plasma membrane aquaporin; PBu, phosphatidylbutanol; PC, phosphatidylcholine; PC-PLC phosphatidylcholine-hydrolyzing phospholipase C; PE, phosphatidylethanolamine; PIP2, phosphatidylinositol 4,5-bisphosphate; PI-PLC, phosphoinositide-specific phospholipase C; PLC, phospholipase C; PLD, phospholipase D; MOPS, 4-morpholinepropanesulfonic acid; T-DNA, transferred DNA. Back


   ACKNOWLEDGMENTS
 
We thank Prof. Masayoshi Maeshima for providing PAQ antibody.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Raghothama, K. G. (1999) Annu. Rev. Plant Physiol. Plant Mol. Biol. 50, 665–693[CrossRef]
  2. Lynch, J. P. (1995) Plant Physiol. 109, 7–13[CrossRef][Medline] [Order article via Infotrieve]
  3. Härtel, H., Dörmann, P., and Benning, C. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 10649–10654[Abstract/Free Full Text]
  4. Joyard, J., Maréchal, E., Miége, C., Block, M. A., Dorne, A-J., and Douce, R. (1998) Lipids in Photosynthesis: Structure, Function, and Genetics, pp. 21–52, Kluwer Academic Publishers, Dordrecht, The Netherlands
  5. Andersson, M. X., Stridh, M. H., Larsson, K. E., Liljenberg, C., and Sandelius, A. S. (2003) FEBS Lett. 537, 128–132[CrossRef][Medline] [Order article via Infotrieve]
  6. Jouhet, J., Maréchal, E., Bligny, R., Joyard, J., and Block, M. A. (2003) FEBS Lett. 544, 63–68[CrossRef][Medline] [Order article via Infotrieve]
  7. Kates, M. (1955) Can. J. Biochem. Physiol. 33, 575–589
  8. Strauss, H., Leibovitz-Ben Gershon, Z., and Heller, M. (1976) Lipids 11, 442–448[Medline] [Order article via Infotrieve]
  9. Chrastil, J., and Parrish, F. W. (1987) J. Agric. Food Chem. 35, 624–627
  10. Rouet-Mayer, M.A., Valentova, O., Simond-Cote, E., Daussan, J., and Thévenot, C. (1995) Lipids 30, 739–746[CrossRef][Medline] [Order article via Infotrieve]
  11. Scherer, G.F.E., Paul, R.U., Holk, A., and Martinec, J. (2002) Biochem. Biophys. Res. Commun. 293, 766–770[Medline] [Order article via Infotrieve]
  12. Wang, X. (2001) Annu. Rev. Plant Physiol. Plant Mol. Biol. 52, 211–231[CrossRef][Medline] [Order article via Infotrieve]
  13. Murashige, T., and Skoog, F. (1962) Physiol. Plant. 15, 473–497[CrossRef]
  14. Bensadoun, A., and Weinstein, D. (1976) Anal. Biochem. 70, 241–250[CrossRef][Medline] [Order article via Infotrieve]
  15. Kawaguchi, J., Kii, I., Sugiyama, Y., Takeshita, S., and Kudo, A. (2001) J. Bone Miner. Res. 16, 260–269[CrossRef][Medline] [Order article via Infotrieve]
  16. Church, G. M., and Gilbert, W. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 1991–1995[Abstract/Free Full Text]
  17. Ohshima, Y., Iwasaki, I., Suga, S., Murakami, M., Inoue, K., and Maeshima, M. (2001) Plant Cell Physiol. 42, 1119–1129[Abstract/Free Full Text]
  18. Schaller, G. E., and DeWitt, N. D. (1995) Methods Cell Biol. 50, 129–148[Medline] [Order article via Infotrieve]
  19. Larsson, C., Widell, S., and Kjellbom, P. (1987) Methods Enzymol. 148, 558–568
  20. Douce, R., and Joyard, J. (1982) Methods in Chloroplast Molecular Biology, pp. 239–255, Elsevier Biomedical Press, Grenoble, France
  21. Yamaryo, Y., Kanai, D., Awai, K., Shimojima, M., Masuda, T., Shimada, H., Takamiya, K., and Ohta, H. (2003) Plant Cell Physiol. 44, 844–855[Abstract/Free Full Text]
  22. Nakamura, Y., Arimitsu, H., Yamaryo, Y., Awai, K., Masuda, T., Shimada, H., Takamiya, K., and Ohta, H. (2003) Lipids 38, 1107–1112[Medline] [Order article via Infotrieve]
  23. Bligh, E. G., and Dyer, W. J. (1959) Can. J. Biochem. Physiol. 37, 911–917
  24. Yang, S. F., Freer, S., and Benson, A. A. (1967) J. Biol. Chem. 242, 477–484[Abstract/Free Full Text]
  25. Munnik, T., Arisz, S. A., Vrije, T., and Musgrave, A. (1995) Plant Cell 7, 2197–2210[Abstract]
  26. Hirayama, T., Ohto, C., Mizoguchi, T., and Shinozaki, K. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 3903–3907[Abstract/Free Full Text]
  27. Hirayama, T., Mitsukawa, N., Shibata, D., and Shinozaki, K. (1997) Plant Mol. Biol. 34, 175–180[CrossRef][Medline] [Order article via Infotrieve]
  28. Titball, R. W. (1998) Symp. Ser. Soc. Appl. Microbiol. 84, 127S–137S
  29. Johansen, K. A., Gill, R. E., and Vasil, M. L. (1996) Infect. Immun. 64, 3259–3266[Abstract]
  30. Kobayashi, K., Awai, K., Takamiya, K., and Ohta, H. (2004) Plant Physiol. 134, 640–648[Abstract/Free Full Text]
  31. Awai, K., Maréchal, E., Block, M. A., Brun, D, Masuda, T., Shimada, H., Takamiya, K., Ohta, H., and Joyard, J. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 10960–10965[Abstract/Free Full Text]
  32. Yotsushima, K., Nakamura, K., Mitsui, T., and Igaue, I. (1992) Biosci. Biotechnol. Biochem. 56, 1247–1251
  33. Yotsushima, K., Mitsui, T., Takaoka, T., Hayakawa, T., and Igaue, I. (1993) Plant Physiol. 102, 165–172[Abstract]
  34. Alonso, J. M., Stepanova, A. N., Leisse, T. J., Kim, C. J., Chen, H., Shinn, P., Stevenson, D. K., Zimmerman, J., Barajas, P., Cheuk, R., Gadrinab, C., Heller, C., Jeske, A., Koesema, E., Meyers, C. C., Parker, H., Prednis, L., Ansari, Y., Choy, N., Deen, H., Geralt, M., Hazari, N., Hom, E., Karnes, M., Mulholland, C., Ndubaku, R., Schmidt, I., Guzman, P., Aguilar-Henonin, L., Schmid, M., Weigel, D., Carter, D.E., Marchand, T., Risseeuw, E., Brogden, D., Zeko, A., Crosby, W. L., Berry, C. C., and Ecker, J. R. (2003) Science 301, 653–657[Abstract/Free Full Text]
  35. Wang, X. (2004) Curr. Opin. Plant Biol. 7, 329–336[CrossRef][Medline] [Order article via Infotrieve]
  36. Qin, C., and Wang, X. (2002) Plant Physiol. 128, 1057–1068[Abstract/Free Full Text]
  37. Munnik, T., Irvine, R. F., and Musgrave, A. (1998) Biochim. Biophys. Acta 1389, 222–272[Medline] [Order article via Infotrieve]
  38. Munnik, T. (2001) Trends Plant Sci. 6, 227–233[CrossRef][Medline] [Order article via Infotrieve]
  39. Wang, X. (2002) Curr. Opin. Plant Biol. 5, 408–414[CrossRef][Medline] [Order article via Infotrieve]
  40. Laxalt, A. M., and Munnik, T. (2002) Curr. Opin. Plant Biol. 5, 332–338[CrossRef][Medline] [Order article via Infotrieve]
  41. Kelly, A. A., and Dörmann, P. (2002) J. Biol. Chem. 277, 1166–1173[Abstract/Free Full Text]
  42. Kelly, A. A., Froehlich, J. E., and Dörmann, P. (2003) Plant Cell 15, 2694–2706[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Plant CellHome page
C. Xu, J. Fan, A. J. Cornish, and C. Benning
Lipid Trafficking between the Endoplasmic Reticulum and the Plastid in Arabidopsis Requires the Extraplastidic TGD4 Protein
PLANT CELL, August 1, 2008; 20(8): 2190 - 2204.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
V. S. Reddy, A. K. Singh, and R. Rajasekharan
The Saccharomyces cerevisiae PHM8 Gene Encodes a Soluble Magnesium-dependent Lysophosphatidic Acid Phosphatase
J. Biol. Chem., April 4, 2008; 283(14): 8846 - 8854.
[Abstract] [Full Text] [PDF]

Home page
 Genome ResHome page
S. Ma, Q. Gong, and H. J. Bohnert
An Arabidopsis gene network based on the graphical Gaussian model
Genome Res., November 1, 2007; 17(11): 1614 - 1625.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y. Nakamura, M. Tsuchiya, and H. Ohta
Plastidic Phosphatidic Acid Phosphatases Identified in a Distinct Subfamily of Lipid Phosphate Phosphatases with Prokaryotic Origin
J. Biol. Chem., September 28, 2007; 282(39): 29013 - 29021.
[Abstract] [Full Text] [PDF]

Home page
 Plant Physiol.Home page
M. Li, R. Welti, and X. Wang
Quantitative Profiling of Arabidopsis Polar Glycerolipids in Response to Phosphorus Starvation. Roles of Phospholipases D{zeta}1 and D{zeta}2 in Phosphatidylcholine Hydrolysis and Digalactosyldiacylglycerol Accumulation in Phosphorus-Starved Plants
Plant Physiology, October 1, 2006; 142(2): 750 - 761.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
A. Cruz-Ramirez, A. Oropeza-Aburto, F. Razo-Hernandez, E. Ramirez-Chavez, and L. Herrera-Estrella
Phospholipase DZ2 plays an important role in extraplastidic galactolipid biosynthesis and phosphate recycling in Arabidopsis roots
PNAS, April 25, 2006; 103(17): 6765 - 6770.
[Abstract] [Full Text] [PDF]

Home page
 Plant Physiol.Home page
M. Li, C. Qin, R. Welti, and X. Wang
Double Knockouts of Phospholipases D{zeta}1 and D{zeta}2 in Arabidopsis Affect Root Elongation during Phosphate-Limited Growth But Do Not Affect Root Hair Patterning
Plant Physiology, February 1, 2006; 140(2): 761 - 770.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. X. Andersson, K. E. Larsson, H. Tjellstrom, C. Liljenberg, and A. S. Sandelius
Phosphate-limited Oat: THE PLASMA MEMBRANE AND THE TONOPLAST AS MAJOR TARGETS FOR PHOSPHOLIPID-TO-GLYCOLIPID REPLACEMENT AND STIMULATION OF PHOSPHOLIPASES IN THE PLASMA MEMBRANE
J. Biol. Chem., July 29, 2005; 280(30): 27578 - 27586.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/9/7469    most recent
M408799200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nakamura, Y.
Right arrow Articles by Ohta, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakamura, Y.
Right arrow Articles by Ohta, H.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement