Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M511629200 on January 5, 2006

J. Biol. Chem., Vol. 281, Issue 11, 7082-7088, March 17, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
281/11/7082    most recent
M511629200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wills, N. M.
Right arrow Articles by Atkins, J. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wills, N. M.
Right arrow Articles by Atkins, J. F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A Functional –1 Ribosomal Frameshift Signal in the Human Paraneoplastic Ma3 Gene*Formula

Norma M. Wills{ddagger}, Barry Moore{ddagger}, Andrew Hammer{ddagger}, Raymond F. Gesteland{ddagger}, and John F. Atkins{ddagger}§1

From the {ddagger}Department of Human Genetics, University of Utah, Salt Lake City, Utah 84112 and the §Biosciences Institute, University College Cork, Cork, Ireland

Received for publication, October 27, 2005 , and in revised form, January 4, 2006.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
A bioinformatics approach to finding new cases of –1 frameshifting in the expression of human genes revealed a classical retrovirus-like heptanucleotide shift site followed by a potential structural stimulator in the paraneoplastic antigen Ma3 and Ma5 genes. Analysis of the sequence 3' of the shift site demonstrated that an RNA pseudoknot in Ma3 is important for promoting efficient –1 frame-shifting. Ma3 is a member of a family of six genes in humans whose protein products contain homology to retroviral Gag proteins. The –1 frameshift site and pseudoknot structure are conserved in other mammals, but there are some sequence differences. Although the functions of the Ma genes are unknown, the serious neurological effects of ectopic expression in tumor cells indicate their importance in the brain.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Although nonoverlapping triplet reading of mRNA codons is the essence of genetic decoding, dynamic nonstandard events at specific sites can permit product diversity and provide regulatory options. One of these recoding events involves shifting to an alternative reading frame by a proportion of ribosomes, thereby changing the linearity of readout. Such utilized frameshifting commonly features both a "shifty site" in the mRNA and an appropriately positioned structural feature in the mRNA that acts to enhance the level of frameshifting, i.e. it is programmed. Although the shift involved can be to either alternative frame, a shift to the –1 frame often involves tRNAs in both the A and P sites detaching from their codons and re-pairing to mRNA at the two overlapping –1 frame codons (1, 2). This tandem detachment and re-pairing usually occurs on a "slippery" heptanucleotide sequence that follows the general pattern of X XXY YYZ where the A and P site tRNAs detach from the zero frame codons XXY YYZ and re-pair after shifting 1 nucleotide to XXX YYY. The spacer region between the shift site and the 3' structural element is commonly 6–8 nt2 (3). The most common 3' recoding signals for –1 frameshifting are pseudoknots (4, 5) with distinct features (6, 7). A less common type of pseudoknot is the kissing stem-loop found in the human coronavirus, HCV229E (8), but bioinformatic studies suggest that it may be involved for transmissible gastroenteritis virus frame-shifting also (9).

Examples of genes that require –1 frameshifting for expression are well known in viral genomes. There is only one demonstrated case of –1 frameshifting in a mammalian cellular gene (10, 11), but it does not display the phylogenetic breadth of the +1 frameshifting utilized in decoding antizyme mRNA, conserved from mammals to yeasts (12). Frameshifting near the end of a coding sequence often allows a proportion of ribosomes to access an ORF that extends beyond the zero frame terminator so that the transframe (coupled ORF) protein is longer than that of standard decoding. The easiest class of –1 programmed frame-shift events to search for is one that has conserved architecture of two ORFs that partially overlap and contains a defined shift site. In these cases conservation of an independent ORF2 helps to distinguish significant candidates from a genomic background that contains sequencing errors and pseudogenes. However, cases such as the Escherichia coli dnaX gene, which utilizes a –1 frameshift to cause a proportion of ribosomes to access a stop codon in the new frame near the frameshift site, demonstrate that frameshifting can be utilized to yield an additional product that lacks a carboxyl-terminal domain of the product of standard decoding. In attempting to identify cases of this nature, searches for two long and partially overlapping ORFs will be fruitless because ORF2 will be wholly contained within the sequence encoding ORF1 and can be small or nonexistent. In addition to identifying an appropriate pair of ORFs that will support a given type of recoding, a specific frameshift site must be identified. The classic heptanucleotide –1 shift site followed by a pseudoknot, as described above, provides a straightforward target for bioinformatic searches. Other possible shift sites are less well defined and thus more complicated to identify. For example, the potential for both A and P site tRNAs to re-pair in the new frame can be difficult to discern (13). In yet other cases, our current knowledge does not adequately predict the likelihood of frameshifting (14, 15). A recent case in point is that reported for the generation of polyalanine runs from long CAG tracts in the MJD-1 transcript (related to a late onset neurodegenerative disorder) where there is no conventional heptanucleotide frame-shift site (16). Diverse approaches are needed to discern the extent to which programmed –1 frameshifting is utilized in decoding eukaryotic cellular genes. Here we report a functional –1 frameshifting site in a mammalian cellular gene, Ma3, identified by a bioinformatic analysis of mRNA sequences searching for a classic heptanucleotide shift site followed by a pseudoknot and contained in the overlap between two ORFs. A counterpart exists in the human Ma5 gene, but the 3' stimulator was not analyzed in detail.

Ma3 and Ma5 are members of a family of mammalian genes whose protein products are the target of immunity associated with paraneoplastic disorders whose symptoms, though associated with tumors elsewhere in the body, are not directly caused by the tumors or the treatment of them. These disorders are often the consequence of an autoimmune response to antigens ectopically expressed in the tumor cells that target the protein(s) normally expressed by the affected cells. Ma1 is expressed in the brain and testis, Ma2 in the brain, and Ma3 in the brain and testis and to a lesser extent in the trachea, kidney, and heart. Immunity to Ma2 and sometimes additional immunity to Ma1 and Ma3 are associated with brainstem encephalitis and cerebral degeneration (17). Our results indicate that the human paraneoplastic antigen Ma3 gene contains a functional heptanucleotide shift sequence and a classical H-type pseudoknot that promotes –1 frameshifting at ~20% efficiency both in vitro and in vivo.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Bioinformatic Analysis—Programs written in Perl were used to analyze 20,763 human mRNA sequences from the RefSeq data base at NCBI (www.ncbi.nlm.nih.gov/RefSeq/). The sequences were searched for ORF pairs in which ORF1 was the annotated coding sequence (CDS) and ORF2 extended at least 300 nt beyond ORF1 and was in the –1 frame relative to it. The overlapping sequences from these 5,709 ORF pairs were searched for the retrovirus-like heptanucleotide shift sites, A AAA AAC, U UUA AAC, G GGA AAC, and U UUU UUA, shown in the zero reading frame (18). For the 1,153 sequences where such a motif was found, a 50-nt region downstream from the shift site was analyzed with the zipfold server (19) to determine the minimum free energy of potential secondary structures. Sequences that had a {Delta}G of –8 kcal/mol or less were analyzed with mfold (19, 20) to generate graphical representations of all available folds. These RNA secondary structure graphics were inspected manually to search for stem-loops that could be extended to pseudoknots with similarity to known frameshift stimulators.

Protein Sequence Analysis—Searches with the Ma3 protein sequence were conducted with Psi-BLAST (21) in the nr data base at NCBI. Supplemental Table S2 shows the species and accession number of sequences considered to be homologs to Ma3. Sequences were searched for protein coding domains with the HMMER algorithm using the Pfam data base (22). Protein sequences from orthologs of the Ma3 gene in human, chimp, macaque, orangutan, mouse, and rat were aligned with ClustalX (23). Columns that contained any gaps were removed, and a phylogenetic tree was bootstrapped by the neighbor joining method also using ClustalX. The trees were prepared for publication with TreeView (24).

Construction of Clones for in Vitro and in Vivo Frameshifting Assays—The 435-nt region of Ma3 containing the shift site and potential kissing loops sequence was amplified by PCR using primers ATATTAGGTCACCAGGCTGCAGTTGAGTCGGGAAAC and ATATTAGGTACCAGGGGTGGTTGGATGAGCAGGAC (BstEII and KpnI restriction sites underlined) for the GST-beta-globin vector, pGB01 (25). Either a human brain cDNA library (Invitrogen) or human genomic DNA (Promega) was used as template for the PCRs. Following amplification, the products were restricted and run on an agarose gel. The correct sized fragments were isolated from a gel slice and ligated into BstEII/KpnI-digested pGB01. A series of deletions was generated using primers to the appropriate 3' sequence and cloned as above. For the constructs containing mutations in the human Ma3 pseudoknot sequence or WT mouse Ma 3 and human Ma 5, complementary oligonucleotides were synthesized containing the overhangs for BstEII and KpnI.

The polylinker region of the dual luciferase vector, p2luc (26) was modified to introduce additional cloning sites. A region of p2luc was amplified by PCR using the following primers: ATATAAGTCGACTTGGATCCCCCGGGGAGCTCAGATCTACGGGCCCTCTCGAGGAAGACGCCAAAAACATAAAGAAAGGC (SalI, BamHI, SmaI, SacI, BglII, ApaI, and XhoI sites underlined) and CCAGAGGAATTCCATTA TCAGTGCAATTGTTTTGTC (EcoRI site underlined). The 692-bp PCR fragment was digested with SalI and EcoRI and ligated into p2luc, also digested with SalI and EcoRI, generating the vector, p2lucj. The human Ma3 pseudoknot sequence was introduced on complementary oligonucleotides containing the overhangs for SalI and XhoI that were cloned into the SalI/XhoI-digested p2lucj. All of the sequences were verified by automated dideoxy sequencing.

In Vitro Frameshifting Assays—100 {eta}g of plasmid DNA from the GST-beta-globin constructs was added to a 10-µl TNT T7-coupled transcription/translation rabbit reticulocyte lysate (Promega). Incubations were carried out at 30 °C for 1 h. Following treatment with 100 µg/ml RNase A at room temperature for 10 min, 30 µl of SDS sample buffer was added. The products were separated by 15% SDS-PAGE, and the gels were fixed, dried, and exposed to a phosphorimaging screen. The data were collected on a Molecular Dynamics phosphorimaging instrument and analyzed by ImageQuant software. The frameshifting efficiencies were determined by normalizing for the number of methionine residues in each product and calculating the percentage of frameshifting [frameshift/(termination + frameshift)] x 100%. The WT human Ma3 pseudoknot sequence promotes frameshifting at ~20%. The efficiencies of the mutant, mouse Ma3, and human Ma5 sequences are reported relative to WT Ma3 (100%). All of the constructs were assayed at least three times, and the average is reported.

In Vivo Frameshifting Assays—The dual luciferase assays were performed as previously described (9).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
A putative –1 frameshift site was identified in the human paraneoplastic antigen Ma3 gene. The original accession for Ma3 was NM_013364 [GenBank] .1, and this sequence was used for the bioinformatic analysis. Shortly after work began on the experimental analysis of Ma3, NM_013364 [GenBank] .1 was updated by NCBI staff to a new version, NM_013364 [GenBank] .2, in which the sequence was revised. An internal region of 121 nt was deleted removing the heptanucleotide shift site. To resolve the conflict between these two sequences, diagnostic PCRs of human brain cDNAs with primers flanking the reported deletion were performed to determine whether the transcript was spliced as indicated by the revised sequence. No evidence for splicing was observed (data not shown). PCR products were also generated from the same cDNA library using primers specific to the 5' coding sequence of the initiating Ma3 reading frame and the 3' coding sequence of the –1 reading frame. These PCR fragments were cloned, and several clones were sequenced. There were no spliced variants, although there was evidence of editing in regions distant from the frameshift site in a minority of cases (data not shown).

The potential frameshift site in Ma3, G GGA AAC, is followed by a 6-nt spacer and a predicted classical H-type pseudoknot. The Ma3 sequence further 3' of the predicted pseudoknot was inspected, and two additional potential stem-loop structures were discovered, the loops of which could interact with the first stem-loop to form kissing loops (Fig. 1A). Therefore, the region tested encompassed the potential kissing loops sequence (411 nt 3' of the putative frameshift site) that included the potential pseudoknot.

The1 Frameshift Event Is Efficient in Reticulocyte Lysates—To determine whether the predicted frameshift site in Ma3 is functional, the region including 15 nt 5' and 411 nt 3' of the G GGA AAC frameshift site was amplified by PCR. The region was cloned between two ORFs, glutathione S-transferase, and rabbit beta-globin, such that –1 frameshifting was required for expression of the 3' ORF. The vector, pGB01, contained a T7 promoter, and frameshifting activity was monitored in a coupled transcription/translation rabbit reticulocyte lysate system. The cloned region of the Ma3 sequence, +411, promoted –1 frameshifting at a level of 20% (Fig. 1B). To investigate the importance of the potential RNA structures, a series of deletions was constructed that successively removed the predicted structural elements, and the effects on –1 frameshifting were measured. Removal of the potential distal and proximal kissing loop structures, as well as sequences 3' of the potential pseudoknot, constructs +374, +271, +198, and +122, had a small positive effect on the frameshifting (Fig. 1B and Table 1). The potential pseudoknot sequence, +53, supported frameshifting at the same level as the sequence encompassing both the potential proximal and distal kissing loops. In contrast, a construct containing only the first stem-loop of the predicted pseudoknot, +37, showed a dramatic reduction in frameshifting to 25% of the entire pseudoknot sequence (WT). Interestingly, when U34 was changed to C in the construct containing only the first stem-loop (+37 C34), allowing the formation of a G-C pair in place of a G:U wobble pair, frameshifting was observed at 54% of the wild type level (Table 1). The basal level of frameshifting with the G GGA AAC shift site and the 6-nt spacer (+6) was 4% of WT (Fig. 1B and Table 1). Mutation of the frameshift site to C GGC AAC to prevent tandem tRNA slippage further reduced frameshifting to 1% of WT (Fig. 1B and Table 1).


View this table:
[in this window]
[in a new window]
 
TABLE 1
The effect of mutations on — 1 frameshifting

 


Figure 1
View larger version (48K):
[in this window]
[in a new window]
 
FIGURE 1.
The cloned region of the human Ma3 gene. A, 15 nt 5' and 411 nt 3' of the GGGAAAC frameshift motif (underlined) were cloned between the coding sequences for GST and rabbit beta-globin (globin). The shaded bases in the first stem-loop can potentially interact with the shaded bases 3' to form a pseudoknot (PK) or kissing loops (KL). The numbers below the line indicate the positions and numbers of Ma3 nucleotides included in the deletions. Numbering starts with the first base 3' of the frameshift site. Two in-frame controls were made by mutating the frameshift site to CGG CAAC C (IFC sequence) shown below the FS site. B, [35S]methionine-labeled in vitro translation products. The sizes of the termination and frameshift products are indicated by the brackets on the right. The two outside lanes show the in-frame control products of the kissing loops sequence (+411) and the pseudoknot sequence (+53).

 
Testing the Potential Pseudoknot Structure in Vitro—Sequences containing the presumptive pseudoknot were sufficient to stimulate a high level of –1 frameshifting. The pseudoknot structure was tested by making disruptive mutations in stems 1 and 2 as well as double mutations that restored the base pairing in the stems (Fig. 2A). The disruptive mutations in stem 1, C8C9, C15C16, G35G36, and G28G29 gave drastic reductions in –1 frameshifting, to 4, 3, 8, and 2% of WT, respectively (Fig. 2B, lanes 2–5, and Table 1). In constructs where the compensatory mutations would restore base pairing in stem 1, –1 frameshifting was observed at 62 (C8C9::G35G36) and 42% (C15C16::G28G29) of WT (Fig. 2B, lanes 6 and 7, and Table 1).

The disruptive mutations in stem 2 also showed a greatly reduced level of frameshifting, C23, 9%; G24, 4%; C23G24, 3%; G50, 14%; C49, 19%; and C49G50, 14% of WT (Fig. 2C, lanes 3–8, and Table 1). The restorative constructs resulted in frameshifting levels relative to WT of 120% for C23:G50, 74% for G24:C49, and 81% for C23G24::C49G50 (Fig. 2C, lanes 9–11, and Table 1). It is interesting to note that restoring stem 2 resulted in activity closer to the wild type level than for restoring stem 1, as has been observed for other recoding stimulator pseudoknots (27, 28).

Other features of the pseudoknot were tested by making mutations. Changing the sequence of loop 1 from CA to GU, G18U19, had a positive effect on frameshifting (120% of WT) (Fig. 2B, lane 9, and Table 1). The presence of a presumptive unpaired A26 residue between stems 1 and 2 is reminiscent of the "bulged" A that induces a kink between two stems and is required for efficient frameshifting at the gag-pro junction in mouse mammary tumor virus (29, 30). When the A26 residue was changed to C, C26, frameshifting was reduced to 21% of WT (Fig. 2C, lane 13, and Table 1). More strikingly, when A26 was deleted, frame-shifting was virtually eliminated, 3% of WT (Fig. 2C, lane 12, and Table 1), indicating the importance of the A residue and raising the possibility that it is responsible for causing a required kink between the stems.

Ma5 and other Ma3 genes contain a putative –1 frameshift site, G GGA AAC, followed by a potential pseudoknot (see below). The frameshift regions from human Ma5 and mouse Ma3 were tested for activity in reticulocyte lysates. The human Ma5 sequence was 54% as efficient as the human Ma3 sequence, whereas the mouse Ma3 sequence was 75% as efficient (Table 1). There are five nucleotide differences between the mouse and human Ma3 pseudoknot regions. One change, U34 -> C replaces a G:U wobble pair in stem 1 in human Ma3 with a G-C pair, which should increase the thermodynamic stability of the stem. The effect of the G10-C34 base pair in the context of the human Ma3 pseudoknot is to increase frameshifting to 150% of WT (Fig. 2B, lane 8, and Table 1). Two of the other nucleotide differences between the mouse and human sequences occur in the spacer region. Replacement of G1 by A or A5 by G in the human sequence resulted in 52 and 115% of WT frameshifting (Table 1). The remaining two nucleotide differences occur in the loop regions of the pseudoknot. Replacing C18 in loop 1 with G or G40 in loop 2 with A in the human sequence increased frameshifting to 108 and 120% of WT, respectively (Table 1).


Figure 2
View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 2.
Testing the importance of the pseudoknot structure. A, the predicted structure of the pseudoknot located 6 nt 3' of the frameshift site in human Ma3. The frameshift site (underlined), spacer region, stem 1, loop 1, loop 2, and stem 2 are labeled. The shaded nucleotides were mutated and tested for their effects on –1 frameshifting. The boxed nucleotides are different in the mouse Ma3 sequence. B and C, [35S] methionine-labeled invitro translation products. The sizes of the termination and frameshift products are indicated by the arrows on the right. The lanes are numbered and labeled by the difference(s) from the wild type sequence. In addition, the region of the pseudoknot affected is indicated above each lane. In lane 12 in C, the termination product is larger because of deletion of A26, which changes the position of the zero frame stop codon.

 


Figure 3
View larger version (8K):
[in this window]
[in a new window]
 
FIGURE 3.
Comparison of the family of Ma genes from human. The shaded regions indicate homology with retrotransposon Gag proteins. The zinc finger region of Ma3 is shown. The Ma3 and Ma5 genes contain a shifty heptanucleotide sequence and an RNA pseudoknot with the putative ORF2 shown in black.

 


Figure 4
View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 4.
Phylogenetic tree of the Ma gene family members. Bt, Bos tarus; Cf, Canis familiaris; Hs, Homo sapiens; Mf, Macaca fascicularis; Mm, Mus musculus; Pp, Pongo pygmaeus; Pt, Pan troglodytes; Rn, Rattus norvegicus.

 
Testing the Pseudoknot Sequence in Vivo—The human Ma3 pseudoknot sequence promotes efficient –1 frameshifting in vitro.To test whether frameshifting is functional in vivo, the pseudoknot region was cloned into a dual luciferase reporter where expression of the 3' reporter, firefly luciferase, is dependent on –1 frameshifting. The plasmids were transfected into HEK 293 cells, and Renilla and firefly luciferase activities were measured in cell lysates. The Ma3 pseudoknot promoted –1 frameshifting at a level of 18%, comparable with the in vitro level of 20% (data not shown).

Orthologs in Other Organisms—Homology searches with BLAST (21) using human paraneoplastic Ma3 sequence revealed similar Ma3 genes in mouse, rat, chimpanzee, and macaque. The alignment of the pseudoknot sequences shows that the stem regions are highly conserved, whereas there are some differences in the spacer and loops (currently the only chimp sequence available ends at the zero frame terminator codon within the pseudoknot). In the rodents, stem 1 is strengthened by the replacement of the G-U wobble pair (in primates) with a G-C pair. Although these species are closely related, the fact that mutations in the pseudoknot region appear to be accumulating preferentially in the loop and spacer regions suggests selection for the pseudoknot.

Family of Ma Genes—There are currently six genes in the human genome annotated as being part of the paraneoplastic Ma family. These are designated Ma1, Ma2, Ma3, MAOP-1 (Ma4), Ma5, and PNMA6A. We will use Ma6 to refer to PNMA6A in this paper. Each of the sequences was analyzed for frameshifting features and protein coding domains. All of the Ma genes show homology to the same region of various retrotransposon Gag proteins (Fig. 3), although only the Ma2 and Ma3 genes have homology that are assigned e values of less than 0.001 by the HMMER algorithm (22). Ma3 is the only member of the family to contain a CCHC zinc finger. As noted above, Ma5 has the same G GGA AAC shift site and a pseudoknot, distinct but similar in both sequence and structure to the Ma3 pseudoknot. Although Ma6 sequence has the potential to form a strong stem-loop or pseudoknot near the end of ORF1, it is quite different in both structure and sequence from the pseudoknot in Ma3. None of the other Ma genes contain a classical retroviral shift site including the G GGA AAC motif found in Ma3.

Phylogenetic analysis of the members of the Ma gene family from various mammals shows that the Ma3 genes from orangutan and crabeating macaque (NCBI GenBankTM accession numbers CR861370 [GenBank] .1 and AB062932 [GenBank] , respectively) cluster with the Ma2 genes from the other species (Fig. 4). Closer analysis of these gene sequences reveals that they have clearly been incorrectly annotated and are, in fact, Ma2 genes.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
In this systematic search for new cases of recoding, the first mammalian cellular gene identified with a classic –1 programmed shift site and stimulatory pseudoknot was human Ma3. The Ma3 gene has many features similar to retroelements including conservation of a well defined zinc finger and other regions of the Gag protein from several retrotransposons. However, none of the Ma family of genes code for domains in the Pol protein, i.e. aspartyl protease, reverse transcriptase, or integrase, and thus, they are certainly not associated with any active retroelements. The only previously known mammalian gene to utilize –1 programmed frameshifting in its expression, edr (embryonal carcinoma differentiation regulated) in mice (10, 11) and PEG10, the homolog in humans, resembles Ma3 in having homology to retroelement gag genes. The CCHC-zinc fingers are similar in Ma3 and edr, but the other retrovirus-like feature in edr, a putative aspartyl protease catalytic site, is absent in Ma3.

Interestingly, searches for homology to the Ma3 protein using Psi-BLAST (21) reveal that the best homology hits in the sequence data bases are to retroelements from Japanese rice. In these retroelements, however, a single frame encodes the Gag-Pol polyprotein (as is the case with most retroelements in plants (31)), whereas Ma3 clearly has a retrovirus-like –1 frameshifting mechanism. This similarity could have resulted from an artifact of the Psi-BLAST search algorithm; inferring phylogeny from homology is not always accurate. It could also suggest that the history of the Ma family of genes is more complex than straight-forward descent from a single retroelement.

Proteins encoded by mobile genetic elements occasionally evolve to assume cellular roles (32, 33). It is perhaps not surprising that a proportion of them also utilize frameshifting, which is well known in the decoding of retroviruses and, to an increasing extent, in retroelements (31, 34), including in mammalian cells (35), yeast (36), and Drosophila (37).

There is a family of Ma genes that includes Ma1, Ma2, Ma3, Ma4 (MOAP-1), Ma5, and Ma6. All of the genes identified thus far in this family are single copy. Ma1 and Ma4 are on chromosome 14, Ma2 is on chromosome 8, and Ma3, Ma5, and Ma6 are on the X chromosome. Although little work has been done on any of these genes, they are known to be expressed in brain as well as other tissues and are also expressed in a range of tumors. Serious neurological phenotypes are associated with tumor expression of the these proteins. Paraneoplastic Ma3 genes have been found in human, chimpanzee, macaque, mouse, and rat. All five of these sequences preserve the G GGA AAC motif and the 3' pseudoknot (except for the incomplete chimp sequence as noted above). There is variation between the primate and rodent sequences in the region of the pseudoknot, but these variations lie within presumptive single-stranded regions with the exception of a G:U wobble pair in the primate stem 1 that is replaced by a G-C pair in rodents. Interestingly, although Ma3 and Ma5 genes have active –1 frameshifting sites, the retroelements to which they are most closely related have Gag-Pol polyproteins encoded by a single frame. The other Ma genes do not contain a retroviral shift motif or a pseudoknot.

Among the Ma3 gene sequences from various species, the protein sequence of the putative ORF2 appears to be much less conserved than ORF1. The ORF2 protein has no similarities to any known protein in public sequence data bases. Although long evolutionary conservation is a hallmark of functional importance, the products of certain ORFs, including those involved in human brain function, may be subject to recent selection and be less matched than average to mouse counterpart genes.

A classical H-type pseudoknot has been shown to promote efficient –1 frameshifting at a retrovirus-like shifty heptanucleotide sequence in the human Ma3 gene. It is very similar to the well characterized infectious bronchitis virus (IBV) pseudoknot in the lengths of stems 1 and 2 (6, 38). Notably, the base of IBV stem 1 is a G-C pair, whereas it is a U-A pair in Ma 3. Loop 2 in the Ma3 pseudoknot is 10 nt, shorter than the 32-nt loop 2 in its IBV counterpart, but reduction of IBV loop 2 to 8 nt does not affect its frameshifting efficiency (39).

Although the potential exists for interactions between the first stemloop of the Ma3 pseudoknot and distant sequences 3' to form kissing loops, these interactions are not necessary to promote the –1 frameshift event as shown by a 3'-deletion series. In the human Ma3 pseudoknot, mutations at the top of stem 1 (C15C16 and G28G29) are more detrimental than those at the base of stem 1 (C8C9 and G35G36). The two constructs designed to restore base pairing in stem 1 gave lower levels of frameshifting than the wild type pseudoknot sequence. This has been observed for other recoding stimulatory pseudoknots and may indicate a primary sequence requirement or reflect subtle structural or thermodynamic effects. In the Ma3 pseudoknot, the disruptive mutations in stem 2 were asymmetric in that mutations to the 3' part of the stem were less detrimental than those to the 5' part of the stem. However, the restorative mutations resulted in frameshifting activities closer to the wild type level. Although only one mutant loop 1 sequence was tested, it had a slight positive effect on frameshifting, indicating at least some flexibility in sequence requirements.

Perhaps the most striking similarity with a subset of frameshift stimulating pseudoknots is the critical importance of the A residue at the junction of stems 1 and 2. Deletion of this residue effectively eliminated frameshifting, whereas changing the A to a C reduced frameshifting by 5-fold. The importance of an A residue at the stem junction indicates that its function may be to induce a required kink between the two stems as is the case in the mouse mammary tumor virus gag-pro (30, 40) and feline immunodeficiency virus (41) pseudoknots.

A minority of the known cases of programmed –1 frameshifting, especially those in bacteria, utilize a simple or elaborated stem-loop rather than a pseudoknot as their 3' recoding stimulator. The list includes IS911 (42), human immunodeficiency virus gag-pol (4345), an RNA polymerase-encoding sequence of a human astrovirus (46), and E. coli dnaX, which encodes DNA polymerase III subunits (47). However, in general, the investigated –1 frameshift stimulatory pseudoknots are not effectively replaceable by even strengthened versions of their component stem 1 (6). In contrast, the first stem-loop alone of the Ma3 pseudoknot shows considerable activity, and when the stem-loop is strengthened by replacing a G:U wobble pair with a G-C pair, the structure is 50% as efficient as the pseudoknot. Without detailed structural knowledge of the pseudoknot, it is difficult to understand how mutations that disrupt base pairing in stem 2 can have more severe detrimental effects on frameshifting than the absence of stem 2. Perhaps there are tertiary interactions involving stem 2 and other regions of the pseudoknot that directly or indirectly affect stem 1. A mutation in stem 2 could then theoretically interfere with the structure of stem 1 and eliminate its stimulatory activity observed when stem 2 is not present. (A related finding was reported for a stem-loop sequence within loop 2 of the stimulatory pseudoknot for –1 frameshifting in SARS-CoV. The deletion of the stem-loop sequence had no appreciable effect, whereas mutations within the stem-loop sequence reduced frameshifting significantly (9, 48, 49).) Alternatively, the activity of the stem-loop may be artificially high because two sequences, GGUUC and GGCUC, further 3' in the vector sequence can potentially base pair with the stem-loop to form pseudoknots with large loops 2 (131 or 195 nt, respectively). Previous work has shown that the stability of stimulatory stem-loops is correlated with the level of frameshifting (47, 50) and that flanking sequences, including the spacer, can influence the level of frameshifting mediated by particular structures or sequences (51, 52) The 3' stimulator cannot be considered in isolation. This is exemplified by comparison of the mouse and human Ma3 pseudoknot sequences, which differ by 5 nt. One of these differences creates the potential for a stronger stem 1 in the mouse pseudoknot because of a G10-C34 base pair replacing G:U. The prediction was that the mouse Ma3 pseudoknot would be more efficient at promoting –1 frameshifting than the human version, but unexpectedly, the mouse pseudoknot was only 75% as efficient. The most likely explanation for the reduced activity is the A residue immediately 3' to the shift site, because this change made alone in the human pseudoknot reduced frameshifting by ~50%.

The degree of importance of frameshifting for the expression of transframe products in human PEG10, Ma3, Ma5, and other genes that may utilize programmed –1 frameshifting is of great relevance when considering the utility of compounds being sought to affect frameshifting efficiency as pharmaceuticals (53). For instance, although this approach could be important in altering the critical Gag to Gag-Pol ratio of retroviruses (54) and in the treatment of human genetic disorders that result from frameshift mutations, an understanding of the extent and importance of frameshifting in the human genome is critical because of the possible side effects of such therapeutics. The search for new cases of recoding in this report is based on finding examples of the well established –1 frameshifting model exhibited in retroviruses. Many other types of recoding are known to be utilized by living systems in a host of functional ways. What more will we discover as we continue to learn how eukaryotes utilize translational recoding as a rich source of proteomic diversity?


    FOOTNOTES
 
Note Added in Proof—A recent study has independently grouped the six human Ma genes in a family (Schüller, M., Jenne, D., and Voltz, R. (2005) J. Neuroimmunol. 169, 172–176).

* This work was supported by National Institutes of Health Grants GM71853 (to R. F. G.) and GM48152 (to J. F. A.), who was also supported by an award from Science Foundation Ireland. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Formula The on-line version of this article (available at http://www.jbc.org) contains supplemental Table S2. Back

1 To whom correspondence should be addressed: Dept. of Human Genetics, 15 N. 2030 E., Bldg. 533, Rm. 7410, Salt Lake City, UT 84112-5330. Tel.: 801-585-3434; Fax: 801-585-3910; E-mail: john.atkins{at}genetics.utah.edu.

2 The abbreviations used are: nt, nucleotide(s); ORF, open reading frame; GST, glutathione S-transferase; WT, wild type; IBV, infectious bronchitis virus; KL, kissing loop. Back


    ACKNOWLEDGMENTS
 
We thank Pavel Baranov, Ivalyo Ivanov, and Mike Howard for help in the analysis of stem-loops and pseudoknots. We also thank Josep Dalmau for valuable discussions.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Jacks, T., Madhani, H. D., Masiarz, F. R., and Varmus, H. E. (1988) Cell 55, 447–458[CrossRef][Medline] [Order article via Infotrieve]
  2. Baranov, P. V., Gesteland, R. F., and Atkins, J. F. (2004) RNA 10, 221–230[Abstract/Free Full Text]
  3. Takyar, S., Hickerson, R. P., and Noller, H. F. (2005) Cell 120, 49–58[CrossRef][Medline] [Order article via Infotrieve]
  4. Brierley, I., Digard, P., and Inglis, S. C. (1989) Cell 57, 537–547[CrossRef][Medline] [Order article via Infotrieve]
  5. ten Dam, E. B., Pleij, C. W., and Bosch, L. (1990) Virus Genes 4, 121–136[CrossRef][Medline] [Order article via Infotrieve]
  6. Brierley, I., and Pennell, S. (2001) Cold Spring Harbor Symp. Quant. Biol. 66, 233–248[CrossRef][Medline] [Order article via Infotrieve]
  7. Pallan, P. S., Marshall, W. S., Harp, J., Jewett, F. C., Wawrzak, Z., Brown, B. A., Rich, A., and Egli, M. (2005) Biochemistry 44, 11315–11322[CrossRef][Medline] [Order article via Infotrieve]
  8. Herold, J., and Siddell, S. G. (1993) Nucleic Acids Res. 21, 5838–5842[Abstract/Free Full Text]
  9. Baranov, P. V., Henderson, C. M., Anderson, C. B., Gesteland, R. F., Atkins, J. F., and Howard, M. T. (2005) Virol. 332, 498–510
  10. Shigemoto, K., Brennan, J., Walls, E., Watson, C. J., Stott, D., Rigby, P. W., and Reith, A. D. (2001) Nucleic Acids Res. 29, 4079–4088[Abstract/Free Full Text]
  11. Manktelow, E., Shigemoto, K., and Brierley, I. (2005) Nucleic Acids Res. 33, 1553–1563[Abstract/Free Full Text]
  12. Ivanov, I. P., Gesteland, R. F., and Atkins, J. F. (2000) Nucleic Acids Res. 28, 3185–3196[Abstract/Free Full Text]
  13. Licznar, P., Mejlhede, N., Prère, M. F., Wills, N. M., Gesteland, R. F., Atkins, J. F., and Fayet, O. (2003) EMBO J. 22, 4770–4778[CrossRef][Medline] [Order article via Infotrieve]
  14. Atkins, J. F., Herr, A. J., Massiere, C., O'Connor, M., Ivanov, I. P., and Gesteland, R. F. (2000) The Ribosome, Structure, Function, Antibiotics and Cellular Interactions (Garrett, R. A., Douthwaite, S. R., Liljas, A., Matheson, A. T., Moore, P. B., and Noller, H. F., eds) pp. 369–383, ASM Press, Washington, D. C.
  15. Griffiths, A., Chen, S. H., Horsburgh, B. C., and Coen, D. M. (2003) J. Virol. 77, 4703–4709[Abstract/Free Full Text]
  16. Toulouse, A., Au-Yeung, F., Gaspar, C., Roussel, J., Dion, P., and Rouleau, G. A. (2005) Hum. Mol. Genet. 14, 2649–2660[Abstract/Free Full Text]
  17. Rosenfeld, M. R., Eichen, J. G., Wade, D. F., Posner, J. B., and Dalmau, J. (2001) Ann. Neurol. 50, 339–348[CrossRef][Medline] [Order article via Infotrieve]
  18. Hatfield, D. L., Levin, J. G., Rein, A., and Oroszlan, S. (1992) Adv. Virus Res. 41, 193–239[Medline] [Order article via Infotrieve]
  19. Zuker, M. (2003) Nucleic Acids Res. 31, 3406–3415[Abstract/Free Full Text]
  20. Mathews, D. H., Sabina, J., Zuker, M., and Turner, D. H. (1999) J. Mol. Biol. 288, 911–940[CrossRef][Medline] [Order article via Infotrieve]
  21. Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997) Nucleic Acids Res. 25, 3389–3402[Abstract/Free Full Text]
  22. Sonnhammer, E. L., Eddy, S. R., Birney, E., Bateman, A., and Durbin, R. (1998) Nucleic Acids Res. 26, 320–322[Abstract/Free Full Text]
  23. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., and Higgins, D. G. (1997) Nucleic Acids Res. 24, 4876–4882
  24. Page, R. D. M. (1996) Comput. Appl. Biosci. 12, 357–358[Free Full Text]
  25. Matsufuji, S., Matsufuji, T., Miyazaki, Y., Murakami, Y., Atkins, J. F., Gesteland, R. F., and Hayashi, S. (1995) Cell 80, 51–60[CrossRef][Medline] [Order article via Infotrieve]
  26. Grentzmann, G., Ingram, J., Kelly, P. J., Gesteland, R. F., and Atkins, J. F. (1998) RNA 4, 479–486[Abstract]
  27. Wills, N. M., Gesteland, R. F., and Atkins, J. F. (1991) Proc. Natl Acad. Sci. U. S. A. 88, 6991–6995[Abstract/Free Full Text]
  28. Chamorro, M., Parkin, N., and Varmus, H. E. (1992) Proc. Natl Acad. Sci. U. S. A. 89, 713–717[Abstract/Free Full Text]
  29. Shen, L. X., and Tinoco, I., Jr. (1995) J. Mol. Biol. 247, 963–978[CrossRef][Medline] [Order article via Infotrieve]
  30. Chen, X., Chamorro, M., Lee, S. I., Shen, L. X., Hines, J. V., Tinoco, I., Jr., and Varmus, H. E. (1995) EMBO J. 14, 842–852[Medline] [Order article via Infotrieve]
  31. Gao, X., Havecker, E. R., Baranov, P. V., Atkins, J. F., and Voytas, D. F. (2003) RNA 9, 1422–1430[Abstract/Free Full Text]
  32. Gao, X., and Voytas, D. F. (2005) Trends Genet. 21, 133–137[CrossRef][Medline] [Order article via Infotrieve]
  33. Ono, R., Nakamura, K., Inoue, K., Naruse, M., Usami, T., Wakisaka-Saito, N., Hino, T., Suzuki-Migishima, R., Ogonuki, N., Miki, H., Kohda, T., Ogura, A., Yokoyama, M., Kaneko-Ishino, T., and Ishino, F. (2006) Nat. Genet. 38, 101–106[Medline] [Order article via Infotrieve]
  34. Stahl, G., Ben Salem, S., Li, Z., McCarty, G., Raman, A., Shah, M., and Farabaugh, P. J. (2001) Cold Spring Harbor Symp. Quant. Biol. 66, 249–258[CrossRef][Medline] [Order article via Infotrieve]
  35. Brandt, J., Veith, A. M., and Volff, J. N. (2005) Cytogenet. Genome Res. 110, 307–317[CrossRef][Medline] [Order article via Infotrieve]
  36. Morris, D. K., and Lundblad, V. (1997) Curr. Biol. 7, 969–976[CrossRef][Medline] [Order article via Infotrieve]
  37. Pardue, M. L., and DeBaryshe, P. G. (2003) Annu. Rev. Genet. 37, 485–511[CrossRef][Medline] [Order article via Infotrieve]
  38. Napthine, S., Liphardt, J., Bloys, A., Routledge, S., and Brierley, I. (1999) J. Mol. Biol. 288, 305–320[CrossRef][Medline] [Order article via Infotrieve]
  39. Brierley, I., Rolley, N. J., Jenner, A. J., and Inglis, S. C. (1991) J. Mol. Biol. 220, 889–902[CrossRef][Medline] [Order article via Infotrieve]
  40. Kang, H., and Tinoco, I. (1997) Nucleic Acids Res. 25, 1943–1949[Abstract/Free Full Text]
  41. Yu, E. T., Zhang, Q., and Fabris, D. (2005) J. Mol. Biol. 345, 69–80[CrossRef][Medline] [Order article via Infotrieve]
  42. Rettberg, C. C., Prère, M. F., Gesteland, R. F., Atkins, J. F., and Fayet, O. (1999) J. Mol. Biol. 286, 1365–1378[CrossRef][Medline] [Order article via Infotrieve]
  43. Dulude, D., Baril, M., and Brakier-Gingras, L. (2002) Nucleic Acids Res. 30, 5094.5102[Abstract/Free Full Text]
  44. Staple, D. W., and Butcher, S. E. (2005) J. Mol. Biol. 349, 1011–1023[CrossRef][Medline] [Order article via Infotrieve]
  45. Gaudin, C., Mazauric, M.-H., Traikia, M., Guittet, E., Yoshizawa, S., and Fourmy, D. (2005) J. Mol. Biol. 349, 1024–1035[CrossRef][Medline] [Order article via Infotrieve]
  46. Marczinke, B., Bloys, A. J., Brown, T. D., Willcocks, M. M., Carter, M. J., and Brierley, I. (1994) J. Virol. 68, 5588–5595[Abstract/Free Full Text]
  47. Larsen, B., Gesteland, R. F., and Atkins, J. F. (1997) J. Mol. Biol. 271, 47–60[CrossRef][Medline] [Order article via Infotrieve]
  48. Plant, E. P., Pérez-Alvarado, G. C., Jacobs, J. L., Mukhopadhyay, B., Hennig, M., and Dinman, J. D. (2005) PLoS Biol. 3, 172[CrossRef]
  49. Su, M.-C., Chang, C.-T., Chu, C.-H., Tsai, C.-H., and Chang, K.-Y. (2005) Nucleic Acids Res. 33, 4265–4275[Abstract/Free Full Text]
  50. Bidou, L., Stahl, G., Grima, B., Liu, H., Cassan, M., and Rousset, J.-P. (1997) RNA 10, 1153–1158
  51. Kim, Y.-G., Maas, S., and Rich, A. (2001) Nucleic Acids Res. 29, 1125–1131[Abstract/Free Full Text]
  52. Bertrand, C., Prère, M. F., Gesteland, R. F., Atkins, J. F., and Fayet, O. (2002) RNA 8, 16–28[Abstract]
  53. Kinzy, T. G., Harger, J. W., Carr-Schmid, A., Kwon, J., Shastry, M., Justice, M., and Dinman, J. D. (2002) Virology 300, 60–70[CrossRef][Medline] [Order article via Infotrieve]
  54. Hung, M., Patel, P., Davis, S., and Green, S. R. (1998) J. Virol. 72, 4819–4824[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
M. B. Clark, M. Janicke, U. Gottesbuhren, T. Kleffmann, M. Legge, E. S. Poole, and W. P. Tate
Mammalian Gene PEG10 Expresses Two Reading Frames by High Efficiency 1 Frameshifting in Embryonic-associated Tissues
J. Biol. Chem., December 28, 2007; 282(52): 37359 - 37369.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
I. P. Ivanov and J. F. Atkins
Ribosomal frameshifting in decoding antizyme mRNAs from yeast and protists to humans: close to 300 cases reveal remarkable diversity despite underlying conservation
Nucleic Acids Res., March 19, 2007; 35(6): 1842 - 1858.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. L. Jacobs, A. T. Belew, R. Rakauskaite, and J. D. Dinman
Identification of functional, endogenous programmed -1 ribosomal frameshift signals in the genome of Saccharomyces cerevisiae
Nucleic Acids Res., January 12, 2007; 35(1): 165 - 174.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
B. Cobucci-Ponzano, F. Conte, D. Benelli, P. Londei, A. Flagiello, M. Monti, P. Pucci, M. Rossi, and M. Moracci
The gene of an archaeal {alpha}-L-fucosidase is expressed by translational frameshifting
Nucleic Acids Res., September 10, 2006; 34(15): 4258 - 4268.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
N. M. Wills and J. F. Atkins
The potential role of ribosomal frameshifting in generating aberrant proteins implicated in neurodegenerative diseases
RNA, July 1, 2006; 12(7): 1149 - 1153.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
281/11/7082    most recent
M511629200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wills, N. M.
Right arrow Articles by Atkins, J. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wills, N. M.
Right arrow Articles by Atkins, J. F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement