Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M506587200 on January 9, 2006

J. Biol. Chem., Vol. 281, Issue 11, 7374-7383, March 17, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/11/7374    most recent
M506587200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bisbis, B.
Right arrow Articles by Chevalier, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bisbis, B.
Right arrow Articles by Chevalier, C.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Cyclin-dependent Kinase (CDK) Inhibitors Regulate the CDK-Cyclin Complex Activities in Endoreduplicating Cells of Developing Tomato Fruit*

Badia Bisbis{ddagger}12, Frédéric Delmas{ddagger}1, Jérôme Joubès§3, Adrien Sicard{ddagger}, Michel Hernould{ddagger}, Dirk Inzé§, Armand Mouras{ddagger}, and Christian Chevalier{ddagger}4

From the {ddagger}Unité Mixte de Recherche 619 en Physiologie et Biotechnologie Végétales, Institut de Biologie Végétale Moléculaire, Institut National de la Recherche Agronomique, Université de Bordeaux 1 et Université Victor Segalen-Bordeaux 2, BP 81, 33883 Villenave d'Ornon Cedex, France and §Department of Plant Systems Biology, Flanders Interuniversity Institute for Biotechnology, Ghent University, B-9052 Gent, Belgium

Received for publication, June 17, 2005 , and in revised form, January 9, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The jelly-like locular (gel) tissue of tomato fruit is made up of large thin-walled and highly vacuolized cells. The development of the gel tissue is characterized by the arrest of mitotic activities, the inhibition of cyclin-dependent kinase A (CDKA) activity, and numerous rounds of nuclear DNA endoreduplication. To decipher the molecular determinants controlling these developmental events, we investigated the putative involvement of CDK inhibitors (p27Kip-related proteins, or KRPs) during the endoreduplication process. Two cDNAs, LeKRP1 and LeKRP2, encoding tomato CDK inhibitors were isolated. The LeKRP1 and LeKRP2 transcript expression was shown to be enhanced in the differentiating cells of the gel undergoing endoreduplication. At the translational level, LeKRP1 was shown to accumulate in the gel tissue and to participate in the inhibition of the CDK-cyclin kinase activities occurring in endoreduplicating cells of the gel tissue. We here propose that LeKRP1 participates in the control of both the cell cycle and the endoreduplication cycle.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Fruit development results from the coordination of cell division and cell expansion, and the control of these two phenomena is a crucial determinant of the final size of fruits. The early development of tomato fruit can be divided into three distinct phases (1) (Fig. 1, A and B). Phase I corresponds to the development of the ovary and the decision to set fruit after successful pollination and fertilization. In phase II the ovary develops in response to fertilization by a series of intense cell division. In phase III fruit growth is mainly sustained by cell expansion leading to a fruit of almost final size that is able to ripen. During this latter phase, the development of the pericarp and the jelly-like locular (gel) tissue (Fig. 1C) is associated with an increase in the nuclear DNA ploidy (2) by endoreduplication (3).

Although endoreduplication is a widespread phenomenon in higher plants, its control and role during plant development are still poorly understood. The endoreduplication cycle or endocycle corresponds to a modified cell cycle lacking mitosis, and as such it utilizes several key cell cycle regulators, including those controlling the G1/S transition (4). Increasing our knowledge of the cell cycle control may lead to the elucidation of the molecular mechanisms underlying endoreduplication. The progression within the plant cell cycle is regulated by a class of heterodimeric protein complexes common to all eukaryotic cells (5). These complexes consist of a catalytic subunit referred to as cyclin-dependent kinase (CDK)5 and a regulatory cyclin subunit whose association determines the activity of the complex, its stability, and its localization and substrate specificity. The activity of the complexes is governed by phosphorylation/dephosphorylation events, availability of the protein partners (synthesis and controlled degradation of the cyclin moiety), and the binding of other proteins such as inhibitors or regulatory factors.

The involvement of CDKs in the control of endoreduplication has been recently demonstrated in maize endosperm cells (6) and in Arabidopsis leaf cells (7). Furthermore, this control is associated with the inhibition of M-phase CDK activity. This has been observed in various plant cells or organs displaying an increase in the DNA ploidy level through endoreduplication, e.g. maize endosperm cells (8), developing tomato fruit tissues (2), and Arabidopsis leaf cells (7). The three mechanisms for the control of CDK complex activity are likely to occur during endoreduplication. The WEE1 inhibitory kinase may play a role in endoreduplicating cells of the maize endosperm (9) and tomato fruit (10). The selective degradation of M-phase-specific cyclins via the activation of the anaphase-promoting complex is likely to be involved in the control of endoreduplicating cells of alfalfa root nodules (11, 12). The involvement of CDK inhibitors in the control of endoreduplication has been more difficult to demonstrate. Their in planta overexpression always resulted in reduced endoreduplication because they are probably able to target a broad spectrum of CDK complexes, including the G1/S-specific ones (13, 14). Recently, Verkest et al. (15) showed that a weak overexpression of the Arabidopsis CDK inhibitor KRP2 inhibited only the mitotic cell cycle-specific CDKA;1 kinase complexes, whereas the endoreduplication cycle-specific CDKA;1 complexes were unaffected. This led to an expected increase in the DNA ploidy level. This study demonstrated for the first time the involvement of a CDK inhibitor in the control of the transition from mitosis to endoreduplication.


Figure 1
View larger version (58K):
[in this window]
[in a new window]
  		FIGURE 1.
Tomato fruit development. A, cell division phase, from anthesis (A) to 8 DPA. B, cell expansion phase, from 10 DPA to the onset of ripening (mature green stage, MG) and ripening phase from MG to red ripe stage, RR. LR, light red. Bar, 1 cm. C, cross-section of a fruit at the MG stage. The various tissues (epidermis, pericarp, and gel) used as the source of mRNA or protein extracts are indicated. Bars, 1 cm. To illustrate the cellular constitution a cross-section of 3-DPA fruit pericarp is given (x100).

 
Tomato fruit is a good model for study of the interconnection between normal cell cycle events and endoreduplication, as its nuclei become highly polyploid during fruit growth, especially in pericarp and locular tissue cells (Fig. 1C) (2). In these tissues, the ploidy can reach levels up to 256 or even 512 C (where C is the DNA content of the haploid genome) that cannot be observed in other model plants such as Arabidopsis or maize (16, 17). At the molecular level, we have shown that the arrest of cell division and subsequent endoreduplication during fruit development are associated with the inhibition of the CDK-cyclin complex (2, 18, 19).

Here we investigated the molecular basis of such mitosis impairment, focusing on the putative involvement of CDK inhibitors. Two cDNAs, LeKRP1 and LeKRP2, encoding tomato CDK inhibitors were isolated. Their expression was associated with differentiating cells of the gel undergoing endoreduplication. At the biochemical level we showed that LeKRP1 could inhibit CDK-cyclin kinase activities in endoreduplicating cells of the gel tissue. These data provide further information on the putative role of KRP in the control of endoreduplication in plant cells.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
cDNA Library Screening—A cDNA library was constructed with poly(A)+ mRNA extracted from the gel tissue of 20-DPA tomato fruits using the ZAP Express cDNA synthesis kit and Gigapack III Gold cloning kit (Stratagene, La Jolla, CA). The cDNA library comprised 1.1 x 106 recombinant plaques. The isolation of full-length cDNA was obtained by screening the library as described previously (2).

Estimation of Relative Transcript Levels with RT-PCR—The relative transcript levels of each cDNA were determined by semiquantitative RT-PCR assays as previously described (2, 18). The specific pairs of primers used for the amplification of the cDNAs were CAACATTCAGACCCCTGGTTCC and GTCTAGAGATGAAACGAGGC for LeKRP1 and GCTGAGCAGCAACAACAACGCC and GACATTGGCTATGTCACCTTGC for LeKRP2. Primers for LeCYCA2;1 and LeActin1 were as described previously (18). RT-PCR experiments were repeated three times.

In Situ Hybridization—Vegetative meristems and flower buds at different developmental stages were fixed according to previously described procedures (19). The LeKRP1 and LeKRP2 templates used for riboprobe synthesis were amplified by PCR using the specific primers described above and cloned into the pGEM-T vector (Promega). Synthesis of digoxygenin-11-rUTP-labeled riboprobes, hybridization, washes, and immunological detection of the hybridized probes were carried out as previously described (19).

Purification of His6-LeKRP1 Recombinant Protein and Antibody Preparation—The open reading frame of LeKRP1 cDNA was inserted into pET28a vector between the BamHI and XhoI sites (Novagen, Madison, WI) to yield the recombinant plasmid pET28a-LeKRP1 and cloned into Escherichia coli strain BL21 (DE3) cells. The induction of the recombinant histidine-tagged LeKRP1 protein and subsequent purification by Ni-NTA column affinity chromatography were performed according to the manufacturer's instructions (Novagen). The His6-LeKRP1 recombinant protein was dialyzed against the following buffer, 50 mM Tris-HCl, pH 7.5, 15 mM MgCl2, 5 mM EGTA, and 1 mM dithiothreitol, and used for rabbit immunization to yield a polyclonal antibody (Eurogentec, Herstal, Belgium). Total IgG was further purified on protein A-agarose using a 1-ml column of HiTrapTM Protein A high performance (Amersham Biosciences).

Protein Extraction, Immunoprecipitation, and Immunodepletion—Epidermis and gel tissues were dissected from tomato fruit and flash frozen in liquid nitrogen prior to protein extraction. They were then ground into a fine powder and stored at -80 °C. For protein extraction, 100 mg of frozen powder was thawed in 1 ml of radioimmune precipitation assay extraction buffer (20 mM Tris-HCl, pH 7.4, 0.1 M NaCl, 5 mM EDTA, 2 mM EGTA, 0.5 mM phenylmethylsulfonyl fluoride, 2 mM NaF, 0.2% (v/v) Nonidet P-40, and 0.1% anti-protease mixture). The cell debris was discarded after a 15-min centrifugation at 18,000 x g at 4 °C.

For immunoprecipitation, 100 µg of total protein from gel tissue in radioimmune precipitation assay buffer was precleared with 20 µl of 25% (v/v) protein A-agarose beads (Santa Cruz Biotechnology, Santa Cruz, CA) for 1 h at 4 °Cona rotating wheel. After a brief centrifugation, the precleared supernatants were incubated overnight at 4 °C in the presence of the LeKRP1 (1:500) antibody. 20 µl of 25% (v/v) protein A-agarose beads were subsequently added, and the mixture was incubated for 2 h at 4 °C on a rotating wheel. After centrifugation, the supernatants were collected and used as the immunodepleted extracts. The pelleted beads were washed twice with phosphate-buffered saline buffer. After a final centrifugation, the immunoprecipitated material was resuspended in 30 µl of Laemmli loading buffer (20). Samples were separated in a 15% SDS-PAGE and transferred to Immobilon-P membrane prior to immunological detection by Western blot analyses using the LeKRP1 (1/600) antibody. Antigen-antibody complexes were detected with horseradish peroxidase-conjugated IgG diluted 1/10,000 (Chemicon, Temecula, CA) with the BM Chemiluminescence blotting substrate (POD) system from Roche Applied Science.

The same procedure was applied for demonstrating the in vivo interaction between LeKRP1 and CDKA, except that 800 µg of total protein from gel tissue were used. A negative control was performed using the preimmune antiserum to precipitate the proteins. Samples were analyzed by Western blot using an anti-PSTAIR (1/1000) antibody (Santa Cruz Biotechnology).

In Vitro Kinase Assay—p9CksHs1 was purified from an overproducing strain of E. coli and linked to CNBr-Sepharose 4B (Amersham Biosciences) according to Azzi et al. (21). A 50-µl aliquot of packed p9CksHs1 protein-Sepharose beads was washed with bead buffer (50 mM Tris, pH 7.4, 5 mM NaF, 250 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Nonidet P40, and anti-protease mixture) and was mixed with the protein extract. The tubes were rotated constantly at 4 °C overnight. After a brief centrifugation at 10,000 x g and removal of the supernatant, the beads were carefully washed three times with bead buffer, once with kinase buffer (50 mM HEPES, pH 7.5, 10 mM MgCl2, 1 mM dithiothreitol), and then used for kinase assay. The histone H1 kinase reaction was initiated by resuspending the pellet of p9CksHs1-Sepharose beads with 30 µl of the reaction mixture containing 1 mg ml-1 histone H1 as the substrate and 2.5 µCi of [{gamma}-32P]ATP (22). Assays were terminated by placing the tube on ice. After a brief centrifugation at 10,000 x g, 10 µl of 4x Laemmli sample buffer was added to the supernatant. Samples were analyzed in a 15% SDS-PAGE, followed by Coomassie Blue staining of the gel to visualize the histone H1 and subsequent autoradiography to detect histone H1 phosphorylation. 30 µl of Laemmli sample buffer was added to the bead pellet, and Western blot analysis was performed to detect CDKA using the anti-PSTAIR (1/1000). Detection of CDKA was performed by standard nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate staining.


Figure 2
View larger version (47K):
[in this window]
[in a new window]
  		FIGURE 2.
Comparison of amino acid sequences of LeKRP1 and LeKRP2 with plant KRPs. A, unrooted neighbor-joining tree of the plant KRPs with the Poisson correction for evolutionary distance calculation. Bootstrap values of 500 bootstrap iterations are shown. Numbers indicate evolutionary distance. The phylogenetic analysis was performed over the last 43 C-terminal residues of the KRPs. Accession numbers are indicated in parentheses. B, sequence alignments of LeKRP1 with Arath;KRP4 and LeKRP2 with Arath;KRP3. Gaps (-) were introduced to maximize the alignments. Conserved motifs in plant KRPs are boxed.

 


Figure 3
View larger version (51K):
[in this window]
[in a new window]
  		FIGURE 3.
Differential expression analysis by semiquantitative RT-PCR of tomato KRP genes in various organs of tomato and during fruit development. A, expression analysis in various organs from tomato plants: young leaves (YL), differentiated leaves (DL), roots (Ro), stems (St), mature seeds (Sd), and inflorescences (In). C1 and C2 correspond to the negative control (absence of cDNA matrix) and positive control (presence of cDNA of interest as a matrix) of PCR, respectively. The LeKRP1 and LeKRP2 mRNA abundances were normalized toward that of Actin1 and expressed as a ratio of arbitrary units for pixel intensities. B, expression analysis in whole fruits harvested at the following developmental stages: A, 3, 5, 8, 10, 15, and 20 DPA and MG. C, expression analysis in the dissected fruit tissues (epidermis, pericarp, and gel) at the following developmental stages: 10, 15, and 20 DPA, MG, and RR.

 
For assaying the retinoblastoma-related protein (RBR) kinase activity, tobacco NtRb1 was expressed using the pGEX-5X-2 plasmid (23) as a glutathione S-transferase-NtRb1 fusion protein and purified by affinity chromatography on glutathione-Sepharose 4B column. Protein extracts were mixed with glutathione S-transferase-NtRb1 immobilized on glutathione-Sepharose 4B beads. Kinase reactions were initiated at 30 °C by adding 5 µCi of [{gamma}-32P]ATP and unlabeled ATP to a final concentration of 30 µM. After 30 min of incubation, the reactions were stopped by adding 30 µl of 2x Laemmli sample buffer and heating at 95 °C for 5 min. The visualization of phosphorylated NtRb1 was as described above. Signals obtained from autoradiography, Western blot, and gel staining were quantified by image scanning using the Quantity One software from Bio-Rad Laboratories (Hercules, CA).

Detection of Protein-Protein Interactions—Protein-protein interactions between LeKRP1 and the different CDK and cyclins were detected by a two-hybrid assay as described previously (19).

Phylogenetic Analysis of Plant KRPs—The sequence analysis of plant KRPs was performed using BioEdit (24), and the phylogenetic tree was constructed with the neighbor-joining algorithm using the software packages TREECON (25). Bootstrap analysis with 500 replicates was performed to test the significance of the nodes.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Molecular Characterization of Two cDNAs Encoding p27Kip1-related Proteins from Tomato—Exploiting the genomic resources of The Institute for Genomic Research (Rockville, MD) Tomato Gene Index (LeGI), we were able to identify two Tentative Consensus (TC) sequences corresponding to cDNAs encoding CDK-specific inhibitors of the plant KRP family (13). TC89204 was 1014 bp and contained a complete open reading frame coding for a 212-amino acid translation product of MW 24.0. TC89097 was a partial sequence of 458 bp harboring a truncated open reading frame. We obtained the corresponding full-length cDNA by screening a "20-DPA tomato gel tissue" cDNA library. The full-length cDNA corresponding to TC89097 was 1061 bp and encoded a 190-amino acid product (MW 19.9).

The sequence similarities of plant KRPs are mostly in the C-terminal part of the proteins (13, 26). Thus the 43-amino acid C termini of the two predicted proteins were used for phylogenetic analysis (Fig. 2A). The translation products corresponding to TC89204 and TC89097 displayed the highest sequence homology with Arath;KRP4 and Arath; KRP3, respectively, rather than their closest evolutionary counterparts from tobacco, Nicta;KRP (26) and Nicsy;KRP (GenBankTM accession number AJ297905 [GenBank] ). As shown in Fig. 2B, they both displayed 73.8% identity with their Arabidopsis counterparts, over the C-terminal 43 residues which encompass domains I, II, and III as defined by De Veylder et al. (13). Based on this phylogenetic and sequence analysis, the two cDNAs were identified as putatively encoding tomato KRPs and thus named LeKRP1 (GenBankTM/EBI accession number AJ441249 [GenBank] for TC89204) and LeKRP2 (GenBankTM/EBI accession number AJ441250 [GenBank] for TC89097).


Figure 4
View larger version (99K):
[in this window]
[in a new window]
  		FIGURE 4.
Analysis of LeKRP1 and LeKRP2 expression at the spatial level. Expression was localized by in situ hybridization of Dig-dUTP antisense LeKRP1 (A, B, D, E, and F) and LeKRP2 (G, H, and I) RNA to mRNA transcripts. Positive hybridization signals correspond to the blue/violet color. LeKRP1 and LeKRP2 sense riboprobes were used as negative controls: a typical pattern of hybridization is shown for LeKRP1 (C). A, longitudinal section of a shoot apical meristem hybridized with LeKRP1 antisense probe showing labeling in the central (CZ) and peripheral zone (PZ) and leaf primordia (lp). Bar, 100µm. B, higher magnification of panel A. Abbreviations are as in panel A. Bar, 100µm. C, negative control hybridization with LeKRP1 sense probe of a longitudinal section of a shoot apical meristem showing the absence of labeling. Bar, 100 µm. D, longitudinal section of a 5-mm flower bud hybridized with LeKRP1 antisense probe showing a heavy labeling in the carpel (ca) and a lighter signal in sepals (se), petals (pe), and stamens (st). Bar, 500 µm. E, higher magnification of panel D showing the heavy labeling in carpels at the level of epidermal cells (ep), carpel wall (cw), and the ovules (ov) according to a patchy pattern. Bar, 100 µm. F, higher magnification of panel E showing the patchy pattern of hybridization at the level of an ovule. Bar, 500 µm. G, longitudinal section of a 7-mm flower bud hybridized with LeKRP2 antisense probe showing a uniform labeling in the whole inflorescence. Abbreviations are as in panel D. Bars, 500 µm. H, higher magnification of panel G showing a uniform labeling in carpels, Bar, 100 µm. Abbreviations are as in panel E. I, higher magnification of panel H showing the uniform labeling at the level of an ovule. Bar, 10 µm.

 
Differential Expression of LeKRP1 and LeKRP2 Genes in Tomato—The transcripts for LeKRP1 accumulated in all plant organs, especially those displaying meristematic activity such as young leaves (YL), roots (Ro), and inflorescences (In) (Fig. 3A). In fully differentiated leaves (DL), the level of LeKRP1 transcripts was much lower. The LeKRP2 transcripts were most abundant in stems (St), and roots and weakly expressed in seeds (Sd) and leaves (YL and DL).

During fruit development, the LeKRP1 and LeKRP2 transcripts were highly expressed very early in the cell division phase (Fig. 3B). After 3 DPA, their respective expression profiles differed. The abundance of LeKRP1 mRNA decreased, reaching its lowest level during the cell expansion phase (8-20 DPA), whereas the abundance of LeKRP2 transcripts decreased gradually, not reaching their lowest level until the mature green (MG) stage.

The different tissues that compose the fruit were dissected to analyze the gene expression from a spatial and developmental perspective. As shown in Fig. 1C, the epidermis tissue per se is composed of a single cell layer. During the tissue preparation fruits were peeled to obtain the epidermis that consists of a few external layers made of small cells. The pericarp corresponds to the fleshy part of the fruit and the gel to the jelly-like locular tissue that surrounds the seeds. The above mentioned difference in the expression profiles of the two tomato KRP genes was also observed during the course of fruit development (Fig. 3C). The maximum expression of LeKRP1 was observed at 20 DPA in all the dissected tissues, especially in the gel tissue where mitosis is impaired and endoreduplication occurs (2) as evidenced by the disappearance of LeCYCA2;1 transcripts. In all three tissues, the expression of LeKRP2 gradually increased to reach its maximum level at the red ripe (RR) stage.

To further characterize LeKRP1 and LeKRP2 gene expression, in situ hybridizations were performed using longitudinal sections of vegetative shoot meristems and developing floral organs (Fig. 4). In vegetative shoot meristems, the in situ hybridization signals using LeKRP1 as a probe were detected in the regions where cell divisions predominantly occur, such as the central and peripheral zones of the meristem and the leaf primordia (Fig. 4, A and B). In 5-mm floral buds, a strong signal was observed in the developing ovules and the carpel wall (Fig. 4D). A higher magnification of the flower bud and an ovule hybridized with LeKRP1 revealed a patchy pattern of expression (Fig. 4, E and F). The hybridization signal obtained with LeKRP2 as a probe was uniformly distributed within the different developing organs of a 7-mm flower bud (Fig. 4G). This uniform distribution was confirmed at the level of the ovules (Fig. 4I) and also observed in every developmental stage of flower buds we analyzed (data not shown). A stronger expression was detected in the epidermis and the 2-3 subepidermal cell layers of the carpel wall (Fig. 4H). These data not only show a differential expression of tomato KRP genes during fruit and plant development but also suggest the involvement of tomato KRPs in endoreduplication during tomato fruit development (2).

LeKRP1 Is a Functional CDK Inhibitor in Vitro—We then focused on the functional analysis of LeKRP1, as its transcriptional expression was maximal at 20 DPA in the developing gel tissue when only endoreduplication occurs (2). LeKRP1 was produced in E. coli as an N-terminal His6-tagged recombinant protein (Fig. 5A, left panel). After purification by Ni-NTA affinity chromatography, the identification of the recombinant His6-tagged LeKRP1 was first ascertained by mass spectrometry analysis after two-dimensional gel separation (data not shown). The specificity of a polyclonal antibody raised against LeKRP1 was then analyzed by immunoblotting of E. coli BL21 (DE3) crude extracts (Fig. 5A, right panel). The antibody reacted clearly with the induced and Ni-NTA-purified recombinant LeKRP1. In addition, an antibody raised against the His tag was used as a positive control and gave similar results, confirming the specificity of the induced LeKRP1 protein (data not shown). As shown below in immunoprecipitation experiments (Fig. 7A), the anti-LeKRP1 antibody was able to react with a single species of protein of the expected molecular mass (23.8 kDa), thus indicating the specificity of the antiserum.

The purified LeKRP1 was then tested for its ability to inhibit the CDK-cyclin kinase activity in in vitro phosphorylation assays using histone H1 as a substrate. Protein extracts were prepared from dissected epidermis tissue, referred to as Epidermis extract, of 20-DPA fruits and used as the source of CDK-cyclin complexes that were then purified by p9CksHs1-affinity chromatography. As shown in Fig. 5B, the addition of 100 ng of purified LeKRP1 prior to p9CksHs1-affinity chromatography (+) resulted in a 57% inhibition of the kinase activity present in the untreated Epidermis extract (-). The effect mediated by LeKRP1 appeared to be specific as the levels of CDKA and histone H1 used as the substrate in the phosphorylation reaction were equally detected in both samples in the absence or in the presence of LeKRP1. Increasing amounts of purified LeKRP1 were then mixed with the Epidermis extract prior to purification of the CDK-cyclin complexes (Fig. 5C). In the presence of added LeKRP1, the kinase activity decreased in a dose-dependent manner. The addition of 100 ng of LeKRP1 resulted in a 60% inhibition of kinase activity. Furthermore, a progressive heat denaturation of the purified LeKRP1 restored the kinase activity. It is noteworthy that treatment at 100 °C for as long as 30 min was necessary to inactivate LeKRP1 totally and to recover the initial level of kinase activity.

LeKRP1 Protein Accumulates in the Gel Tissue during Endoreduplication—In the gel tissue of tomato fruits, the CDK-cyclin kinase activity is strongly regulated at the post-translational level (2). This suggests the presence of an inhibitory mechanism. We therefore investigated whether LeKRP1 could be involved in this inhibition.

As a first step, protein extracts from 20-DPA Epidermis (dividing tissue) were used as a source of CDK-cyclin kinase activity. These extracts were mixed with extracts from 20-DPA gel referred to as Gel extract (endoreduplicating tissue lacking CDK-cyclin histone H1 kinase activity) (2) (Fig. 6). The Epidermis extract displayed a high level of kinase activity, whereas the activity from the Gel extract was insignificant even though CDKA was present. When both extracts were mixed, the kinase activity present in Epidermis extract decreased in a dose-dependent manner. Adding equal amounts of Gel extract and Epidermis extract resulted in 67% inhibition of the kinase activity. By progressively increasing the duration of protein denaturation, the kinase activity of the Epidermis extract was similar to that measured in the absence of Gel extract or after the addition of an equal amount (100 µg) of bovine serum albumin. A treatment of 30 min at 100 °C was necessary to recover 100% of the kinase activity, as previously observed with the exogenously added LeKRP1. Thus the effect of the Gel extract mimicked the effect of purified LeKRP1 on the activity of the CDK-cyclin complex present in epidermis. This indicates that a putative CDK inhibitory protein is expressed in the gel tissue after 20 DPA during endoreduplication (2).


Figure 5
View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 5.
In vitro functional analysis of LeKRP1. A, generation of a specific antiserum raised against LeKRP1. Left panel, SDS-PAGE performed with crude protein extracts from uninduced pET28a-LeKRP1 (-IPTG) (lane 1), isopropyl-1-thio-beta-D-galactopyranoside-induced pET28a-LeKRP1 (+IPTG)(lane 2), and Ni-NTA-purified LeKRP1 (lane 3). Right panel, Western blot using the polyclonal rabbit antiserum raised against LeKRP1. The presence of a supernumerary protein in crude extracts of induced E. coli (lane 2) is indicated by an arrowhead. Size determination was done according to the protein molecular mass marker from MBI Fermentas (lane M). B, kinase activity of CDK-cyclin complexes present in 20-DPA Epidermis protein extracts (100 µg) bound to p9CksHs1-Sepharose beads, assayed in the absence (-) or presence (+) of exogenously supplied (100 ng) purified LeKRP1 using histone H1 as a substrate. The level of CDKA protein in each sample was immunologically detected using an anti-PSTAIR antibody. The Coomassie Blue staining of the electrophoresis gel area showing histone H1 is shown as a control of equal substrate quantity used per phosphorylation reaction. The kinase activity was quantified by image scanning of the autoradiogram, normalized for the quantified amount of histone H1, and expressed as a ratio of arbitrary units for pixel intensities. Data were obtained from four independent experiments. C, dose-dependent inhibition of p9CksHs1-bound CDK-cyclin complex activity. Equal amounts (100 µg) of extracted proteins from 20-DPA Epidermis were preincubated at room temperature for 10 min with various amounts or 100 ng of heat-treated purified LeKRP1. At the end of the preincubation period, the samples were mixed with the p9CksHs1-Sepharose matrix, and the kinase activity was assayed. Bovine serum albumin (100 µg) was used as a control. The time exposure for autoradiography was 48 h. Phosphorylation assay, CDKA detection, histone H1 staining, and quantification of kinase activity were performed as in panel B.

 
The accumulation of LeKRP1 in gel protein extracts of developing fruits was then analyzed by immunoprecipitation experiments using the specific antibody raised against LeKRP1 (Fig. 7A, top panel). The level of LeKRP1 in the gel increased throughout fruit development to reach a maximum at 20 DPA. At the onset of ripening and in fully matured fruits, the level of LeKRP1 then decreased but still remained elevated compared with that at 10 DPA. As a control, we performed a second round of immunoprecipitation using the LeKRP1-immunodepleted extracts and demonstrated that they lacked LeKRP1 (Fig. 7A, bottom panel). Thus the accumulation profile of LeKRP1 in the developing gel tissue of tomato fruit paralleled that of LeKRP1 transcripts (Fig. 3C).


Figure 6
View larger version (43K):
[in this window]
[in a new window]
  		FIGURE 6.
Inhibition of CDK-cyclin kinase activity by protein extracts from endoreduplicating gel tissue of developing tomato fruits. Equal amounts (100 µg) of extracted proteins from 20-DPA Epidermis were preincubated at room temperature for 10 min with 20-DPA Gel protein extract using various amounts (indicated in µg) or 100 µg of heat-treated extract. The phosphorylation assay, controls, and quantification of kinase activity were performed as in Fig. 5B.

 


Figure 7
View larger version (42K):
[in this window]
[in a new window]
  		FIGURE 7.
Inhibition of the CDK-cyclin complex activities by LeKRP1 in the endoreduplicating gel tissue of developing tomato fruits. A, 100µg of Gel protein extracts prepared from fruits harvested at 10-, 15-, and 20-DPA, MG, and RR stages were used to prepare immunoprecipitated (top panel) and immunodepleted (bottom panel) LeKRP1 extracts as described under "Experimental Procedures." B, the LeKRP1 immunoprecipitates and LeKRP1-immunodepleted extracts were mixed to equal amounts (100 µg) of 20-DPA Epidermis extracts, and the mixtures were subsequently preincubated at room temperature for 10 min prior to binding to p9CksHs1-Sepharose beads and kinase activity assay. The phosphorylation assay, controls, and quantification of kinase activity were performed as in Fig. 5B.

 
The Presence of LeKRP1 Accounts for the Inhibition of CDK-Cyclin Kinase Activity Mediated by Gel Protein Extracts—To demonstrate that LeKRP1 was involved in the CDK-cyclin complex inhibition observed in the Gel extract, the LeKRP1 immunoprecipitates (Fig. 7A) were used in phosphorylation assays. The Epidermis extract was used as the source of CDK-cyclin kinase activity. As shown in Fig. 7B, the addition of LeKRP1 immunoprecipitates obtained from 10- to 15-DPA gel extracts resulted in a 75% inhibition of the activity. When compared with the histone H1 autophosphorylation control (in the absence of any added protein extracts), the addition of the LeKRP1 immunoprecipitates from gel extracts of 20-DPA, MG, and RR fruits resulted in the total inhibition of the activity. In the presence of the LeKRP1-immunodepleted extracts, the level of the CDK-cyclin kinase activity remained almost constant up to 20 DPA, representing a mean value of 80% of the activity present in the Epidermis extract. After 20 DPA and during maturation, the level of the kinase activity decreased to 60% of the initial value. This inhibition may be due to the increased production of other KRP proteins in the gel during ripening, such as LeKRP2 as observed in Fig. 3C. We conclude that LeKRP1 expression in the gel tissue of developing tomato fruits contributes to the inhibition of CDK-cyclin kinase activity during endoreduplication.

LeKRP1 Only Interacts with Tomato CDKA and CYCD3;1—A yeast two-hybrid approach was used to investigate putative protein-protein interactions between LeKRP1 and tomato CDKs and cyclins (2, 18, 19). As shown in Table 1, LeKRP1 interacted strongly with CDKA and CYCD3;1. No interaction was detected between LeKRP1 and the other CDKs and cyclins tested. To demonstrate an in vivo interaction between CDKA and LeKRP1, we performed an immunoprecipitation assay, trapping the KRP1-interacting CDK-cyclin complexes with the anti-KRP1 antibody. The immunoprecipitated proteins were subsequently detected using an anti-PSTAIR antibody. As shown in Fig. 8, the incubation of total protein extracts from 15-DPA gel with the anti-KRP1 antibody resulted in the specific immunoprecipitation of CDKA (lane 1), thus demonstrating the in vivo KRP1-CDKA interaction occurring in tomato fruit cells.


View this table:
[in this window]
[in a new window]
  		TABLE 1
Interactions between LeKRP1 and tomato CDKs and cyclins in yeast

 
LeKRP1 Is Able to Inhibit a CDK-Cyclin Kinase Activity Targeting RBR—Increasing evidence indicates that CDKA and D-type cyclins associate to form complexes controlling the G1/S transition (27). Plant CDKA-CYCD complexes can phosphorylate the RBR protein both in vitro and in vivo (29, 34). Therefore we investigated the inhibitory effect of LeKRP1 on the CDK-cyclin kinase activity isolated from endoreduplicating cells of the gel tissue, using the tobacco RBR (NtRb1) protein (23) as a substrate.

First the kinase activity of the Epidermis and Gel protein extracts (both prepared from fruits at 20 DPA) were assayed (Fig. 9A). A basal kinase activity was present in the Epidermis extract. The Gel extract showed a 1.4-fold greater kinase activity than the epidermis. We then tested the kinase activity of the gel tissue during fruit development (Fig. 9B). The maximum RBR phosphorylation was observed during the earliest developmental stages, i.e. at 10 and 15 DPA. The kinase activity decreased at 20 DPA and then increased again until the RR stage. The pattern of kinase activity was therefore inversely proportional to the transcriptional (Fig. 3C) and translational (Fig. 7A) profile of LeKRP1, suggesting that LeKRP1 may affect the activity of this kinase complex during the development of the gel tissue. When added exogenously to the Gel extracts, LeKRP1 was able to significantly inhibit the kinase activity. These results suggest that a kinase activity targeting RBR is putatively regulated by LeKRP1 binding.


Figure 8
View larger version (6K):
[in this window]
[in a new window]
  		FIGURE 8.
In vivo interaction of CDKA with LeKRP1 in endoreduplicating cells from the gel tissue of developing tomato fruits. Lane 1, total protein extract (800 µg from 15-DPA Gel) was immunoprecipitated with anti-LeKRP1. After protein A-Sepharose binding and SDS-PAGE separation, the immunoprecipitated proteins were revealed by Western blotting using an anti-PSTAIR (CDKA) antibody. Lane 2, as a negative control, the same amount of total protein from 15-DPA Gel extract was incubated with the preimmune antiserum prior to protein A-Sepharose binding. Lane 3, 1 µg of purified His6-tagged LeCDKA (molecular mass 38 kDa) was used as a positive control for the anti-PSTAIR detection.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
The tight binding of specific inhibitors is essential for the control of CDK activities governing cell cycle progression. In mammals CDK inhibitors belong to two classes of proteins, the INK4 family and the Cip/Kip family (28). Their classification is based on their structural features and CDK targets. Both types of CDK inhibitors are involved in regulating the progression of the G1 phase. In plants, all CDK inhibitors isolated so far belong to a single family with weak homology to the mammalian Cip/Kip family (13, 26, 29, 30). In planta functional analyses of plant KRPs (13, 31-33) indicate that, unlike their mammalian counterparts, they may not be solely involved in regulating the timing of exit from the cell cycle and differentiation (13, 34). Cell proliferation is controlled by stimulatory signals such as sugars and hormones through the activation of D-type cyclins (35). Therefore, inhibitory signals may alter the mitotic activity of plant cells in response to unfavorable environmental conditions. Plant KRPs may integrate these negative signals, as their expression, at least at the transcriptional level, is regulated by growth conditions. For instance, Himanen et al. (36) demonstrated that the expression of Arath;KRP2, which is involved in maintaining the arrest of root pericycle cells, is rapidly repressed by auxin. However, the function of plant KRPs in the regulation of the cell cycle progression as well as their putative involvement in endoreduplication remains poorly understood.

We isolated cDNAs of the tomato CDK inhibitors, LeKRP1 and LeKRP2. Their amino acid sequence is typical of plant KRPs (Fig. 2), with a conserved C-terminal region and a highly variable N-terminal region (13). The C-terminal region of KRPs plays a major role in protein-protein interactions with both CDKA and CYCD3;1 (31). The N-terminal domain contains a sequence determining protein stability in vivo that could drive the temporal selective degradation of KRP proteins at different time points of the cell cycle (37). This sequence variation may also reflect the specificity of KRP gene expression at a developmental and spatial level. Indeed, like Arabidopsis KRP genes (13, 30), LeKRP1 and LeKRP2 display differential patterns of expression in the various organs of tomato plants (Fig. 3A). The expression of LeKRP1 is associated with dividing tissues and restricted to a limited interval of the cell cycle as seen by its patchy expression pattern during in situ hybridization (Fig. 4). The increased expression of LeKRP2 in flower buds compared with that of LeKRP1 (Fig. 3A) may be due to the uniform distribution of the transcripts as observed in Fig. 4, G-I. This suggests that the regulation of LeKRP2 expression is independent of the cell cycle. The first data dealing with the differential expression of plant KRP genes during cell cycle progression were produced in highly synchronous Arabidopsis suspension cultures (38). Unfortunately, the lack of a synchronizable cell suspension culture for tomato prevents us from investigating the expression of LeKRP1 and LeKRP2 during cell cycle progression.

During the course of fruit development, LeKRP1 and LeKRP2 display different kinetics of transcript accumulation in the gel tissue (Fig. 3C). LeKRP2 is preferentially expressed at the onset of fruit maturation, which is unexpected as mitotic activities are absent in the gel at this time and endoreduplication is retarded.6 This raises the following questions. First, is there a relationship between LeKRP2 and ripening and/or regulation by ethylene, the triggering hormone of the maturation process? Second, is the induction of LeKRP2 gene expression involved in the inhibition of endoreduplication at the end of fruit development?


Figure 9
View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 9.
Developmental analysis of a kinase activity targeting RBR in the gel tissue of tomato fruits. A, CDK-cyclin kinase activity levels detected by phosphorylation assay using 100 µg of 20-DPA Epidermis or Gel extracts and NtRb1 as a substrate. The time exposure for autoradiography was 1 week. Phosphorylation assay, NtRb1 detection by Coomassie Blue staining, and quantification of kinase activity were performed as in Fig. 5B. Data were obtained from three independent experiments. B, CDK-cyclin kinase activity levels in developing Gel extracts determined in the absence (left panel) or in the presence (right panel) of exogenously added (100 µg) LeKRP1 and NtRb1 as a substrate. Developing Gel extracts were prepared from fruits harvested at 10-, 15-, and 20-DPA, MG, and RR stages. The time exposure for autoradiography was 1 week. Quantification of kinase activity was performed as in panel A.

 
The maximum LeKRP1 expression after 15 DPA coincides with the disappearance of cell division activity, the transcription of mitosis-specific CDKs and cyclins, and the appearance of endoreduplication in the gel tissue (2, 18, 19). Whole cell extracts of 20-DPA fruit tissues show that LeKRP1 is involved in the inhibition of the CDK activity in the endoreduplicating (mitotically inactive) cells of the gel tissue (2) (Figs. 6 and 7).

De Veylder et al. (39) suggested that the inhibition of M-phase CDK-cyclin kinase activity triggers endoreduplication, thus preventing mitosis. The plant-specific CDKB1;1, whose activity peaks at the G2/M boundary, is likely to prevent the transition from the mitotic cycle to the endocycle. Indeed, the impairment of CDKB1;1 activity resulted in enhanced endoreduplication (7). Recently it was shown in Arabidopsis that CDKB1;1 phosphorylates KRP2, triggering its proteolytic degradation, and in turn maintains a high CDKA;1 activity required for the mitotic cell cycle (15). When the CDKB1;1 activity declines, KRP2 is able to inactivate CDKA;1, thus driving the cell toward endoreduplication.

Transgenic plants that strongly overexpress KRPs show not only reduced growth due to the alteration of cell proliferation through the reduction of CDK activity but also reduced ploidy levels as endoreduplication is suppressed (13, 26, 31). These data suggest that KRPs are able to inhibit both types of CDK-cyclin complexes, mitotic cell cycle-specific ones and endoreduplication cycle-specific ones. Interestingly, the generation of weak KRP2 overexpressors in Arabidopsis (15) resulted in the inhibition of only the mitosis CDK-cyclin complex activity and not that of the endocycle-specific CDK-cyclin complex. Data obtained from the misexpression of ICK1/KRP1 in the single cell Arabidopsis trichomes also supported the idea that plant CDK inhibitors act in a concentration-dependent manner (34).

Endoreduplication (and consequently the absence of mitosis) in the gel tissue of tomato fruit coincides with the lack of transcription of mitosis-associated genes (e.g. CDKBs and A- and B-type cyclins) (18, 19). Therefore, it is likely that M-phase CDK-cyclin complexes are not synthesized and assembled in endoreduplicating tissues. The production of tomato KRPs in the gel (Figs. 3C and 7), in the absence of cell division (2), suggests a role for CDK inhibitors in addition to the inhibitory binding of M-phase CDK-cyclin complexes for the control of the transition toward endoreduplication.

The RBR pathway controls the G1/S transition in plant cells (40). The CDK-cyclin complexes that drive the G1/S transition are formed from the association of a D-type cyclin with CDKA. They act by phosphorylating RBR (23, 27, 41, 42). Compelling evidence for the involvement of RBR pathway components in the control of endoreduplication arises from in planta functional analyses (39, 43). We (Table 1; Fig. 8) and others (13, 31, 37) have shown that plant KRPs only interact with CDKA and Cyclin D. During endoreduplication, the transcription of LeC DKA;1 and LeCYCD3;1 is sustained in tomato (18), arguing for a role of CDKA and CYCD3;1 in the endocycle. Here, we have shown that LeKRP1 can inhibit a putative kinase activity present in the endoreduplicating gel tissue of the fruit that targets RBR (Fig. 9). It remains to be demonstrated whether the CDK-cyclin complex containing this kinase activity, that is targeted by LeKRP1, is indeed composed of CDKA and CYCD3;1.

As demonstrated in transgenic lines overproducing plant KRPs (13, 32), cell growth can be uncoupled from cell cycle progression and DNA content. However, in most plant cells, endoreduplication correlates with cell size increase to maintain the nucleus-to-cell volume ratio (3, 44). The effects of a mis-expression of ICK1/KRP1 in Arabidopsis trichomes indicated that cell growth may be controlled by two distinct mechanisms, a DNA amount-independent mechanism and a DNA-dependent mechanism (14). For instance, the cell may need to reach a minimal size to pass the Start/restriction point in the G-phase of the endocycle prior to DNA replication. This was demonstrated in yeast where the control of cell size involves the action of the CDK inhibitor p25rum1, which delays the passage through Start until the required cell mass is reached (45). As a working hypothesis, we propose that plant KRPs regulate the phase transitions of the endocycle by modulating the CDKA-CYCD kinase activity on RBR in late G-phase of the endocycle to prevent a premature passage into S-phase. This control of the CDKA-CYCD kinase activity could be exerted at two distinct levels: first, by slowing down the assembly of the CDKA-CYCD kinase complex, assuming that KRP may interact with the CYCD subunit alone (as shown in planta and Refs. 14, 32, 37); and second, by inhibitory binding to the CDKA-CYCD complex itself. Another level of control by KRP may also be during re-entry into the successive G-phase of the endocycle. At this point it may act by inhibiting the CDKA-CYCD kinase activity when the DNA replication phase is completed. Whether plant KRPs participate in these different mechanisms is an intriguing matter for investigation, and some recent findings seem to support these putative roles of plant KRPs (34).


   FOOTNOTES
 
The nucleotide sequence(s) reported in this paper has been submitted to the DDBJ/GenBankTM/EBI Data Bank with accession number(s) AJ441249 [GenBank] and AJ441250 [GenBank] .

* This work was supported in part by Grants 00-512858 and 10697-2003 from the Ministère de la Recherche et de la Technologie (France) (to F. D. and A. S., respectively) and by funding from the Region Aquitaine. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 Both authors contributed equally to this work. Back

2 Recipient of a postdoctoral fellowship from the Département de Biologie Végétale of Institut National de la Recherche Agonomique. Back

3 Recipient of a European Molecular Biology Organization fellowship. Present address: Laboratoire de Biogenèse Membranaire, CNRS FRE 2694, Université Victor Ségalen-Bordeaux 2, 146 Rue Léo Saignat-Case 92, 33076 Bordeaux Cedex, France. Back

4 To whom correspondence should be addressed. Tel./Fax: 33-557-122541; E-mail: chevalie{at}bordeaux.inra.fr.

5 The abbreviations used are: CDK, cyclin-dependent kinase; DPA, days post-anthesis; KRP; p27Kip1-related protein; Ni-NTA, nickel-nitrilotriacetic acid; RBR, retinoblastoma-related protein; RR, red ripe; MG, mature green; TC, tentative consensus. Back

6 C. Chevalier and J. Joubès, unpublished data. Back


   ACKNOWLEDGMENTS
 
We thank Dr. Masami Sekine and Prof. Atsuhiko Shinmyo (Nara Institute of Science and Technology, Japan) for providing the pGEX-5X-2 (NtRb1) plasmid and Dr. Lieven De Veyder for critically reading the manuscript.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Gillaspy, G., Ben-David, H., and Gruissem, W. (1993) Plant Cell 5, 1439-1451[Free Full Text]
  2. Joubès, J., Phan, T.-H., Just, D., Rothan, C., Bergounioux, C., Raymond P., and Chevalier, C. (1999) Plant Physiol. 121, 857-869[Abstract/Free Full Text]
  3. Joubès, J., and Chevalier, C. (2000) Plant Mol. Biol. 43, 735-745[CrossRef][Medline] [Order article via Infotrieve]
  4. Grafi, G. (1998) Exp. Cell Res. 244, 372-378[CrossRef][Medline] [Order article via Infotrieve]
  5. Dewitte, W., and Murray, J. A. H. (2003) Annu. Rev. Plant Biol. 54, 235-264[CrossRef][Medline] [Order article via Infotrieve]
  6. Leiva-Neto, J. T., Grafi, G., Sabelli, P. A., Dante, R. A., Woo, Y.-M., Maddock, S., Gordon-Kamm, W. J., and Larkins, B. A. (2004) Plant 16, 1854-1869
  7. Boudolf, V., Vlieghe, K., Beemster, G. T. S., Magyar, Z., Torres Acosta, J. A., Maes, S., Van Der Schueren, E., Inzé, D., and De Veylder, L. (2004) Plant Cell 16, 2683-2692[Abstract/Free Full Text]
  8. Grafi, G., and Larkins, B. A. (1995) Science 269, 1262-1264[Abstract/Free Full Text]
  9. Sun, Y., Dilkes, B. P., Zhang, C., Dante, R. A., Carneiro, N. P., Lowe, K. S., Jung, R., Gordon-Kamm, W. J., and Larkins, B. A. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 4180-4185[Abstract/Free Full Text]
  10. Gonzalez, N., Hernould, M., Delmas, F., Gévaudant, F., Duffe, P., Causse, M., Mouras, A., and Chevalier, C. (2004) Plant Mol. Biol. 56, 849-861[CrossRef][Medline] [Order article via Infotrieve]
  11. Cebolla, A., Vinardell, J. M., Kiss, E., Olah, B., Roudier, F., Kondorosi, A., and Kondorosi, E. (1999) EMBO J. 18, 4476-4484[CrossRef][Medline] [Order article via Infotrieve]
  12. Vinardell, J. M., Fedorova, E., Cebolla, A., Kevei, Z., Horvath, G., Kelemen, Z., Tarayre, S., Roudier, F., Mergaert, P., Kondorosi, A., and Kondorosi, E. (2003) Plant Cell 15, 2093-2105[Abstract/Free Full Text]
  13. De Veylder, L., Beeckman, T., Beemster, G. T. S., Krols, L., Terras, F., Landrieu, I., Van Der Schueren, E., Maes, S., Naudits, M., and Inzé, D. (2001) Plant Cell 13, 1-15[Free Full Text]
  14. Schnittger, A., Weinl, C., Bouyer, D., Schöbinger, U., and Hülskamp, M. (2003) Plant Cell 15, 303-315[Abstract/Free Full Text]
  15. Verkest, A., de O. Manes, C. L., Vercruysse, S., Maes, S., Van Der Schueren, E., Beeckman, T., Genshik, P., Kuiper, M., Inzé, D., and De Veylder, L. (2005) Plant Cell 17, 1723-1736[Abstract/Free Full Text]
  16. Melaragno, J. E., Mehrotra, B., and Coleman, A. W. (1993) Plant Cell 5, 1661-1668[Abstract]
  17. Vilhar, B., Kladnik, A., Blejec, A., Chourey, P. S., and Dermastia, M. (2002) Plant Physiol. 129, 23-30[Free Full Text]
  18. Joubès, J., Walsh, D., Raymond, P., and Chevalier, C. (2000) Planta 211, 430-439[CrossRef][Medline] [Order article via Infotrieve]
  19. Joubès, J., Lemaire-Chamley, M., Delmas, F., Walter, J., Hernould, M., Mouras, A., Raymond, P., and Chevalier, C. (2001) Plant Physiol. 126, 1403-1415[Abstract/Free Full Text]
  20. Laemmli, U. K. (1970) Nature 227, 680-685[CrossRef][Medline] [Order article via Infotrieve]
  21. Azzi, L., Meijer, L., Reed, S. I., Pidikiti, R., and Tung, H. Y. (1992) Eur. J. Biochem. 203, 353-360[Medline] [Order article via Infotrieve]
  22. Magyar, Z., Bako, L., Bögre, L., Dedeoglu, D., Kapros, T., and Dudits, D. (1993) Plant J. 4, 151-161[CrossRef]
  23. Nakagami, H., Sekine, M., Murakami, H., and Shinmyo, A. (1999) Plant J. 18, 243-252[CrossRef][Medline] [Order article via Infotrieve]
  24. Hall, T. A. (1999) Nucleic Acids Symp. Ser. 41, 95-98
  25. Van de Peer, Y., and De Wachter, R. (1994) Comput. Appl. Biosci. 10, 569-570[Free Full Text]
  26. Jasinski, S., Perennes, C., Bergounioux, C., and Glab, N. (2002) Plant Physiol. 130, 18871-18882
  27. Healy, J. M. S., Menges, M., Doonan, J. H., and Murray, J. A. H. (2001) J. Biol. Chem. 276, 7041-7047[Abstract/Free Full Text]
  28. Sherr, C. J., and Roberts, J. M. (1999) Genes Dev. 13, 1501-1512[Free Full Text]
  29. Wang, H., Fowke, L. C., and Crosby, W. L. (1997) Nature 386, 451-452[CrossRef][Medline] [Order article via Infotrieve]
  30. Lui, H., Wang, H., Delong, C., Fowke, L. C., Crosby, W. L., and Fobert, P. R. (2000) Plant J. 21, 379-385[CrossRef][Medline] [Order article via Infotrieve]
  31. Wang, H., Qi, Q., Schorr, P., Cutler, A. J., Crosby, W. L., and Fowke, L. C. (1998) Plant J. 15, 501-510[CrossRef][Medline] [Order article via Infotrieve]
  32. Jasinski, S., Riou-Khamlichi, C., Roche, O., Perennes, C., Bergounioux, C., and Glab, N. (2001) J. Cell Science 115, 973-982
  33. Zhou, Y., Wang, H., Gilmer, S., Whitwill, S., and Fowke, L. C. (2003) Planta 216, 604-613[Medline] [Order article via Infotrieve]
  34. Weinl, C., Maquardt, S., Kuijt, S. J., Nowack, M. K., Jakoby, M. J., Hülskamp, M., and Schnittger, A. (2005) Plant Cell 17, 1704-1722[Abstract/Free Full Text]
  35. Meijer, M., and Murray, J. A. H. (2000) Plant Mol. Biol. 43, 621-633[CrossRef][Medline] [Order article via Infotrieve]
  36. Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inzé, D., and Beeckman, T. (2002) Plant Cell 14, 2339-2351[Abstract/Free Full Text]
  37. Zhou, Y., Li, G., Brandizzi, F., Fowke, L. C., and Wang, H. (2003) Plant J. 35, 476-489[CrossRef][Medline] [Order article via Infotrieve]
  38. Menges, M., and Murray, J. A. H. (2002) Plant J. 30, 203-212[CrossRef][Medline] [Order article via Infotrieve]
  39. De Veylder, L., Beeckman, T., Beemster, G. T. S., de Almeida Engler, J., Ormenese, S., Maes, S., Naudts, M., Van Der Schueren, E., Jaqmard, A., Engler, G., and Inzé, D. (2002) EMBO J. 21, 1360-1368[CrossRef][Medline] [Order article via Infotrieve]
  40. Gutierrez, C., Ramirez-Parra, E., Mar-Castellano, M., and Carlos del Pozo, J. (2002) Curr. Opin. Plant Biol. 5, 480-486[CrossRef][Medline] [Order article via Infotrieve]
  41. Boniotti, M. B., and Gutierrez, C. (2001) Plant J. 28, 341-350[CrossRef][Medline] [Order article via Infotrieve]
  42. Nakagami, H., Kawamura, K., Sugisaka, K., Sekine, M., and Shinmyo, A. (2002) Plant Cell 14, 1847-1857[Abstract/Free Full Text]
  43. Park, J.-A., Ahn, J.-W., Kim, Y.-K., Kim, S. J., Kim, J.-K., Kim, W. T., and Pai, H.-S. (2005) Plant J. 42, 153-163[CrossRef][Medline] [Order article via Infotrieve]
  44. Kondorosi, E., Roudier, F., and Gendreau, E. (2000) Curr. Opin. Plant Biol. 3, 488-492[CrossRef][Medline] [Order article via Infotrieve]
  45. Martin-Castellanos, C., and Moreno, S. (1996) in Progress in Cell Cycle Research, (Meijer, L., Guidet, S., and Vogel, L., eds) Vol. 2, pp. 29-35 Plenum Press, New York[Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J Exp BotHome page
M. Kwiatkowska, K. Poplonska, A. Kazmierczak, D. Stepinski, K. Rogala, and K. Polewczyk
Role of DNA endoreduplication, lipotubuloids, and gibberellic acid in epidermal cell growth during fruit development of Ornithogalum umbellatum
J. Exp. Bot., June 1, 2007; 58(8): 2023 - 2031.
[Abstract] [Full Text] [PDF]

Home page
 Plant Physiol.Home page
R. M. Barroco, A. Peres, A.-M. Droual, L. De Veylder, L. S. L. Nguyen, J. De Wolf, V. Mironov, R. Peerbolte, G. T.S. Beemster, D. Inze, et al.
The Cyclin-Dependent Kinase Inhibitor Orysa;KRP1 Plays an Important Role in Seed Development of Rice
Plant Physiology, November 1, 2006; 142(3): 1053 - 1064.
[Abstract] [Full Text] [PDF]

Home page
 Plant Physiol.Home page
M. J. Jakoby, C. Weinl, S. Pusch, S. J.H. Kuijt, T. Merkle, N. Dissmeyer, and A. Schnittger
Analysis of the Subcellular Localization, Function, and Proteolytic Control of the Arabidopsis Cyclin-Dependent Kinase Inhibitor ICK1/KRP1
Plant Physiology, August 1, 2006; 141(4): 1293 - 1305.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/11/7374    most recent
M506587200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bisbis, B.
Right arrow Articles by Chevalier, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bisbis, B.
Right arrow Articles by Chevalier, C.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement