Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M510940200 on January 3, 2006

J. Biol. Chem., Vol. 281, Issue 11, 7595-7604, March 17, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/11/7595    most recent
M510940200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stefanic, S.
Right arrow Articles by Hehl, A. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stefanic, S.
Right arrow Articles by Hehl, A. B.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Organelle Proteomics Reveals Cargo Maturation Mechanisms Associated with Golgi-like Encystation Vesicles in the Early-diverged Protozoan Giardia lamblia*

Sasa Stefanic{ddagger}, Daniel Palm§, Staffan G. Svärd§, and Adrian B. Hehl{ddagger}1

From the {ddagger}Institute of Parasitology, University of Zürich, Winterthurerstrasse 266a, CH-8057 Zürich, Switzerland, the §Microbiology and Tumor Biology Center, Karolinska Institutet, SE-171 77 Stockholm, Sweden, and the Department of Cell and Molecular Biology, BMC, Uppsala University, SE-751 24 Uppsala, Sweden

Received for publication, October 6, 2005 , and in revised form, December 22, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
During encystation Giardia trophozoites secrete a fibrillar extracellular matrix of glycans and cyst wall proteins on the cell surface. The cyst wall material is accumulated in encystation-specific vesicles (ESVs), specialized Golgi-like compartments generated de novo, after export from the endoplasmic reticulum (ER) and before secretion. These large post-ER vesicles neither have the morphological characteristics of Golgi cisternae nor sorting functions, but may represent an evolutionary early form of the Golgi-like maturation compartment. Because little is known about the genesis and maturation of ESVs, we used a limited proteomics approach to discover novel proteins that are specific for developing ESVs or associated peripherally with these organelles. Unexpectedly, we identified cytoplasmic and luminal factors of the ER quality control system on two-dimensional electrophoresis gels, i.e. several proteasome subunits and HSP70-BiP. We show that BiP is exported to ESVs and retrieved via its C-terminal KDEL signal from ESVs. In contrast, cytoplasmic proteasome complexes undergo a developmentally regulated re-localization to ESVs during encystation. This suggests that maturation of bulk exported cyst wall material in the Golgi-like ESVs involves both continuous activity of ER-associated quality control mechanisms and retrograde Golgi to ER transport.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Giardia lamblia (syn. Giardia intestinalis, Giardia duodenalis) is a unicellular intestinal parasite and a leading cause of diarrheal disease in humans and animals worldwide (1). In addition to this public health importance, the diplomonad Giardia belongs to one of the earliest known branches of the eukaryotic lineage (2, 3). As an increasingly popular model organism for cell biology, this protozoan is currently one of the best opportunities for discovering cellular mechanisms and structures that represent potentially ancient eukaryotic features (4, 5).

Synthesis and secretion of a protective cell wall are essential for transmission of infectious stages of Giardia and many other uni- or multicellular pathogens. Oocysts or (tissue) cysts acquire the necessary environmental resistance to survive their release into the environment and/or subsequent stomach passage when ingested by a new host. Eimeria oocysts develop a multilayered oocyst wall by sequential exocytosis of at least three different extracellular matrices (6). These infectious stages may survive for many months outside of a host. Encysting Entamoeba trophozoites produce a fibrillar extracellular matrix composed of proteins and chitin (7-9) in a manner that appears similar to Giardia encystation, i.e. by accumulating the material in membrane vesicles followed by regulated secretion. In all cases, however, complex, but poorly understood signal-dependent secretory processes are involved. Notably the nature of membrane compartments responsible for the accumulation/maturation of matrix material, e.g. wall forming bodies of Eimeria species or encystation-specific vesicles (ESVs)2 of Giardia and Entamoeba, is largely unknown. Giardia is a unique model for cyst formation because (i) it is an evolutionarily basic eukaryote with a very simple secretory system that lacks a conventional Golgi apparatus (4), (ii) ESVs have been characterized as Golgi-like compartments (10-12), (iii) de novo ESV formation is easily induced in vitro (13), and (iv) there is a potential for targeted intervention to block encystation and thus prevent transmission to another host.

Giardia possesses a structurally conserved but uniquely basic apparatus for vesicular transport (4). Despite its simplicity and without recognizable Golgi dictyosomes, Giardia can sort proteins to constitutive or regulated export pathways, and maintains few but distinct membrane compartments. After induction of encystation, large amounts of cyst wall proteins (CWPs) and glycans are produced. The bulk of newly synthesized cyst wall material is exported from the ER to nascent ESVs as a pulse during the first 5-8 h after induction, and accumulate in a set of approximately spherical ESVs with defined cargo (14-16). The exact mechanism of this export is still elusive, however. The available data support two nonmutually exclusive models for ESV genesis: (i) lateral segregation and concentration of cyst wall material in specialized ER subcompartments (10), and/or (ii) export of cyst wall material in COPII-coated transport vesicles that give rise to ESVs by homotypic fusion (17). In any case, analogous to the generation of vesicular tubular clusters and cis-Golgi compartments, formation of ESVs seems to require the small GTPase Sar1p3 and thus represents a unique form of Golgi neogenesis. Maturation of ESVs is less controversial: during the 15-24-h process until cyst wall secretion, peripheral membrane proteins are sequentially recruited to ESVs (4). This indicates that the compartments themselves and presumably also their cargo undergo a maturation process during which CWPs are post-translationally modified. Evidence for cargo modification was inferred from the presence of protein-disulfide isomerases in ESVs (18), cleavage of the CWP2 C terminus by an encystation-specific proteases in vitro (19), or phosphorylation of newly synthesized CWPs (20). In particular, the formation and reshuffling of intra- and intermolecular disulfide bonds is essential for establishing a cyst wall, because treatment with dithiothreitol (DTT) reversibly abolished cyst wall formation and appeared to dissolve ESVs (21). Interestingly, like conventional Golgi cisternae, ESVs are sensitive to brefeldin A and associate with two Golgi markers, beta'COPI and GiYip1 (4, 17). This is strong evidence for their Golgi-like nature despite the unusual morphology.

Previously we have used an in silico strategy to identify proteins associated with ESVs that was based on the available sequence data from the Giardia Genome Database (GGD) (4, 5). We proceeded on the assumption that ESVs were unusual Golgi compartments and searched for homologues of proteins associated with this organelle. However, in addition to being biased, a major limitation of this strategy was the high sequence degeneracy and the fact that some key factors for ESV genesis and maturation of ESVs might be Giardia-specific. Here, we used an organelle-specific proteomics approach to discover unknown ESV-associated proteins. We have developed protocols for the production of fractions enriched in ESV-derived microsomes containing CWP cargo and peripheral Golgi marker proteins. In a first step we have analyzed this fraction with two-dimensional electrophoresis and identified novel proteins. Despite the difficulty to resolve proteins in this fraction, we could identify components of the ER quality control system and localized those to ESVs. These results have important implications for transport and maturation of cyst wall material, as well as the nature of ESVs as de novo-generated Golgi-like maturation compartments in Giardia. Using a membrane-permeable thiol-reducing agent during ESV maturation, we also obtained first evidence that the spherical morphology of ESVs is actively maintained and directly dependent on disulfide bonds in cargo proteins.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Giardia Culture, Transfection, and Analysis of Transgenic Cells—G. lamblia strain WBC6 (ATCC catalog number 50803) trophozoites were grown in TYI-S-33 supplemented with 10% fetal bovine serum and bovine bile. Two-step encystation was induced as described previously (12) by increasing the medium pH and by addition of porcine bile after culture for ~44 h in medium without bile (13).

To reduce intra- and intermolecular disulfide bonds in CWPs, DTT was added to a final concentration of 7.15 mM to encysting cells 8 h post-induction for 10-30 min. Cells were harvested and fixed directly for analysis, or the drug was washed out by replacing the growth medium and incubation was continued for 30 min before fixation.

Proteasome inhibitors were added 90 min post-induction. Cells were incubated for 6, 14, and 24 h in the presence of the drugs, and processed for analysis by immunofluorescence assay to determine ESV formation, proteasome recruitment, or cyst formation (24 h). Final concentrations in the cell culture were: Pefabloc® SC (Fluka), 40 and 80 µM; MG132 (Sigma), 20 and 60 µM; and Epoxomycin (Sigma), 3 and 8 nM. All inhibitors with the exception of Pefablock, which is water soluble, were dissolved in dimethyl sulfoxide. Controls received solvent only.

Nucleic Acid Techniques and Expression Vector Construction—Using vectors for Giardia transfection all constructs were based on the expression cassette C1-CWP (12) for expression under the control of an inducible CWP1 promoter. A short fragment coding for a single Haemophilus agglutinin (HA) epitope tag was ligated in the form of annealed complementary oligonucleotides with NsiI compatible overhangs into the NsiI site downstream of the CWP signal sequence processing site. This reaction mutated the distal NsiI sequence leaving the one adjacent to the open reading frames (ORF) of interest intact. The ORF from giardial Hsp70-BiP were amplified by PCR from genomic DNA, cut, and ligated into NsiI and PacI sites.

PCR oligonucleotide primers (5'-3' orientation) used in this study were: GiBip-s, GGATGCATATAGACCTCGGCACGACCTACTC; GiBip-as, CGTTAATTAATTAGAGTTCATCTTTTTCTGCATAG; and GiBipMut-as, CGTTAATTAATTAGAGGTCATCATTTTCTGCATAG. The KDEL to NDDL mutations on recombinant BiP were encoded on the antisense primer used for amplifying the ORF. Plasmid vector DNA was electroporated into trophozoites, and stable transgenic cells were selected using the antibiotic G418 (Sigma), as described previously (12). Plasmids were maintained episomally or targeted to the TPI locus and integrated by homologous recombination.

Cell Disruption and Sucrose Density Gradient Centrifugation—Cell fractionation and analysis of marker protein distribution in encysting Giardia trophozoites at 8 h post-induction were carried out as described previously (4). Briefly, cells were harvested as described above, counted, and resuspended at 1.25 x 108/ml in ice-cold phosphate-buffered saline (PBS), containing a 2x protease inhibitor mixture (1 mM 4-(2-aminoethyl)benzenesulfonyl fluoride, 1 mM EDTA, 2 µM E-64, 2 µM leupeptin, and 2 µg/ml aprotinin; Calbiochem, San Diego, CA) and 1 mM phenylmethylsulfonyl fluoride. Cells in suspension were disrupted by gentle sonication (~5 cycles of 20 s, each) on a fixed stand (Branson Sonifier, Danbury, CT). Cells were examined microscopically after each cycle and sonicated until the parasites appeared completely disintegrated. Sucrose was added to a final concentration of 250 mM, mixed gently, and the suspension was centrifuged for 10 min at 1,000 x g. The supernatant was loaded onto a discontinuous 20-60% sucrose gradient in 12-ml polyallomer tubes (number 331374, Beckman Coulter Inc., Fullerton, CA). After centrifugation at 100,000 x g for 18 h at 4 °C, the gradient was eluted from the bottom into 18 fractions of 650 µl and kept on ice. Protein content in each fraction was measured with the BCA protein assay kit (Pierce). Proteins in the collected fractions were precipitated by addition of ice-cold trichloroacetic acid to a final concentration of 10% and centrifuged. Pellets were washed three times with acetone, air dried, and re-dissolved in SDS-PAGE sample buffer including 7.75 mg/ml dithiothreitol and boiled for 5 min. After separation on SDS-PAGE gels (10%) marker proteins for ESV microsomes were detected by incubating Western blots with specific antisera diluted in PBS, 0.05% Tween 20, and 5% nonfat milk powder at 20 °C for 2 h, followed by incubation with a peroxidase-conjugated rabbit anti-mouse IgG antibody (Sigma). Bound secondary antibodies were visualized using Western Lightning® (PerkinElmer Life Sciences).

Microsomes for mass spectrometry and two-dimensional electrophoresis analysis were prepared as follows. Instead of trichloroacetic acid precipitation, sucrose concentrations of selected fractions and fraction pools were lowered by 50% by stepwise addition of cold 10% sucrose solution with gentle mixing on ice. The diluted microsome suspension was transferred to a 12-ml polyallomer tube and topped off with 10% sucrose solution. After centrifugation at 100,000 x g for 18 h at 4 °C, the supernatant was poured off and all excess liquid was removed. The pellet was resuspended in ice-cold 50 mM ammonium acetate, transferred immediately to an Eppendorf tube, and frozen in liquid nitrogen. The frozen pellet was lyophilized and stored at -20 °C until further use.

Two-dimensional Electrophoresis and Mass Spectrometry Analysis of Microsome Fractions and Protein Identification—The ESV fraction was prepared for two-dimensional analysis according to the PS-1 protocol and the two-dimensional electrophoresis, gel staining, and MALDI analysis were performed as described in Ref. 22. 70- or 180-mm Ready-Strip IPG Strips (Bio-Rad, non-linear 3-10 and linear 3-6) were used for isoelectric focusing. For isolation of proteins for mass spectrometry analysis, gels were stained with Coomassie Brilliant Blue and all visible spots were excised and eluted as in Ref. 22. MALDI analysis was performed on a Bruker Reflex III using {alpha}-cyano-4-hydroxycinnamic acid as matrix. Peptide maps were searched against simulated tryptic digests of the open reading frames from the G. lamblia genome in NCBI using the Mascot search engine at Matrix Science. The peptide mass tolerance was set to 0.15 dalton and no miscleavages were allowed. All identified proteins showed significant hits (p < 0.05) in the Mascot program.

Antibody Production—The open reading frames of a {alpha} proteasome subunit (GGD ORF 15099) and GiCim5 (GGD ORF 86683) were inserted downstream of the maltose-binding protein (MBP) in plasmid vector pMal-2Cx (New England Biolabs). The fusion proteins were produced in transgenic Escherichia coli by adding isopropyl beta-D-thiogalactopyranoside to 0.5 mM for 2 h at 37 °C.Maltose-binding protein fusions were isolated from bacterial lysates by affinity purification on amylose resin according to the manufacturers protocols (New England Biolabs), dialyzed, and lyophilized (4). NMRI mice were immunized intraperitoneally with 100 µg of fusion protein emulsified with RIBI adjuvant (Corixa, Hamilton, MT) on days 0, 15, 30, and 50. Blood from the tail vein was collected prior to the initial immunization and after the second and third boosts. The serum fraction was assayed for the presence of specific antibodies by Western blot using separated total Giardia trophozoite lysate and by immunofluorescence assay.

Cell Preparation and Microscopy—Cells were harvested by cooling and centrifugation at 900 x g for 10 min, or by adherence to cover glasses. Fixation and preparation for fluorescence microscopy was done as described previously (17). Briefly, cells were washed with cold PBS and fixed with 3% formaldehyde in PBS for 40 min at 20 °C, followed by a 5-min incubation with 0.1 M glycine in PBS. Cells were permeabilized with 0.2% Triton X-100 in PBS for 20 min at 20 °C and blocked for >2 h in 2% bovine serum albumin in PBS. Incubations with titrated polyclonal antibodies raised against a giardial {alpha} proteasome subunit or GiCim5, or with the anti-HA monoclonal antibody were done in 2% bovine serum albumin, 0.2% Triton X-100 in PBS. Washes between incubations were done with 0.5% bovine serum albumin, 0.05% Triton X-100 in PBS. Labeled cells were embedded with Vectashield (Vector Labs) containing the DNA intercalating agent DAPI for detection of nuclear DNA. Immunofluorescence analysis was performed on a Leica SP2 AOBS confocal laser-scanning microscope (Leica Microsystems, Wetzlar, Germany) using the appropriate settings. Image stacks of optical sections were further processed using the Huygens deconvolution software package version 2.7 (Scientific Volume Imaging, Hilversum, NL). Three-dimensional reconstruction and surface rendering was done with the Imaris software suite (Bitplane, Zurich, Switzerland) using the surpass functions.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Enrichment of ESV-derived Microsomes by Subcellular Fractionation—For the production of fractions enriched in microsomes containing CWP and Golgi marker proteins (ESV-derived microsomes) from cells at 8-h post-induction we used previously developed protocols for cell disruption and sucrose density centrifugation. Microsomes from 109 encysting cells were loaded onto two 12-ml 20-60% sucrose gradients, centrifuged, and eluted into 18 equal fractions from the bottom. The Western analysis and densitometry (top panel) in Fig. 1A show a bimodal distribution of the CWP2 marker in dense fractions 1-3 as well as in lighter fractions 10-12 when analyzed by Western blot (Fig. 1A, boxed, solid line). The fractions 11/12 were designated the ESV/Golgi-enriched microsome pool (Fig. 1A,I) based on co-migration with the major peaks of two previously identified Golgi marker proteins, the coatomer (COPI) component Gibeta'COP and the multispanning membrane protein GiYip1 (Fig. 1B) (4). Cytoplasmic proteins did not run into the gradient and accumulated in fractions 15-18 (data not shown). For comparison we also collected medium density microsomes (pooled fractions 5 and 6) with undetermined organellar origin (Fig. 1A, boxed, broken line). The association of beta'COP and GiYip1 with developing ESVs was demonstrated using confocal laser scanning microscopy (CLSM) (Fig. 1). Individual optical sections show extensive co-localization of the marker proteins with CWP in most ESVs, as do the three-dimensional (3D) reconstructed image stacks.


Figure 1
View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 1.
Subcellular localization of CWP2 and Golgi marker proteins and identification of ESV fractions. A, Western blot analysis of density fractionated organelle-derived microsomes and densitometry. 20-60% sucrose gradients were eluted into 18 fractions from the bottom (fraction 1), separated by SDS-PAGE, and blotted to nitrocellulose. Antibodies against the cargo protein CWP2 were used to detect microsomes containing cyst wall material (1-3 and 10-12, boxed, solid lines) in cells at 8 h postinduction. The ESV/Golgi peak (11-12, shaded) was identified using antibodies against two Golgi marker proteins, Gibeta'COP and GiYip1. The pooled fractions 5/6 (boxed, broken lines) contained only trace amounts of CWP2 or Golgi markers and served as a control. B, localization of Golgi marker proteins to ESV membranes in encysting Giardia trophozoites by confocal microscopy. Top row, the peripheral membrane protein Gibeta'COP localizes to dispersed structures in the cell and to ESVs between 2 and 8 h post-induction. Bottom row, the multispanning transmembrane GiYip1 labels ESV membranes. Central optical sections of each antibody and merged images are shown. Three-dimensional reconstructions including surface rendering were done from entire image stacks. Nuclear DNA is stained with DAPI. Scale bars are 2 µm.

 
A ESV/Golgi fraction (pooled fractions 11/12) was prepared for further analysis. To increase resolution and to minimize cross-contamination, microsomes from only 5 x 108 cells were loaded onto the gradient. The resulting preparations were again tested with SDS-PAGE and Western blot (Fig. 2). The ESV/Golgi fraction (Fig. 2, left panel) showed a distinct protein pattern, i.e. >70 distinguishable bands with a relative mass between 12 and 200 kDa. Western analysis of identical samples run on the same gel revealed exclusive distribution of CWP2 and GiYip1 in fractions 11/12, demonstrating the presence of these markers and providing a qualitative measure of the separation. To gauge the extent of cross-contamination of fractions 11/12 with marker proteins from other compartments, the gradient was analyzed using specific antibodies or verified reporter proteins (4, 24) (Fig. 2B).


Figure 2
View larger version (38K):
[in this window]
[in a new window]
  		FIGURE 2.
Protein profile of microsome fractions. A, microsomes from density gradient fractions 5/6 (pooled control fraction) and 11/12 (pooled ESV fractions) were collected in a pellet by ultracentrifugation in a dilute sucrose solution, resuspended in ammonium acetate solution, and lyophilized. The protein profile was analyzed by reducing SDS-PAGE and subsequent staining with Coomassie Blue (left panel). The banding pattern of the two pools is completely different, indicating efficient separation of organelle-specific microsomes. Total protein (pooled fractions 1-18) is shown for comparison. Western blots from replicas run on the same gel (middle and right panels) show that the ESV markers GiYip1 (membrane) and CWP2 (luminal) are only detected in the lanes with total protein and the pooled ESV/Golgi fractions (11/12), but not in the control. The relative masses of marker proteins are indicated in kilodaltons. B, the extent of cross-contamination of the fractions 11/12 with compartment-specific marker proteins was analyzed using additional antibodies or verified reporter proteins. Densitometric analysis was preformed on the following: recombinant Cpn60 (mitosomes), clathrin heavy chain (CLH) (peripheral vesicles), recombinant leader-less {Delta}LS-IscU-HA (cytoplasm), the small GTPase SarI (ER/cytoplasm), recombinant BiP-HA (ER/cytoplasm), the small GTPase Rab1 (ER/ESV), dynamin-like protein (DLP) (ER/ESV/cytoplasm). The corresponding Western blots are shown below each graph. The cytoplasmic peak in the BiP-HA panel is because of loss of cargo during microsome preparation. A combined three-dimensional summary graph is shown.

 


Figure 3
View larger version (39K):
[in this window]
[in a new window]
  		FIGURE 3.
Two-dimensional electrophoresis analysis of the pooled ESV fraction. Coomassie-stained gel of ESV proteins, which could be resolved in this system. Circled spots correspond to those identified by MS (see Table 1). pI and relative masses are indicated.

 
Separation and Identification of Proteins in the ESV Fraction—The ESV/Golgi fraction was prepared for two-dimensional electrophoresis as described under "Materials and Methods." Because of the extreme pI values of some proteins and presumably also the high sugar (beta1-3 Gal-NAc homopolymers) content (25) in the preparation, the quality of the separation was comparatively low. For example, none of the CWPs could be resolved, even though they were readily detected in conventional SDS-PAGE and Western analysis (Fig. 2). Approximately 30 spots were identified in Coomassie-stained two-dimensional gels (Fig. 3) and 20 were chosen for excision and analysis by mass spectrometry. Identified proteins are listed in Table 1. As expected there is a considerable bias, which is demonstrated by the absence of bona fide markers such as CWPs, or low abundance proteins like COPI subunits and Yip1 that were identified in Western blot analysis (Fig. 2). On the other hand, there are three hits for HSP70-BiP, a lumenal ER resident chaperone of Giardia (26-28) that contains a conserved ER retrieval signal (KDEL) at the C terminus, indicating that the protein might also localize to proximal Golgi elements and possibly to ESVs as well.


View this table:
[in this window]
[in a new window]
  		TABLE 1
Identification of ESV Proteins

 
More surprisingly, we identified several {alpha} and beta subunits of the 20 S proteasome core complex. In other eukaryotes proteasome complexes are found in the cytoplasm and the nucleoplasm, but can also be associated with ER and cis-Golgi compartments on the cytoplasmic side, where they are involved in degradation of retrotranslocated, misfolded protein.

Cytoplasmic Proteasome Complexes Are Recruited to Maturing ESVs—Identification of proteasome subunits associated with a Golgi-like compartment seemed unusual and could be because of co-migration of proteasome complexes with ESVs in the density gradient centrifugation. To determine the subcellular localization of the 20 S and 19 S complexes, we produced polyclonal mouse antibodies against recombinant subunits expressed in E. coli. Antibodies against a predicted giardial {alpha} subunit of the 20 S core (GGD ORF 15099; predicted Mr 23.1) and a Cim5 homologue of the 19 S cap complex (GGD ORF86683; predicted Mr 56.4) were produced and tested in Western blots against total Giardia lysate (Fig. 4A). Both sera recognized single bands of the predicted sizes with high specificity and showed no cross-reactions with other proteins. In subcellular fractionation experiments, both subunits showed overlapping peak distributions in fractions 11/12 (Fig. 4B), with some minor signal in the cytoplasmic fraction. To determine where proteasomes were localized in the cell, we used the anti-{alpha} subunit antibody to detect the 20 S complex in proliferating and encysting Giardia trophozoites. Formaldehyde-fixed and detergent-permeabilized parasites were analyzed by CLSM. Series of optical sections were reconstructed to three-dimensional views of representative cells (Fig. 4C). In trophozoites (Fig. 4C, top row) a punctate distribution of the signal was observed in the cytoplasm and nucleoplasm. In encysting trophozoites at 2 h post-induction (Fig. 4C, second row), the distribution of the {alpha}-subunit was less random and the antibody clearly localized to ER membranes containing CWP and to emerging ESVs. Later in encystation, co-localization with fully formed ESVs of 6-h encysting trophozoites was very distinct (Fig. 4C, third row), with less proteasome signal detected elsewhere in the cytoplasm. Three-dimensional reconstructions from optical sections show that a significant proportion of the cellular proteasome core subunits appear to localize in the vicinity of ESV membranes. At later stages of encystation (14 h post-induction), however, this association with ESVs was lost and the distribution of the {alpha}-subunit returned to the pattern seen in trophozoites (Fig. 4C, bottom row). ESV localization of the Cim5 subunit of the 19 S proteasome cap structure was also observed, indicating that entire 26 S complexes are present on the cytoplasmic side of ESV membranes (data not shown).

Recombinant Hsp70-Bip Is Exported to ESVs and Actively Retrieved to the ER—The recruitment of proteasome to the cytoplasmic side of ESV membranes indicated a key function in development and maturation of these Golgi-like organelles. A simple explanation was that accumulation of proteasome was part of a quality control system, similar to the one operating normally in the ER. This in turn implied retrotranslocation of ESV cargo destined for degradation to the cytoplasm and its subsequent modification by ubiquitination. Although the identification of the giar-dial BiP in the ESV fraction (Table 1) was consistent with this scenario, membrane components of the translocation machinery itself (e.g. Sec61-{alpha}, GGD ORF 5744) were not identified in this two-dimensional electrophoresis analysis. To test whether BiP was indeed exported to ESVs we conditionally expressed a full-length, HA-tagged variant (BiP-HA) during encystation. Expression of the recombinant protein was under the control of the CWP1 promoter and induced upon encystation. At 5 h post-induction, BiP-HA showed a typical ER distribution in these cells (Fig. 5A, left panels). At the same time confocal microscopy and three-dimensional reconstruction of optical sections showed that very little recombinant BiP-HA, if any, appeared to co-localize with CWP in the lumen of ESV (Fig. 5A). This indicated that ectopic expression resulted in correct localization in the ER (28) without significant spill-over into other compartments such as ESVs and peripheral vesicles, or saturation of the retrieval machinery. To determine whether recombinant BiP cycled through ESVs at all, we expressed a HSP70-BiP variant (NDDL-BiP-HA) in which the KDEL retrieval signal was mutated to prevent recognition by Erd2 and COPI-mediated retrograde transport. We reasoned that if NDDL-BiP-HA cycled through ESVs, mutation of its retrieval signal would lead to a significant accumulation in these compartments. Indeed, at 5 h post-induction most of the CWP signal co-localized with NDDL-BiP-HA. This confirmed that recombinant BiP indeed trafficked through ESVs, although at steady-state most of the wild-type form of the chaperone was localized to the ER, consistent with efficient retrieval. The result also validated both the identification of BiP in ESV fractions, and the presence of COPI components on ESV membranes (Fig. 1B) by fluorescence microscopy.

ESV Morphology Is Determined by Cargo Maturation—Evidence for a quality control mechanism for cyst wall material, including retrotranslocation to the cytoplasm and COPI-dependent retrograde transport to the ER, reinforced the notion that ESVs are dynamic compartments, as opposed to simple dense granule-like secretory vesicles. Direct or indirect interference with cargo maturation mechanisms might therefore lead to interruption of the encystation process.

For example, treatment of Entamoeba histolytica with the proteasome inhibitor lactacystine completely abolished cyst formation (29). Giardia encystation, however, appeared to be unaffected by the inhibitors lactacystine, Pefabloc, or Epoxomycin, possibly reflecting profound differences in the encystation mechanisms of these unrelated protozoa.4

A different approach for interfering with ESV maturation concerns CWP folding and heterodimerization. At least three members of the CWP family of proteins form numerous inter- and intramolecular disulfide bonds during their maturation in ESVs. Gillin and co-workers (21) showed that treating encysting trophozoites with 7.15 mM DTT completely unfolded and monomerized CWP cargo proteins and led to the disappearance of ESVs (21). This fully reversible effect suggested that the maturation state of CWPs might also influence compartment integrity. To determine how ESV morphology and compartment identity was affected during treatment with DTT, we performed CLSM analysis of fixed cells using polyclonal mouse anti-GiPDI2 antibodies and a monoclonal anti-CWP antibody as markers for ER and ESVs, respectively. Parasites were encysted for 8 h until large ESVs had formed. Normal ESVs were round or spherical in appearance and clearly post-ER compartments (Fig. 6A). Anti-PDI2 strongly labeled ER membranes, but only very little of the protein localized to ESVs, if any. Three-dimensional reconstruction of cells from optical sections further supported this conclusion (Fig. 6A). To analyze the effects of thiol reduction in ESV cargo, encysting cells (8 h post-induction) were treated with DTT for 30 min, and prepared for CLSM analysis. Using anti-CWP as a marker for ESV cargo, we found that ESVs did not disappear but the compartment morphology changed from spherical to elongated, similar to swollen ER cisternae (Fig. 6B). As noted previously (21), this change was almost completely reversed 30 min after DTT wash-out (data not shown). More importantly, ESVs maintained their compartment identity, demonstrated by the continued exclusion of the ER marker PDI2 (Fig. 6B) and the lack of CWP cargo in the ER cisternae. The characteristic DTT-induced ESV morphology was reminiscent of very early stages of ESV development between 2 and 3 h post-encystation and may correspond to the so-called clefts reported in EM studies (10). This implied that the spherical shape of ESVs in later phases of encystation was indicative of a complete or at least more advanced state of cargo maturation and maintained actively. Interestingly, the flattened cisternae often assumed the shape of parallel cisternae (Fig. 6B, enlarged image), reminiscent of Golgi stacks. Taken together, these results suggest a direct correlation of the tertiary and quaternary folding state of ESV cargo and the morphology of maturing ESVs.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
We have attempted to discover novel proteins associated with the stage-specific, Golgi-like ESVs using a limited proteomics approach. ESVs are highly dynamic post-ER compartments, which harbor exclusively cyst wall material, and arise only after induction of encystation by an external signal.

Previous work has demonstrated the possibility to enrich organellespecific microsomes from Giardia by subcellular fractionation techniques (4). Our SDS-PAGE analysis revealed a distinct protein profile for the ESV fractions and the higher density fractions 5/6 as well as total post-nuclear supernatant, which were used as a control. The approach used here efficiently enriched ESV-specific cargo (CWP2), an integral membrane protein (Yip1), and even proteins of a peripherally associated coat protein complex (COPI). In addition to these three markers SDS-PAGE separation revealed more than 70 protein bands between 13 and 230 kDa. Because only a fraction of those were separable by two-dimensional electrophoresis, this lead to a significant bias, in particular concerning CWPs and presumably other cargo proteins that do not migrate into these gels. Despite the relatively clear-cut result presented in Fig. 1, the two-dimensional electrophoresis and MS analysis showed that the low-density ESV fractions (10-12) can be contaminated with proteins from the neighboring plasma membrane and cytoplasmic fractions (14-18). This was suggested by the identification of cytoplasmic and plasma membrane proteins, such as giardins, ornithine carbamoyltransferase, and proteasome subunits. However, we do not know if these proteins change their localization and localize to the ESVs during encystation. {alpha}1-Giardin changed its localization during encystation and localized to the surface of the excyzoite, just inside of the cyst wall. Overexpression of {alpha}7-giardin disturbed cell division; it can even induce encystation of trophozoites and the recombinant protein localized to the cyst wall (30). Membrane-bound forms of glutamate dehydrogenase have been shown to mediate ATP dependent binding of vesicles to the microtubule system (31). Further studies will show if these proteins associate with ESVs, and if so, what functions they have during encystation.


Figure 4
View larger version (50K):
[in this window]
[in a new window]
  		FIGURE 4.
Identification and subcellular localization of proteasome subunits. A, polyclonal mouse antibodies against a recombinant {alpha}7 subunit of the 20 S complex and a giardial Cim5 homologue of 19 S cap structure detect single bands of the predicted sizes in total protein (pooled fractions 1-18) separated by SDS-PAGE and blotted to nitrocellulose. B, Western blot analysis of density fractionated organelle-derived microsomes and densitometry (see also Fig. 1). Proteins were separated by SDS-PAGE, blotted to nitrocellulose, and incubated with the antibodies against Gi{alpha}7 and GiCim5. C, analysis of subcellular localization of Gi{alpha}7 in trophozoites (0 h) and encysting (2, 6, and 14 h) cells by confocal microscopy using Gi{alpha}7-specific and anti-CWP antibodies. Extensive recruitment of Gi{alpha}7 is detected at 2 and 6 h post-induction but not at 14 h. Single confocal sections are shown. Insets, differential interference contrast (DIC) images of cells. Nuclei are stained with DAPI (blue). Panels on the right show three-dimensional reconstructions from entire image stacks including surface rendering.

 
The identification of structural ({alpha}) and catalytic (beta) subunits of the giardial 20 S proteasome complex (32) in the ESV/Golgi fraction was unexpected. In mammalian cells and in yeast proteasome complexes localize at ER membranes (33) in addition to the cytoplasm and the nucleoplasm. However, this association is not known to be stable and thus it is formally possible that the detection of proteasome subunits in fraction 11/12 was the result of complexes co-purifying in the sucrose gradient. On the other hand, CLSM analysis demonstrated that the giardial 20 S core complex, as well as the 19 S cap structure was indeed associated with ESV membranes during early encystation until at least 7 h post-induction. As noted previously, expression of proteasome subunits is not up-regulated in encysting cells (32). Our CLSM data indicated a re-localization from more peripheral sites in the cytoplasm to the vicinity of ESVs, indicative of a high rate of retrotranslocation of organelle proteins destined for degradation. Retrotranslocation connected to ER-associated degradation usually occurs through a pore formed by trimeric Sec61 complexes in the ER membrane. Depending on the nature of the target protein (lumenal, single, or multiple transmembrane) and the site of the lesion, retrotranslocation to the cytoplasm occurs directly or after export to the cis-Golgi and retrieval by COPI-mediated transport (34). Hence, we propose that proteasome recruitment during encystation is a consequence of quality control and cargo maturation processes in the ER and early ESVs (i.e. protein folding, hetero-oligomerization, and trimming) producing large amounts of material destined for degradation. As explained in Fig. 7, there are two possible scenarios for the translocation of this material to the cytoplasm: (i) retrotranslocation directly across ESV membranes, and/or (ii) retrograde transport via COPI-dependent mechanisms from the ESVs to adjoining ER compartments followed by retrotranslocation and degradation via classical ER-associated degradation pathways. Based on the general conservation of these pathways in eukaryotes in general, and the observed proteasome recruitment to the ER containing CWPs in particular (Fig. 4C, second row), we favor the second scenario.


Figure 5
View larger version (77K):
[in this window]
[in a new window]
  		FIGURE 5.
Subcellular localization of tagged BiP variants in encysting cells. A, HA-tagged wild-type BiP (BiP-HA, green) localizes predominantly to the ER with little or no overlap with the CWP signal (red). B, mutations in the ER retrieval signal leads to trapping of the BiP variant (NDDL-BiP-HA) in post-ER compartments containing CWP. Single confocal sections from image stacks and differential interference contrast (DIC) images of the cells are shown. Nuclei are stained with DAPI (blue). Bottom rows in A and B show three-dimensional reconstructions of image stacks including surface rendering. Bottom right panels show three-dimensional volume images only.

 


Figure 6
View larger version (78K):
[in this window]
[in a new window]
  		FIGURE 6.
Addition of DTT alters ESV morphology. A, representative control cell at 8 h post-induction showing numerous ESVs. Image stacks were collected by confocal microscopy from encysting cells incubated with an anti-PDI2 antibody as a marker for ER membranes (green) and with anti-CWP antibody (red). PDI2 is mostly excluded from these more mature ESVs. Some ESVs are stained adequately with anti-CWP only in the periphery because of poor penetration of the antibody into the organelle contents. B, representative cell after treatment with DTT for 30 min. Note that the morphologically altered ESVs still exclude the ER marker PDI2. Single confocal sections from image stacks and differential interference contrast (DIC) images of the cells are shown. Nuclei are stained with DAPI (blue). Bottom rows in A and B show three-dimensional reconstructions of image stacks including surface rendering and enlarged sections.

 


Figure 7
View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 7.
Current model of ESV genesis and maturation. ESVs are highly dynamic compartments dedicated to accumulation and post-translational maturation of cyst wall proteins. Proteasome complexes are recruited to the vicinity of ESVs, suggesting a specific function in the cargo/organelle maturation process. Cargo protein maturation processes in ESVs are subject to quality control mechanisms requiring removal and degradation of misfolded proteins. Scenario I, misfolded cargo is directly retrotranslocated across the ESV membrane. Scenario II, misfolded cargo is transported back to the ER via a COPI-dependent retrograde pathway and subsequently translocated to the cytoplasm via a classical ER-associated degradation pathway. Accumulation of a non-retrievable BiP variant in ESVs suggests the BiP cycles through these compartments. Typical ESV morphology is dependent on the maturation state of their cargo proteins. This implies that the characteristic round shape is maintained actively, perhaps with the help of peripheral matrix proteins. N, nucleus.

 
Recruitment of proteasomes to ESVs also hints at the existence of additional (post-ER) levels of quality control during export of cyst wall material. This might be required because of the large amounts of newly synthesized cyst wall material to be exported to ESVs in a short time. There are indications for bulk transport (10), i.e. aggregation of cyst wall material in enlarged ER cisternae, which could subsequently transform into large carrier compartments and nascent ESVs similar to export of procollagen in mammalian cells (36). Procollagen aggregates are too large to fit into the ~70-nm COPII-coated transport vesicles and instead accumulate in large pleiomorphic ER-derived carriers in a SarI-dependent manner before joining the cis-Golgi compartment. In Giardia a similar scenario for ER export of CWPs might result in insufficient quality control on the ER level. Hence, processing and quality control of ESV cargo may be completed in early ESVs, which assume the role of a post-ER quality control compartment, similar to dedicated compartments in mammalian cells (37).

Detection of giardial BiP in the ESV-derived microsome fraction was consistent with the notion of extended quality control during export of cyst wall material. Yeast BiP is required to unfold and escort rejected proteins to the Sec61 pore complex (38). The presence of a C-terminal KDEL retrieval sequence implied export to post-ER compartments and subsequent retrieval by COPI-dependent transport. Indeed, accumulation of mutated NDDL-BiP-HA in compartments containing CWPs was direct evidence that the chaperone cycled through ESVs. These results further confirmed the nature of ESVs as specialized Golgi-like delay compartments for protein maturation and provided direct support for two hypotheses. First, ESVs are indeed bona fide post-ER vesicles, which remain in communication with the ER. This was also demonstrated by the segregation of ER resident PDI2 and exported CWP. Second, we showed that a ER retrieval signal is necessary for export of giardial BiP from ESVs, consistent with CLSM observations of COPI components associated with ESV membranes (4) as well sensitivity of ESVs to brefeldin A.

In contrast to the normal eukaryotic Golgi with its typical morphology, ESVs are apparently unorganized spherical compartments, randomly distributed in the cell, and with no known connection to cytoskeleton elements. Occasional flattened cisternae and clefts in EM sections of encysting cells likely represent organized smooth ER induced by weak homotypic interaction of ER membrane proteins (39) rather than bona fide Golgi stacks. Around 2 h post-induction, cyst wall material begins to accumulate in the ER, leading to swollen, sheath-like or even polygonal compartment morphology. This morphology is transient and rapidly replaced by small spherical structures resembling ER exit sites and nascent ESVs, which undergo homotypic fusion. Here we showed that reduction of disulfide bonds using the thiol-reducing agent DTT during encystation (21) profoundly and reversibly altered this typical ESV morphology. In all eukaryotes, DTT efficiently prevents proteins from folding properly and leaving the ER, there by causing accumulation of cargo leading to an unfolded protein response by these cells (40). Giardia apparently lacks this pathway (21), which may explain its unusual capacity for accumulating misfolded heterologous proteins in the ER (41). If we assume that in Giardia, as in all other eukaryotes, misfolded cargo is normally retrotranslocated from the ER, this fact may also explain why the use of proteasome inhibitors failed to show immediate consequences for ESV formation and encystation. However, hetero-oligomers of CWPs in ESVs are clearly sensitive to DTT and disassemble/unfold (21), indicating their relatively immature state at this stage of export. Whereas the ER morphology appeared normal in the presence of DTT, the Golgi-like ESVs assumed a flattened shape reminiscent of ER cisternae, and more interestingly, membrane stacks (Fig. 6B, enlarged three-dimensional image). In post-ER compartments of mammalian cells, the effects of DTT include defects in protein processing, transport to the trans-Golgi, or mis-sorting of proteins (42). In contrast to brefeldin A, which disperses the Golgi (23, 35) and giardial ESVs alike, DTT is not known to have immediate effects on the Golgi structure of mammalian cells. Alteration of Golgi structure and organization would only be expected secondarily, as a result of reduced cargo traffic from the ER. Because most of the cyst wall material is already exported from the ER at 8 h post-induction, the dramatic change of ESV morphology is not easily interpreted. Importantly, we showed that ESVs strictly maintained their compartment identity in the presence of DTT. Thus, retrograde transport, as seen after brefeldin A treatment, and re-establishment of large ER sheath structures cannot be invoked. A possible explanation should take at least three aspects into account: (i) an active mechanism for the maintenance of a spherical ESV morphology, (ii) peripheral, large coiled-coil "matrix proteins" (e.g. golgins) to stabilize ESVs, and (iii) a transducing mechanism that "senses" and transmits the state of cargo maturity across ESV membranes. The latter might also play a role in stage-specific recruitment of peripheral effectors such as COPI, proteasome, dynamin-like protein, and clathrin (4), as well as converting ESVs from maturation compartments to secretory competent vesicles (14).

Taken together, our data strongly support the notion that ESVs are post-ER compartments, which undergo active maturation processes. The nature of their cargo requires an efficient quality control system, presumably acting initially at the level of ER (i.e. ER-associated degradation), as in other eukaryotes. However, the large volume of cyst wall material exported from the ER might necessitate that quality control mechanisms, e.g. retrograde transport and/or retrotranslocation of cargo targeted for degradation, be continued at the post-ER, i.e. ESV, level. ESV formation in Giardia is a unique form of developmentally regulated Golgi neogenesis, limited to the export of a specific set of pre-sorted cargo proteins. In the context of the basal position of Giardia in eukaryotic evolution this provides an excellent model for the study of basic mechanisms for protein sorting, ER export, and cis-Golgi formation.


   FOOTNOTES
 
* This work was supported by a grant from the Swiss National Science Foundation (to A. B. H.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed. Tel.: 41-44-635-8526/30; Fax: 41-1-635-8907; E-mail: Adrian.Hehl{at}access.unizh.ch.

2 The abbreviations used are: ESV, encystation-specific vesicle; ER, endoplasmic reticulum; CWP, cyst wall protein; DTT, dithiothreitol; HA, Haemophilus agglutinin; ORF, open reading frame; PBS, phosphate-buffered saline; MALDI, matrix-assisted laser desorption ionization; GGD, Giardia Genome Database; DAPI, 4,6-diamidino-2-phenylindole; CLSM, confocal laser scanning microscopy; COPI, coat protein complex I. Back

3 S. Stefanic and A. B. Hehl, unpublished data. Back

4 S. G. Svärd and A. B. Hehl, unpublished observations. Back


   ACKNOWLEDGMENTS
 
We are indebted to Dr. A. Regoes for the analysis of IscU distribution and T. Michel for excellent technical assistance. We gratefully acknowledge the Giardia Genome Project for making genome data accessible prior to publication.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Adam, R. D. (2001) Clin. Microbiol. Rev. 14, 447-475[Abstract/Free Full Text]
  2. Roger, A. J., Morrison, H. G., and Sogin, M. L. (1999) J. Mol. Evol. 48, 750-755[CrossRef][Medline] [Order article via Infotrieve]
  3. Sogin, M. L., Gunderson, J. H., Elwood, H. J., Alonso, R. A., and Peattie, D. A. (1989) Science 243, 75-77[Abstract/Free Full Text]
  4. Marti, M., Regos, A., Li, Y., Schraner, E. M., Wild, P., Muller, N., Knopf, L. G., and Hehl, A. B. (2003) J. Biol. Chem. 278, 24837-24848[Abstract/Free Full Text]
  5. McArthur, A. G., Morrison, H. G., Nixon, J. E., Passamaneck, N. Q., Kim, U., Hinkle, G., Crocker, M. K., Holder, M. E., Farr, R., Reich, C. I., Olsen, G. E., Aley, S. B., Adam, R. D., Gillin, F. D., and Sogin, M. L. (2000) FEMS Microbiol. Lett. 189, 271-273[CrossRef][Medline] [Order article via Infotrieve]
  6. Ferguson, D. J., Belli, S. I., Smith, N. C., and Wallach, M. G. (2003) Int. J. Parasitol. 33, 1329-1340[CrossRef][Medline] [Order article via Infotrieve]
  7. Frisardi, M., Ghosh, S. K., Field, J., Van Dellen, K., Rogers, R., Robbins, P., and Samuelson, J. (2000) Infect. Immun. 68, 4217-4224[Abstract/Free Full Text]
  8. Arroyo-Begovich, A., Carabez-Trejo, A., and Ruiz-Herrera, J. (1980) J. Parasitol. 66, 735-741[CrossRef][Medline] [Order article via Infotrieve]
  9. Petri, W. A., Jr. (2002) Curr. Opin. Microbiol. 5, 443-447[CrossRef][Medline] [Order article via Infotrieve]
  10. Lanfredi-Rangel, A., Attias, M., Reiner, D. S., Gillin, F. D., and De Souza, W. (2003) J. Struct. Biol. 143, 153-163[CrossRef][Medline] [Order article via Infotrieve]
  11. Lujan, H. D., Marotta, A., Mowatt, M. R., Sciaky, N., Lippincott-Schwartz, J., and Nash, T. E. (1995) J. Biol. Chem. 270, 4612-4618[Abstract/Free Full Text]
  12. Hehl, A. B., Marti, M., and Kohler, P. (2000) Mol. Biol. Cell. 11, 1789-1800[Abstract/Free Full Text]
  13. Gillin, F. D., Boucher, S. E., Rossi, S. S., and Reiner, D. S. (1989) Exp. Parasitol. 69, 164-174[CrossRef][Medline] [Order article via Infotrieve]
  14. Hehl, A. B., and Marti, M. (2004) Mol. Microbiol. 53, 19-28[CrossRef][Medline] [Order article via Infotrieve]
  15. Marti, M., and Hehl, A. B. (2003) Trends Parasitol. 19, 440-446[CrossRef][Medline] [Order article via Infotrieve]
  16. Lujan, H. D., and Touz, M. C. (2003) Cell. Microbiol. 5, 427-434[CrossRef][Medline] [Order article via Infotrieve]
  17. Marti, M., Li, Y., Schraner, E. M., Wild, P., Kohler, P., and Hehl, A. B. (2003) Mol. Biol. Cell 14, 1433-1447[Abstract/Free Full Text]
  18. Davids, B. J., Mehta, K., Fesus, L., McCaffery, J. M., and Gillin, F. D. (2004) Mol. Biochem. Parasitol. 136, 173-180[CrossRef][Medline] [Order article via Infotrieve]
  19. Touz, M. C., Nores, M. J., Slavin, I., Carmona, C., Conrad, J. T., Mowatt, M. R., Nash, T. E., Coronel, C. E., and Lujan, H. D. (2002) J. Biol. Chem. 277, 8474-8481[Abstract/Free Full Text]
  20. Slavin, I., Saura, A., Carranza, P. G., Touz, M. C., Nores, M. J., and Lujan, H. D. (2002) Mol. Biochem. Parasitol. 122, 95-98[CrossRef][Medline] [Order article via Infotrieve]
  21. Reiner, D. S., McCaffery, J. M., and Gillin, F. D. (2001) Cell. Microbiol. 3, 459-472[CrossRef][Medline] [Order article via Infotrieve]
  22. Pal, A., Hall, B. S., Nesbeth, D. N., Field, H. I., and Field, M. C. (2002) J. Biol. Chem. 277, 9529-9539[Abstract/Free Full Text]
  23. Donaldson, J. G., and Klausner, R. D. (1994) Curr. Opin Cell Biol. 6, 527-532[CrossRef][Medline] [Order article via Infotrieve]
  24. Regoes, A., Zourmpanou, D., Leon-Avila, G., van der Giezen, M., Tovar, J., and Hehl, A. B. (2005) J. Biol. Chem. 280, 30557-30563[Abstract/Free Full Text]
  25. Gerwig, G. J., van Kuik, J. A., Leeflang, B. R., Kamerling, J. P., Vliegenthart, J. F., Karr, C. D., and Jarroll, E. L. (2002) Glycobiology 12, 499-505[Abstract/Free Full Text]
  26. Gupta, R. S., Aitken, K., Falah, M., and Singh, B. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2895-2899[Abstract/Free Full Text]
  27. Lujan, H. D., Mowatt, M. R., Conrad, J. T., and Nash, T. E. (1996) Biol. Cell 86, 11-18[CrossRef][Medline] [Order article via Infotrieve]
  28. Soltys, B. J., Falah, M., and Gupta, R. S. (1996) J. Cell Sci. 109, 1909-1917[Abstract]
  29. Gonzalez, J., Bai, G., Frevert, U., Corey, E. J., and Eichinger, D. (1999) Eur. J. Biochem. 264, 897-904[Medline] [Order article via Infotrieve]
  30. Weiland, M. E., McArthur, A. G., Morrison, H. G., Sogin, M. L., and Svard, S. G. (2005) Int. J. Parasitol. 35, 617-626[CrossRef][Medline] [Order article via Infotrieve]
  31. Rajas, F., and Rousset, B. (1993) Biochem. J. 295, 447-455[Medline] [Order article via Infotrieve]
  32. Emmerlich, V., Scholze, H., Gillin, F. D., and Bakker-Grunwald, T. (2001) Parasitol. Res. 87, 112-115[CrossRef][Medline] [Order article via Infotrieve]
  33. Enenkel, C., Lehmann, A., and Kloetzel, P. M. (1998) EMBO J. 17, 6144-6154[CrossRef][Medline] [Order article via Infotrieve]
  34. Vashist, S., Kim, W., Belden, W. J., Spear, E. D., Barlowe, C., and Ng, D. T. (2001) J. Cell Biol. 155, 355-368[Abstract/Free Full Text]
  35. Donaldson, J. G., Finazzi, D., and Klausner, R. D. (1992) Nature 360, 350-352[CrossRef][Medline] [Order article via Infotrieve]
  36. Mironov, A. A., Mironov, A. A., Jr., Beznoussenko, G. V., Trucco, A., Lupetti, P., Smith, J. D., Geerts, W. J., Koster, A. J., Burger, K. N., Martone, M. E., Deerinck, T. J., Ellisman, M. H., and Luini, A. (2003) Dev. Cell 5, 583-594[CrossRef][Medline] [Order article via Infotrieve]
  37. Kamhi-Nesher, S., Shenkman, M., Tolchinsky, S., Fromm, S. V., Ehrlich, R., and Lederkremer, G. Z. (2001) Mol. Biol. Cell 12, 1711-1723[Abstract/Free Full Text]
  38. Nishikawa, S. I., Fewell, S. W., Kato, Y., Brodsky, J. L., and Endo, T. (2001) J. Cell Biol. 153, 1061-1070[Abstract/Free Full Text]
  39. Snapp, E. L., Hegde, R. S., Francolini, M., Lombardo, F., Colombo, S., Pedrazzini, E., Borgese, N., and Lippincott-Schwartz, J. (2003) J. Cell Biol. 163, 257-269[Abstract/Free Full Text]
  40. Benedetti, C., Fabbri, M., Sitia, R., and Cabibbo, A. (2000) Biochem. Biophys. Res. Commun. 278, 530-536[CrossRef][Medline] [Order article via Infotrieve]
  41. Gaechter, V., and Hehl, A. B. (2005) Int. J. Parasitol. 35, 1359-1368[CrossRef][Medline] [Order article via Infotrieve]
  42. Van Horssen, A. M., Van Kuppeveld, F. J., and Martens, G. J. (1998) J. Neurochem. 71, 402-409[Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Eukaryot CellHome page
D. M. Ratner, J. Cui, M. Steffen, L. L. Moore, P. W. Robbins, and J. Samuelson
Changes in the N-Glycome, Glycoproteins with Asn-Linked Glycans, of Giardia lamblia with Differentiation from Trophozoites to Cysts
Eukaryot. Cell, November 1, 2008; 7(11): 1930 - 1940.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
N. Gottig, E. V. Elias, R. Quiroga, M. J. Nores, A. J. Solari, M. C. Touz, and H. D. Lujan
Active and Passive Mechanisms Drive Secretory Granule Biogenesis during Differentiation of the Intestinal Parasite Giardia lamblia
J. Biol. Chem., June 30, 2006; 281(26): 18156 - 18166.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/11/7595    most recent
M510940200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stefanic, S.
Right arrow Articles by Hehl, A. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stefanic, S.
Right arrow Articles by Hehl, A. B.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement