| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 281, Issue 11, 7082-7088, March 17, 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1
From the
Department of Human Genetics, University of Utah, Salt Lake City, Utah 84112 and the Biosciences Institute, University College Cork, Cork, Ireland
Received for publication, October 27, 2005 , and in revised form, January 4, 2006.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
Examples of genes that require –1 frameshifting for expression are well known in viral genomes. There is only one demonstrated case of –1 frameshifting in a mammalian cellular gene (10, 11), but it does not display the phylogenetic breadth of the +1 frameshifting utilized in decoding antizyme mRNA, conserved from mammals to yeasts (12). Frameshifting near the end of a coding sequence often allows a proportion of ribosomes to access an ORF that extends beyond the zero frame terminator so that the transframe (coupled ORF) protein is longer than that of standard decoding. The easiest class of –1 programmed frame-shift events to search for is one that has conserved architecture of two ORFs that partially overlap and contains a defined shift site. In these cases conservation of an independent ORF2 helps to distinguish significant candidates from a genomic background that contains sequencing errors and pseudogenes. However, cases such as the Escherichia coli dnaX gene, which utilizes a –1 frameshift to cause a proportion of ribosomes to access a stop codon in the new frame near the frameshift site, demonstrate that frameshifting can be utilized to yield an additional product that lacks a carboxyl-terminal domain of the product of standard decoding. In attempting to identify cases of this nature, searches for two long and partially overlapping ORFs will be fruitless because ORF2 will be wholly contained within the sequence encoding ORF1 and can be small or nonexistent. In addition to identifying an appropriate pair of ORFs that will support a given type of recoding, a specific frameshift site must be identified. The classic heptanucleotide –1 shift site followed by a pseudoknot, as described above, provides a straightforward target for bioinformatic searches. Other possible shift sites are less well defined and thus more complicated to identify. For example, the potential for both A and P site tRNAs to re-pair in the new frame can be difficult to discern (13). In yet other cases, our current knowledge does not adequately predict the likelihood of frameshifting (14, 15). A recent case in point is that reported for the generation of polyalanine runs from long CAG tracts in the MJD-1 transcript (related to a late onset neurodegenerative disorder) where there is no conventional heptanucleotide frame-shift site (16). Diverse approaches are needed to discern the extent to which programmed –1 frameshifting is utilized in decoding eukaryotic cellular genes. Here we report a functional –1 frameshifting site in a mammalian cellular gene, Ma3, identified by a bioinformatic analysis of mRNA sequences searching for a classic heptanucleotide shift site followed by a pseudoknot and contained in the overlap between two ORFs. A counterpart exists in the human Ma5 gene, but the 3' stimulator was not analyzed in detail.
Ma3 and Ma5 are members of a family of mammalian genes whose protein products are the target of immunity associated with paraneoplastic disorders whose symptoms, though associated with tumors elsewhere in the body, are not directly caused by the tumors or the treatment of them. These disorders are often the consequence of an autoimmune response to antigens ectopically expressed in the tumor cells that target the protein(s) normally expressed by the affected cells. Ma1 is expressed in the brain and testis, Ma2 in the brain, and Ma3 in the brain and testis and to a lesser extent in the trachea, kidney, and heart. Immunity to Ma2 and sometimes additional immunity to Ma1 and Ma3 are associated with brainstem encephalitis and cerebral degeneration (17). Our results indicate that the human paraneoplastic antigen Ma3 gene contains a functional heptanucleotide shift sequence and a classical H-type pseudoknot that promotes –1 frameshifting at 
20% efficiency both in vitro and in vivo.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
G of –8 kcal/mol or less were analyzed with mfold (19, 20) to generate graphical representations of all available folds. These RNA secondary structure graphics were inspected manually to search for stem-loops that could be extended to pseudoknots with similarity to known frameshift stimulators. Protein Sequence Analysis—Searches with the Ma3 protein sequence were conducted with Psi-BLAST (21) in the nr data base at NCBI. Supplemental Table S2 shows the species and accession number of sequences considered to be homologs to Ma3. Sequences were searched for protein coding domains with the HMMER algorithm using the Pfam data base (22). Protein sequences from orthologs of the Ma3 gene in human, chimp, macaque, orangutan, mouse, and rat were aligned with ClustalX (23). Columns that contained any gaps were removed, and a phylogenetic tree was bootstrapped by the neighbor joining method also using ClustalX. The trees were prepared for publication with TreeView (24).
Construction of Clones for in Vitro and in Vivo Frameshifting Assays—The 435-nt region of Ma3 containing the shift site and potential kissing loops sequence was amplified by PCR using primers ATATTAGGTCACCAGGCTGCAGTTGAGTCGGGAAAC and ATATTAGGTACCAGGGGTGGTTGGATGAGCAGGAC (BstEII and KpnI restriction sites underlined) for the GST-
-globin vector, pGB01 (25). Either a human brain cDNA library (Invitrogen) or human genomic DNA (Promega) was used as template for the PCRs. Following amplification, the products were restricted and run on an agarose gel. The correct sized fragments were isolated from a gel slice and ligated into BstEII/KpnI-digested pGB01. A series of deletions was generated using primers to the appropriate 3' sequence and cloned as above. For the constructs containing mutations in the human Ma3 pseudoknot sequence or WT mouse Ma 3 and human Ma 5, complementary oligonucleotides were synthesized containing the overhangs for BstEII and KpnI.
The polylinker region of the dual luciferase vector, p2luc (26) was modified to introduce additional cloning sites. A region of p2luc was amplified by PCR using the following primers: ATATAAGTCGACTTGGATCCCCCGGGGAGCTCAGATCTACGGGCCCTCTCGAGGAAGACGCCAAAAACATAAAGAAAGGC (SalI, BamHI, SmaI, SacI, BglII, ApaI, and XhoI sites underlined) and CCAGAGGAATTCCATTA TCAGTGCAATTGTTTTGTC (EcoRI site underlined). The 692-bp PCR fragment was digested with SalI and EcoRI and ligated into p2luc, also digested with SalI and EcoRI, generating the vector, p2lucj. The human Ma3 pseudoknot sequence was introduced on complementary oligonucleotides containing the overhangs for SalI and XhoI that were cloned into the SalI/XhoI-digested p2lucj. All of the sequences were verified by automated dideoxy sequencing.
In Vitro Frameshifting Assays—100 
g of plasmid DNA from the GST--globin constructs was added to a 10-µl TNT T7-coupled transcription/translation rabbit reticulocyte lysate (Promega). Incubations were carried out at 30 °C for 1 h. Following treatment with 100 µg/ml RNase A at room temperature for 10 min, 30 µl of SDS sample buffer was added. The products were separated by 15% SDS-PAGE, and the gels were fixed, dried, and exposed to a phosphorimaging screen. The data were collected on a Molecular Dynamics phosphorimaging instrument and analyzed by ImageQuant software. The frameshifting efficiencies were determined by normalizing for the number of methionine residues in each product and calculating the percentage of frameshifting [frameshift/(termination + frameshift)] x 100%. The WT human Ma3 pseudoknot sequence promotes frameshifting at 20%. The efficiencies of the mutant, mouse Ma3, and human Ma5 sequences are reported relative to WT Ma3 (100%). All of the constructs were assayed at least three times, and the average is reported.
In Vivo Frameshifting Assays—The dual luciferase assays were performed as previously described (9).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
The potential frameshift site in Ma3, G GGA AAC, is followed by a 6-nt spacer and a predicted classical H-type pseudoknot. The Ma3 sequence further 3' of the predicted pseudoknot was inspected, and two additional potential stem-loop structures were discovered, the loops of which could interact with the first stem-loop to form kissing loops (Fig. 1A). Therefore, the region tested encompassed the potential kissing loops sequence (411 nt 3' of the putative frameshift site) that included the potential pseudoknot.
The –1 Frameshift Event Is Efficient in Reticulocyte Lysates—To determine whether the predicted frameshift site in Ma3 is functional, the region including 15 nt 5' and 411 nt 3' of the G GGA AAC frameshift site was amplified by PCR. The region was cloned between two ORFs, glutathione S-transferase, and rabbit -globin, such that –1 frameshifting was required for expression of the 3' ORF. The vector, pGB01, contained a T7 promoter, and frameshifting activity was monitored in a coupled transcription/translation rabbit reticulocyte lysate system. The cloned region of the Ma3 sequence, +411, promoted –1 frameshifting at a level of 20% (Fig. 1B). To investigate the importance of the potential RNA structures, a series of deletions was constructed that successively removed the predicted structural elements, and the effects on –1 frameshifting were measured. Removal of the potential distal and proximal kissing loop structures, as well as sequences 3' of the potential pseudoknot, constructs +374, +271, +198, and +122, had a small positive effect on the frameshifting (Fig. 1B and Table 1). The potential pseudoknot sequence, +53, supported frameshifting at the same level as the sequence encompassing both the potential proximal and distal kissing loops. In contrast, a construct containing only the first stem-loop of the predicted pseudoknot, +37, showed a dramatic reduction in frameshifting to 25% of the entire pseudoknot sequence (WT). Interestingly, when U34 was changed to C in the construct containing only the first stem-loop (+37 C34), allowing the formation of a G-C pair in place of a G:U wobble pair, frameshifting was observed at 54% of the wild type level (Table 1). The basal level of frameshifting with the G GGA AAC shift site and the 6-nt spacer (+6) was 4% of WT (Fig. 1B and Table 1). Mutation of the frameshift site to C GGC AAC to prevent tandem tRNA slippage further reduced frameshifting to 1% of WT (Fig. 1B and Table 1).
|
|
The disruptive mutations in stem 2 also showed a greatly reduced level of frameshifting, C23, 9%; G24, 4%; C23G24, 3%; G50, 14%; C49, 19%; and C49G50, 14% of WT (Fig. 2C, lanes 3–8, and Table 1). The restorative constructs resulted in frameshifting levels relative to WT of 120% for C23:G50, 74% for G24:C49, and 81% for C23G24::C49G50 (Fig. 2C, lanes 9–11, and Table 1). It is interesting to note that restoring stem 2 resulted in activity closer to the wild type level than for restoring stem 1, as has been observed for other recoding stimulator pseudoknots (27, 28).
Other features of the pseudoknot were tested by making mutations. Changing the sequence of loop 1 from CA to GU, G18U19, had a positive effect on frameshifting (120% of WT) (Fig. 2B, lane 9, and Table 1). The presence of a presumptive unpaired A26 residue between stems 1 and 2 is reminiscent of the "bulged" A that induces a kink between two stems and is required for efficient frameshifting at the gag-pro junction in mouse mammary tumor virus (29, 30). When the A26 residue was changed to C, C26, frameshifting was reduced to 21% of WT (Fig. 2C, lane 13, and Table 1). More strikingly, when A26 was deleted, frame-shifting was virtually eliminated, 3% of WT (Fig. 2C, lane 12, and Table 1), indicating the importance of the A residue and raising the possibility that it is responsible for causing a required kink between the stems.
Ma5 and other Ma3 genes contain a putative –1 frameshift site, G GGA AAC, followed by a potential pseudoknot (see below). The frameshift regions from human Ma5 and mouse Ma3 were tested for activity in reticulocyte lysates. The human Ma5 sequence was 54% as efficient as the human Ma3 sequence, whereas the mouse Ma3 sequence was 75% as efficient (Table 1). There are five nucleotide differences between the mouse and human Ma3 pseudoknot regions. One change, U34 
C replaces a G:U wobble pair in stem 1 in human Ma3 with a G-C pair, which should increase the thermodynamic stability of the stem. The effect of the G10-C34 base pair in the context of the human Ma3 pseudoknot is to increase frameshifting to 150% of WT (Fig. 2B, lane 8, and Table 1). Two of the other nucleotide differences between the mouse and human sequences occur in the spacer region. Replacement of G1 by A or A5 by G in the human sequence resulted in 52 and 115% of WT frameshifting (Table 1). The remaining two nucleotide differences occur in the loop regions of the pseudoknot. Replacing C18 in loop 1 with G or G40 in loop 2 with A in the human sequence increased frameshifting to 108 and 120% of WT, respectively (Table 1).
|
|
|
Orthologs in Other Organisms—Homology searches with BLAST (21) using human paraneoplastic Ma3 sequence revealed similar Ma3 genes in mouse, rat, chimpanzee, and macaque. The alignment of the pseudoknot sequences shows that the stem regions are highly conserved, whereas there are some differences in the spacer and loops (currently the only chimp sequence available ends at the zero frame terminator codon within the pseudoknot). In the rodents, stem 1 is strengthened by the replacement of the G-U wobble pair (in primates) with a G-C pair. Although these species are closely related, the fact that mutations in the pseudoknot region appear to be accumulating preferentially in the loop and spacer regions suggests selection for the pseudoknot.
Family of Ma Genes—There are currently six genes in the human genome annotated as being part of the paraneoplastic Ma family. These are designated Ma1, Ma2, Ma3, MAOP-1 (Ma4), Ma5, and PNMA6A. We will use Ma6 to refer to PNMA6A in this paper. Each of the sequences was analyzed for frameshifting features and protein coding domains. All of the Ma genes show homology to the same region of various retrotransposon Gag proteins (Fig. 3), although only the Ma2 and Ma3 genes have homology that are assigned e values of less than 0.001 by the HMMER algorithm (22). Ma3 is the only member of the family to contain a CCHC zinc finger. As noted above, Ma5 has the same G GGA AAC shift site and a pseudoknot, distinct but similar in both sequence and structure to the Ma3 pseudoknot. Although Ma6 sequence has the potential to form a strong stem-loop or pseudoknot near the end of ORF1, it is quite different in both structure and sequence from the pseudoknot in Ma3. None of the other Ma genes contain a classical retroviral shift site including the G GGA AAC motif found in Ma3.
Phylogenetic analysis of the members of the Ma gene family from various mammals shows that the Ma3 genes from orangutan and crabeating macaque (NCBI GenBankTM accession numbers CR861370 [GenBank] .1 and AB062932 [GenBank] , respectively) cluster with the Ma2 genes from the other species (Fig. 4). Closer analysis of these gene sequences reveals that they have clearly been incorrectly annotated and are, in fact, Ma2 genes.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
Interestingly, searches for homology to the Ma3 protein using Psi-BLAST (21) reveal that the best homology hits in the sequence data bases are to retroelements from Japanese rice. In these retroelements, however, a single frame encodes the Gag-Pol polyprotein (as is the case with most retroelements in plants (31)), whereas Ma3 clearly has a retrovirus-like –1 frameshifting mechanism. This similarity could have resulted from an artifact of the Psi-BLAST search algorithm; inferring phylogeny from homology is not always accurate. It could also suggest that the history of the Ma family of genes is more complex than straight-forward descent from a single retroelement.
Proteins encoded by mobile genetic elements occasionally evolve to assume cellular roles (32, 33). It is perhaps not surprising that a proportion of them also utilize frameshifting, which is well known in the decoding of retroviruses and, to an increasing extent, in retroelements (31, 34), including in mammalian cells (35), yeast (36), and Drosophila (37).
There is a family of Ma genes that includes Ma1, Ma2, Ma3, Ma4 (MOAP-1), Ma5, and Ma6. All of the genes identified thus far in this family are single copy. Ma1 and Ma4 are on chromosome 14, Ma2 is on chromosome 8, and Ma3, Ma5, and Ma6 are on the X chromosome. Although little work has been done on any of these genes, they are known to be expressed in brain as well as other tissues and are also expressed in a range of tumors. Serious neurological phenotypes are associated with tumor expression of the these proteins. Paraneoplastic Ma3 genes have been found in human, chimpanzee, macaque, mouse, and rat. All five of these sequences preserve the G GGA AAC motif and the 3' pseudoknot (except for the incomplete chimp sequence as noted above). There is variation between the primate and rodent sequences in the region of the pseudoknot, but these variations lie within presumptive single-stranded regions with the exception of a G:U wobble pair in the primate stem 1 that is replaced by a G-C pair in rodents. Interestingly, although Ma3 and Ma5 genes have active –1 frameshifting sites, the retroelements to which they are most closely related have Gag-Pol polyproteins encoded by a single frame. The other Ma genes do not contain a retroviral shift motif or a pseudoknot.
Among the Ma3 gene sequences from various species, the protein sequence of the putative ORF2 appears to be much less conserved than ORF1. The ORF2 protein has no similarities to any known protein in public sequence data bases. Although long evolutionary conservation is a hallmark of functional importance, the products of certain ORFs, including those involved in human brain function, may be subject to recent selection and be less matched than average to mouse counterpart genes.
A classical H-type pseudoknot has been shown to promote efficient –1 frameshifting at a retrovirus-like shifty heptanucleotide sequence in the human Ma3 gene. It is very similar to the well characterized infectious bronchitis virus (IBV) pseudoknot in the lengths of stems 1 and 2 (6, 38). Notably, the base of IBV stem 1 is a G-C pair, whereas it is a U-A pair in Ma 3. Loop 2 in the Ma3 pseudoknot is 10 nt, shorter than the 32-nt loop 2 in its IBV counterpart, but reduction of IBV loop 2 to 8 nt does not affect its frameshifting efficiency (39).
Although the potential exists for interactions between the first stemloop of the Ma3 pseudoknot and distant sequences 3' to form kissing loops, these interactions are not necessary to promote the –1 frameshift event as shown by a 3'-deletion series. In the human Ma3 pseudoknot, mutations at the top of stem 1 (C15C16 and G28G29) are more detrimental than those at the base of stem 1 (C8C9 and G35G36). The two constructs designed to restore base pairing in stem 1 gave lower levels of frameshifting than the wild type pseudoknot sequence. This has been observed for other recoding stimulatory pseudoknots and may indicate a primary sequence requirement or reflect subtle structural or thermodynamic effects. In the Ma3 pseudoknot, the disruptive mutations in stem 2 were asymmetric in that mutations to the 3' part of the stem were less detrimental than those to the 5' part of the stem. However, the restorative mutations resulted in frameshifting activities closer to the wild type level. Although only one mutant loop 1 sequence was tested, it had a slight positive effect on frameshifting, indicating at least some flexibility in sequence requirements.
Perhaps the most striking similarity with a subset of frameshift stimulating pseudoknots is the critical importance of the A residue at the junction of stems 1 and 2. Deletion of this residue effectively eliminated frameshifting, whereas changing the A to a C reduced frameshifting by 5-fold. The importance of an A residue at the stem junction indicates that its function may be to induce a required kink between the two stems as is the case in the mouse mammary tumor virus gag-pro (30, 40) and feline immunodeficiency virus (41) pseudoknots.
A minority of the known cases of programmed –1 frameshifting, especially those in bacteria, utilize a simple or elaborated stem-loop rather than a pseudoknot as their 3' recoding stimulator. The list includes IS911 (42), human immunodeficiency virus gag-pol (43–45), an RNA polymerase-encoding sequence of a human astrovirus (46), and E. coli dnaX, which encodes DNA polymerase III subunits (47). However, in general, the investigated –1 frameshift stimulatory pseudoknots are not effectively replaceable by even strengthened versions of their component stem 1 (6). In contrast, the first stem-loop alone of the Ma3 pseudoknot shows considerable activity, and when the stem-loop is strengthened by replacing a G:U wobble pair with a G-C pair, the structure is 50% as efficient as the pseudoknot. Without detailed structural knowledge of the pseudoknot, it is difficult to understand how mutations that disrupt base pairing in stem 2 can have more severe detrimental effects on frameshifting than the absence of stem 2. Perhaps there are tertiary interactions involving stem 2 and other regions of the pseudoknot that directly or indirectly affect stem 1. A mutation in stem 2 could then theoretically interfere with the structure of stem 1 and eliminate its stimulatory activity observed when stem 2 is not present. (A related finding was reported for a stem-loop sequence within loop 2 of the stimulatory pseudoknot for –1 frameshifting in SARS-CoV. The deletion of the stem-loop sequence had no appreciable effect, whereas mutations within the stem-loop sequence reduced frameshifting significantly (9, 48, 49).) Alternatively, the activity of the stem-loop may be artificially high because two sequences, GGUUC and GGCUC, further 3' in the vector sequence can potentially base pair with the stem-loop to form pseudoknots with large loops 2 (131 or 195 nt, respectively). Previous work has shown that the stability of stimulatory stem-loops is correlated with the level of frameshifting (47, 50) and that flanking sequences, including the spacer, can influence the level of frameshifting mediated by particular structures or sequences (51, 52) The 3' stimulator cannot be considered in isolation. This is exemplified by comparison of the mouse and human Ma3 pseudoknot sequences, which differ by 5 nt. One of these differences creates the potential for a stronger stem 1 in the mouse pseudoknot because of a G10-C34 base pair replacing G:U. The prediction was that the mouse Ma3 pseudoknot would be more efficient at promoting –1 frameshifting than the human version, but unexpectedly, the mouse pseudoknot was only 75% as efficient. The most likely explanation for the reduced activity is the A residue immediately 3' to the shift site, because this change made alone in the human pseudoknot reduced frameshifting by 50%.
The degree of importance of frameshifting for the expression of transframe products in human PEG10, Ma3, Ma5, and other genes that may utilize programmed –1 frameshifting is of great relevance when considering the utility of compounds being sought to affect frameshifting efficiency as pharmaceuticals (53). For instance, although this approach could be important in altering the critical Gag to Gag-Pol ratio of retroviruses (54) and in the treatment of human genetic disorders that result from frameshift mutations, an understanding of the extent and importance of frameshifting in the human genome is critical because of the possible side effects of such therapeutics. The search for new cases of recoding in this report is based on finding examples of the well established –1 frameshifting model exhibited in retroviruses. Many other types of recoding are known to be utilized by living systems in a host of functional ways. What more will we discover as we continue to learn how eukaryotes utilize translational recoding as a rich source of proteomic diversity?
|
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grants GM71853 (to R. F. G.) and GM48152 (to J. F. A.), who was also supported by an award from Science Foundation Ireland. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 
The on-line version of this article (available at http://www.jbc.org) contains supplemental Table S2.
1 To whom correspondence should be addressed: Dept. of Human Genetics, 15 N. 2030 E., Bldg. 533, Rm. 7410, Salt Lake City, UT 84112-5330. Tel.: 801-585-3434; Fax: 801-585-3910; E-mail: john.atkins{at}genetics.utah.edu.
2 The abbreviations used are: nt, nucleotide(s); ORF, open reading frame; GST, glutathione S-transferase; WT, wild type; IBV, infectious bronchitis virus; KL, kissing loop.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  M. B. Clark, M. Janicke, U. Gottesbuhren, T. Kleffmann, M. Legge, E. S. Poole, and W. P. Tate Mammalian Gene PEG10 Expresses Two Reading Frames by High Efficiency 1 Frameshifting in Embryonic-associated Tissues J. Biol. Chem., December 28, 2007; 282(52): 37359 - 37369. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. P. Ivanov and J. F. Atkins Ribosomal frameshifting in decoding antizyme mRNAs from yeast and protists to humans: close to 300 cases reveal remarkable diversity despite underlying conservation Nucleic Acids Res., March 19, 2007; 35(6): 1842 - 1858. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Jacobs, A. T. Belew, R. Rakauskaite, and J. D. Dinman Identification of functional, endogenous programmed -1 ribosomal frameshift signals in the genome of Saccharomyces cerevisiae Nucleic Acids Res., January 12, 2007; 35(1): 165 - 174. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Cobucci-Ponzano, F. Conte, D. Benelli, P. Londei, A. Flagiello, M. Monti, P. Pucci, M. Rossi, and M. Moracci The gene of an archaeal {alpha}-L-fucosidase is expressed by translational frameshifting Nucleic Acids Res., September 10, 2006; 34(15): 4258 - 4268. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. M. Wills and J. F. Atkins The potential role of ribosomal frameshifting in generating aberrant proteins implicated in neurodegenerative diseases RNA, July 1, 2006; 12(7): 1149 - 1153. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |
