![]()
|
|
||||||||
J. Biol. Chem., Vol. 281, Issue 14, 9538-9546, April 7, 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
-Ketoacyl-Acyl Carrier Protein Synthase Involved in Fatty Acid Biosynthesis of Plasmodium falciparum Using Natural and Artificial Substrates*



1
From the
Pharmaceutical Biochemistry Group, School of Pharmaceutical Sciences, University of Geneva, University of Lausanne, Quai Ernest-Ansermet 30, CH-1211 Geneva 4, Switzerland, the
Department of Chemistry and Applied BioSciences, Swiss Federal Institute of Technology, Winterthurerstrasse 190, CH-8057 Zurich, Switzerland, and ¶Collegium Helveticum, University of Zurich and Swiss Federal Institute of Technology, Schmelzbergstrasse 25, CH-8092 Zurich, Switzerland
Received for publication, August 18, 2005 , and in revised form, January 11, 2006.
| ABSTRACT |
|---|
|
|
|---|
-Ketoacyl-acyl carrier protein (ACP) synthase (PfFabBF), being the only elongating
-ketoacyl-ACP synthase in P. falciparum, is a potential candidate for inhibition. In this study we present the cloning, expression, purification, and characterization of PfFabBF. Soluble protein was obtained when PfFabBF was expressed as a NusA fusion protein in Escherichia coli BL21(DE3)-CodonPlus-RIL cells under conditions of osmotic stress. The fusion protein was purified by affinity and ion exchange chromatography. Various acyl-P. falciparum acyl carrier protein (PfACP) substrates were tested for their specific activities, and their kinetic parameters were determined. Activity of PfFabBF was highest with C4:0- to C10:0-acyl-PfACPs and decreased with use of longer chain acyl-PfACPs. Consistent with the fatty acid synthesis profile found in the parasite cell, no activity could be detected with C16:0-PfACP, indicating that the enzyme is lacking the capability of elongating acyl chains that are longer than 14 carbon atoms. PfFabBF was found to be specific for acyl-PfACPs, and it displayed much lower activities with the corresponding acyl-CoAs. Furthermore, PfFabBF was shown to be sensitive to cerulenin and thiolactomycin, known inhibitors of
-ketoacyl-ACP synthases. These results represent an important step toward the evaluation of P. falciparum
-ketoacyl-ACP synthase as a novel antimalaria target. | INTRODUCTION |
|---|
|
|
|---|
The importance of lipids for parasite survival has generated much interest in the enzymes responsible for their biosynthesis. Their inhibition has been shown repeatedly to be a suitable target for antimicrobials (9). Thus, the intervention at the level of P. falciparum FAS-II represents a very promising approach for the development of new antimalarials (10, 11).
Among the inhibitors described to act against various targets in FAS-I and FAS-II, thiolactomycin and cerulenin are known to inhibit the
-ketoacyl-ACP synthases FabB and FabF of bacteria (e.g. Escherichia coli and Mycobacterium tuberculosis) and plants (e.g. Pisum sativum and Allium porrum) (12-17). Cerulenin inactivates the enzymes irreversibly, forming a covalent adduct with the active site cysteine (14). Thiolactomycin is a reversible inhibitor that competes with malonyl-ACP for binding (16-21).
-Ketoacyl-ACP synthases catalyze the Claisen condensation reaction, transferring an acyl primer to malonyl-ACP and thereby creating a
-ketoacyl-ACP product that has been lengthened by a two-carbon unit. In the type II FAS of plants and bacteria, three
-ketoacyl-ACP synthases with different substrate specificities have emerged as important regulators of the initiation and elongation steps in the pathway. The initiation enzyme
-ketoacyl synthase III (FabH) only catalyzes the elongation of malonyl-ACP by an acetyl-CoA primer, whereas the elongation enzymes
-ketoacyl synthase I and II (FabB and FabF) use acyl-ACPs for elongation of malonyl-ACP (18).
Sequencing of the full genome of P. falciparum revealed that the parasite possesses only one isoform of the elongating condensing enzyme, PfFabBF. As PfFabBF is unique, its activity cannot be replaced by another
-ketoacyl-ACP synthase, which makes it a very promising target. To date there are no data available concerning substrate specificity and kinetic parameters of PfFabBF. To this end, we present the cloning, expression, and purification of this enzyme. A recombinant expression and purification system was established, allowing the production of significant amounts of active enzyme that are suitable for the characterization using natural acyl-PfACP substrates as well as the corresponding acyl-CoA analogs.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Multiple Sequence AlignmentSequences of
-ketoacyl-ACP synthases of various organisms were aligned using the ClustalW alignment program (22). The sequences were obtained from the SwissProt data base and included E. coli FabB (SwissProt primary accession number P14926) and FabF (P39435), Arabidopsis thaliana FabB (P52410
[GenBank]
) and FabF (Q9C9P4), and P. falciparum FabBF (Q6LF11).
Cloning of the P. falciparum PfFabBF Expression PlasmidsA two-step megaprimer PCR method (23, 24) was used to create a pffabBF clone that carried a 171-bp truncation at the N terminus. In the first step, two overlapping fragments of the pffabBF gene were PCR-amplified from P. falciparum 3D7 gDNA (MRA-386, MR4; ATCC, Manassas VA). The first fragment was amplified using the forward primer 5'-ACTTCTAGAGTGGTGTGCACAG and the reverse primer 5'-CCTGAACCTTCTCCCATAACGAAACCACACG. The second fragment was generated using the following primer pair: 5'-GAAGTGGTTTCGTTATGGGAGAAGGTTCAGG and 5'-TCACTTTACAATTTTTTTGAAAAGTAATG. In a second step, the above mentioned fragments were combined to give the final insert using forward primer 5'-TGGTTCCATGGCTTCTAGAGTGGTGTGCACAGGTGTAGGGGTA and reverse primer 5'-CCGAATTCTCACTTTACAATTTTTTTGAAAAGTAATGCTGTGTTATGGCCTCC who carried NcoI and EcoRI restriction sites, respectively (underlined). The PCR program for both reactions consisted of an initial 2-min denaturation step (94 °C), followed by 25 cycles of 94 °C for 30 s, 45 °C for 30 s, 48 °C for 90 s, and 60 °C for 60 s, followed by a final elongation step at 60 °C for 5 min. The amplified gene was digested with NcoI and EcoRI and ligated into pET30b vector using T4 DNA ligase.
An 18-bp-long stretch of DNA, coding for six additional amino acids (i.e. KNLCET) of the original pffabBF N terminus, was introduced by site-directed mutagenesis using as template the plasmid described above. The following primers were used: 5'-GGTACCGACGACGACGACAAGCATATGAAAAATCTTTGTGAAACTTCTAGAGTGGTGTGCACAGGTGTAGGGGT and 5'-ACCCCTACACCTGTGCACACCACTCTAGAAGTTTCACAAAGATTTTTCATATGCTTGTCGTCGTCGTCGGTACC. The amplification was carried out with Pfu Turbo polymerase. The PCR program consisted of a 2-min initial denaturation step at 94 °C, followed by 18 cycles of 95 °C for 50 s, 48 °C for 60 s, 52 °C for 60 s, and 68 °C for 14 min, and a final polishing step at 68 °C for 7 min. The original plasmid was digested with DpnI at 37 °C for 90 min. The remaining mutated plasmid was purified by ethanol precipitation and used to transform CaCl2 competent Nova Blue E. coli cells. Positive mutants were identified by sequencing.
|
Expression and Purification of PfFabBFThe final pET43.1b-PfFabBF clone was designed to express PfFabBF as NusA fusion protein with an expected molecular mass of 107 kDa, covering amino acids 52-474 of the
-ketoacyl-ACP synthase part. The expression plasmid was introduced into BL21(DE3)-CodonPlus-RIL expression cells. The cells were used to inoculate 500 ml of TB medium supplemented with 1 mM betaine, 660 mM sorbitol, ampicillin (100 µg/ml), and chloramphenicol (34 µg/ml) and grown overnight at 37 °C. The temperature was then lowered to 25 °C, and protein production was induced with 1 mM isopropyl
-D-thiogalactopyranoside for 7 h. The cells were harvested by centrifugation, resuspended in lysis buffer (20 mM NaH2PO4, 500 mM NaCl, 20 mM imidazole, 2 mM DTT, 10% glycerol, pH 7.5) containing DNase, and disrupted by passing them twice through a French press. The extract was clarified, and the supernatant was applied to a 5-ml HisTrap chelating column. The column was washed with 4 column volumes of lysis buffer and eluted by means of a 50-ml linear imidazole gradient using buffer A (20 mM NaH2PO4, 500 mM NaCl, 2 mM DTT, 10% glycerol, pH 7.5) and buffer B (20 mM NaH2PO4, 500 mM NaCl, 500 mM imidazole, 2 mM DTT, 10% glycerol, pH 7.5). Fractions containing PfFabBF were pooled, concentrated (Centriprep, 30-kDa cut-off), diluted to a final NaCl concentration of 50 mM, and loaded on a 5-ml HiTrap SP-Sepharose HP column. The protein was eluted with a linear NaCl gradient using buffer C (20 mM NaH2PO4, 2 mM DTT, pH 7.5) and buffer D (20 mM NaH2PO4,1 M NaCl, 2 mM DTT, pH 7.5). The fractions containing the fusion protein were again pooled, concentrated, and either applied on a Superdex 200 column equilibrated with buffer E (20 mM NaH2PO4, 300 mM NaCl, 2 mM DTT, 10% glycerol, pH 7.5) or desalted by ultrafiltration (Amicon Ultra 4, 30-kDa cut-off), depending on the required degree of purity. Total protein concentration was determined by a dye-binding assay (25). The purified protein was stored at +4 °C.
Cloning and Expression of P. falciparum ACPAcyl-PfACPs are the natural substrates of PfFabBF and are thus needed for its characterization. PfACP has been cloned and expressed in a similar way as described earlier (26, 27). Briefly, the pfacp gene sequence N-terminally truncated by 180 bp was PCR-amplified from a P. falciparum strain 3D7 gametocyte stage cDNA pSPORT plasmid library (kindly provided by Dr. T. Templeton, Weill Medical College of Cornell University) and ligated into the pET28b expression vector. Correct clones were identified and verified by restriction digestion, PCR, and automated sequencing with T7 forward and reverse primers. The resulting clone was designed to express PfACP without the putative N-terminal signal and translocation sequence, i.e. amino acids 1-60. PfACP, consisting of residues 61-137, was expressed for 8 h at 37 °C in TB medium supplemented with kanamycin (100 µg/ml) and chloramphenicol (34 µg/ml) using BL21(DE3)-CodonPlus-RIL expression cells. After isolation on a HisTrap chelating column and subsequent imidazole gradient elution, the N-terminal His tag was removed by thrombin digestion. The protein was concentrated, diluted in buffer A (20 mM BisTris, pH 6.5) to a final NaCl concentration of 50 mM, and applied to a 5-ml HiTrap Q-Sepharose XL column in order to separate the apo-form of the protein from the holo-form. Apo-PfACP and holo-PfACP were separated by applying a linear NaCl gradient (120 ml) using buffer A and buffer B (20 mM BisTris, 1 M NaCl, pH 6.5). Fractions containing apo-PfACP were pooled and reapplied to the column. Three runs were necessary to complete the separation. The purity of apo-PfACP was verified by conformational sensitive gel electrophoresis (CS-PAGE) (28, 29). The pure fractions were concentrated (Centriprep, 3-kDa cut-off) and stored at -20 °C.
Cloning and Expression of E. coli ACPSIn order to produce the acyl-PfACPs enzymatically, EcACPS has been cloned and expressed essentially as described earlier (30). Briefly, the complete acpS coding sequence was amplified from E. coli genomic DNA and ligated into the pET30b expression vector. Correct clones were identified and verified by restriction digestion, PCR, and automated sequencing with T7 forward and reverse primers. The resulting plasmid was introduced into BL21(DE3)-CodonPlus-RIL expression cells, and the protein was expressed for 8 h at 37 °C in TB medium supplemented with kanamycin (100 µg/ml) and chloramphenicol (34 µg/ml). After isolation on a HisTrap chelating column and subsequent imidazole gradient elution, EcACPS was desalted by applying the concentrated fractions to a PD10 column. The protein was eluted with a buffer containing 20 mM Tris, pH 8.0, 150 mM NaCl, 10% glycerol, and 3 mM DTT.
Cloning, Expression, and Purification of PfFabGActivity assays of PfFabBF were performed by coupling the synthase activity of PfFabBF to the reductase activity of PfFabG. A pffabG sequence N-terminally truncated by 162 bp was PCR-amplified from a P. falciparum (strain 3D7) gametocyte cDNA pSPORT plasmid library and after restriction digestion was ligated into the pET30b expression vector. Correct clones were identified and verified by restriction digestion, PCR, and automated sequencing with T7 forward and reverse primers. The resulting clone was designed to express the enzyme without the putative N-terminal signal and translocation sequence, i.e. amino acids 1-54. PfFabG, consisting of residues 55-304, was expressed for 6 h at 37°C using BL21(DE3)-CodonPlus-RIL cells. Purification of the protein was performed as described for PfFabI (31), except that a linear imidazole gradient was applied.
Preparation of Acylated PfACP SubstratesC4:0 to C16:0 acyl-PfACPs were generated using EcACPS. A typical reaction (1 ml) contained 100 µM of the corresponding acyl-CoA, 250 µg of EcACPS, 1 mg of apo-PfACP, 25 mM MgCl2 in 20 mM Tris, pH 7.5. For higher amounts of substrates, the protocol was scaled up accordingly. The mixture was incubated at 37 °C for 1 h. EcACPS was eliminated from the mixture by binding it to nickel-nitrilotriacetic acid-agarose. Afterward the acyl-PfACPs were concentrated and desalted by means of a PD10 column equilibrated with 20 mM NaH2PO4 and 300 mM NaCl, pH 7.5. The purity of acyl-PfACPs was confirmed by CS-PAGE (28, 29).
Enzyme AssaysA continuous assay format was used to monitor the PfFabBF activity by coupling the condensing activity of PfFabBF to PfFabG. FabG reduces
-ketoacyl-ACPs to the corresponding
-hydroxyacyl-ACPs by simultaneous oxidation of its cofactor NADPH to NADP+, allowing the reaction course to be monitored spectrophotometrically at 340 nm. Control experiments, such as performing the reaction either without substrates or without enzyme, were carried out to rule out unspecific oxidase activity.
Specific activity measurements of the acyl-PfACPs were performed at 37 °C and contained 30 µM malonyl-PfACP, 30 µM acyl-PfACP (1 mM for the acyl-CoA series), and 5 µg of PfFabG in assay buffer (20 mM NaH2PO4, 300 mM NaCl, 80 µM NADPH, 1 mM DTT, pH 7.5) in a total volume of 100 µl. The reaction was started with the addition of 3 µg of PfFabBF. The course of the reaction was monitored for 1 min, and the rates of product formation were expressed as pmol/min. The substrate specificity of PfFabBF was additionally checked by CS-PAGE in order to exclude the possibility of PfFabG being the limiting factor.
Kinetic measurements were performed with C4:0- to C14:0-PfACPs under Michaelis-Menten conditions at 37 °C using various concentrations of acyl-PfACP (25, 50, 100, 200, 300, 400, 500, 600, and 800 µM), malonyl-PfACP at saturating conditions (400 µM), and 5 µg of PfFabG in assay buffer (final volume 100 µl). The kinetic parameters of malonyl-PfACP were determined using 500 µM C4:0-PfACP and various concentrations of malonyl-PfACP (6.25, 12.5, 25, 50, 100, 200, and 400 µM). The reaction was started with the addition of 3 µg of PfFabBF. Control experiments (e.g. linearity of the rate of product formation at different PfFabBF concentrations) were performed to show that PfFabG is not the rate-limiting step in the reaction.
Cerulenin Inhibition AssayTime dependence of cerulenin (CER) inhibition was analyzed by adding 3 µg of PfFabBF that had been preincubated with 100 µM CER for 0, 10, 15, 20, 30, 45, 60, and 120 s to the assay buffer containing 30 µM malonyl-PfACP, 30 µM hexanoyl-PfACP, and 5 µg of PfFabG (total volume 100 µl). The IC50 value was determined using various concentrations of CER (0, 1, 10, 25, 50, and 100 µM) in the reaction mixture described above. The reaction was started without preincubation by the addition of 3 µg of enzyme. The irreversibility of CER inhibition was confirmed by adding inhibited enzyme to the reaction mixture described above, thereby diluting the CER concentration 20-fold. All measurements were performed at 37 °C.
|
| RESULTS |
|---|
|
|
|---|
-ketoacyl-ACP synthase I/II homolog of the P. falciparum pathway have not been reported yet in the literature. The Plasmodium Genome Data base (32) proposed the open reading frame PFF1275c to be the mentioned
-ketoacyl-ACP synthase (PfFabBF). To confirm this hypothesis, we cloned the cDNA corresponding to PFF1275c and characterized its gene product PfFabBF.
Multiple Sequence AlignmentThe open reading frame encodes a protein of 474 amino acids with an expected molecular mass of 52.6 kDa. PfFabBF has a long N-terminal extension that is characteristic of bipartite N-terminal presequences found in Plasmodium and Toxoplasma parasite proteins targeted to the apicoplast (5, 33). The size of the adjacent apicoplast translocation signal cannot be predicted and remains to be determined experimentally. A multiple sequence alignment of PfFabBF with FabB and FabF of E. coli and A. thaliana is shown in Fig. 2. When compared with PfFabBF (residues 56-474), the parasite enzyme shares 31 and 38% identity with FabB (residues 1-406) and FabF (residues 1-412) of E. coli and 38 and 37% identity with FabB (residues 59-473) and FabF (residues 128-541) of A. thaliana. The typical Cys/His/His motif found in
-ketoacyl-ACP synthases is also present in PfFabBF. This group entails the active site cysteine and histidines that are involved in the elongation reaction. In PfFabBF they correspond to Cys-221, His-362, and His-399 (Fig. 2).
Expression and Purification of FabBFBecause of the lack of knowledge about the mature size of PfFabBF, the initial pET30b expression construct was designed to express a truncated enzyme missing the potential signal and translocation sequences, but retaining all amino acids needed to ensure complete functionality as deduced from sequence alignments with bacterial homologs. This initial pET30b vector containing the truncated pffabBF gene resulted in large quantities of protein that remained insoluble under any conditions. Subsequent refolding attempts achieved some solubilization, but the enzyme failed the activity tests, and it was shown by means of circular dichroism that it lacked secondary structure. At this stage a new clone (pET30b-PffabBF) was prepared by site-directed mutagenesis to add back 6 amino acids derived from the N terminus that had been omitted in the first construct. Starting from this new construct, the extended insert was introduced into several pET vectors, aiming at the expression of the target protein with highly soluble fusion partners, i.e. glutathione S-transferase, thioredoxin, DsbA, and NusA. Only pET43.1b, which allows expression of the protein fused to the highly soluble NusA protein, resulted in a significant increase of soluble PfFabBF. The production of soluble fusion protein could be raised to acceptable amounts by subjecting the cells to osmotic stress (34, 35). We supplemented the TB medium with 1 mM betaine and sorbitol. Of all sorbitol concentrations tested (0, 330, and 660 mM and 1 M), 660 mM gave the best result. The identity of the fusion protein was confirmed by SDS-PAGE (Fig. 3A), Western blotting, and thrombin digestion. The first purification step of the fusion protein consisted of loading the clarified soluble fraction on a HisTrap chelating column. NusA-fusion proteins from pET43 are known to bind rather weakly to the nickel column, making a complete elimination of contaminating proteins difficult. PfFabBF eluted at an imidazole concentration of 125 mM and was of low purity, as expected. Most contaminants were eliminated by cation exchange chromatography, resulting in a preparation of about 80% purity as deduced from SDS-PAGE and gel densitometry. A final polishing step using gel filtration chromatography could increase purity to >95% but resulted in >50% loss of protein. Various control experiments showed clearly that the impurities present in the sample do not interfere with the measurement (i.e. do not introduce unspecific oxidase activity). In addition, the NusA-PfFabBF fusion protein displayed identical activities compared with the thrombin-cleaved PfFabBF. Based on these results, we used the more stable fusion protein for all measurements. The purification typically resulted in 2-3 mg of PfFabBF fusion protein/liter of media.
|
PfFabBF Activity with Acyl-PfACP and Acyl-CoA as SubstratesTo examine the substrate acceptance, we tested C4:0- to C16:0-acyl-PfACPs and the corresponding acyl-CoAs. PfFabBF readily elongates C4:0-through C10:0-PfACPs, has significantly less activity with C12:0- and C14:0-PfACPs, and no capacity for elongation of C16:0-PfACP (Table 1). The acyl-CoAs are much poorer substrates compared with acyl-PfACPs. When measured at 30 µM, the activity of PfFabBF with C4:0- to C14:0-CoAs as substrates was in the range of the background, but a trend toward higher activity with C16:0- and C18:0-CoAs could be observed. At acyl-CoA concentrations of 1 mM we detected activity with C4:0- to C14:0-CoAs. PfFabBF was found to be more than twice as active with C16:0- and C18:0-CoAs compared with the shorter chain acyl-CoAs (Table 1). Thus PfFabBF accepts long chain acyl-CoAs but not long chain acyl-PfACPs, and the long chain acyl-CoAs seem to be better substrates than the shorter chain acyl-CoAs.
|
|
|
-ketoacyl-ACP synthases. To investigate the sensitivity of PfFabBF to CER, the enzyme was preincubated with 100 µM CER. Samples were taken at various time points and assayed for activity. As expected, CER was found to be a potent inhibitor of PfFabBF activity, leading to a complete inactivation of the enzyme within 1 min (Fig. 5A). The irreversibility of CER inhibition was confirmed by diluting the CER concentration 20-fold. In case of a reversible inhibitor, the enzyme would have regained activity. This was not the case with CER as the enzyme remained inactive. Because CER binds covalently to PfFabBF, Fig. 5B reflects the rate of complex formation at different inhibitor concentrations. The IC50 value was determined to be 15.8 ± 2.3 µM under the conditions applied. TLM inhibits PfFabBF reversibly with an IC50 of 23.6 ± 6.0 µM (Fig. 6A). TLM is a competitive inhibitor with respect to malonyl-PfACP (Fig. 6B). Preliminary experiments indicate uncompetitive inhibition with respect to acyl-PfACP (data not shown). Analysis of the data according to Dixon and secondary plots resulted in a Ki value of 10 ± 4 µM.
| DISCUSSION |
|---|
|
|
|---|
Multiple sequence alignments of PfFabBF with
-ketoacyl-ACP synthases of other organisms display the homology of the enzymes, with 30-40% identical amino acids. As PfFabBF is the unique elongating
-ketoacyl-ACP synthase in the pathway, it is of interest whether the enzyme could be annotated as either FabB- or FabF-type synthase. Comparison of PfFabBF with plant FabB and FabF of A. thaliana disclosed very similar identity (38%) toward both enzymes, and it was not possible to distinguish between the two isoforms. The situation is different for E. coli FabB and FabF. Here the plasmodial enzyme shows more identity to FabF (31 versus 38%). This would be in line with the general assumption that FabF is the "generic" synthase, whereas FabB is also involved in specific reactions of the unsaturated fatty acid biosynthesis pathway. However, as the active site residues that seem to be of diagnostic value do not give a clear answer as well (36), the synthase is named PfFabBF.
Sequence comparison further led to the identification of a number of highly conserved residues that constitute the active site. The configuration of the active site of all known elongation condensing enzymes is identical, containing a Cys/His/His catalytic triad (18, 37). In PfFabBF, these residues are Cys-221, His-362, and His-399. We therefore assume that the PfFabBF mechanism of acyl-enzyme formation, decarboxylation, and condensation is very similar to that of other organisms and that
-ketoacyl-ACP synthase inhibitors CER and TLM exhibit identical binding modes. Structural and biochemical analyses of PfFabBF and its interaction with CER and TLM will be helpful in providing clues for the development of new compounds that selectively target PfFabBF. We therefore established an expression system that allowed production of soluble and active PfFabBF. Production of soluble protein was only achieved by expressing the NusA-PfFabBF fusion protein under increased osmotic pressure (34, 35). It is assumed that subjecting the cells to osmotic stress by addition of sorbitol to the growth medium facilitates the uptake of the "compatible osmolyte" betaine. Betaine is believed to stabilize protein structure by minimizing solvent-protein contacts (35, 38).
|
|
-ketoacyl-ACP synthases exhibit low specific activity with acyl-CoA derivatives (16, 40). Surprisingly, among all acyl-CoAs tested, PfFabBF displayed the highest activity for C16:0-CoA and C18:0-CoA. This is in direct contrast to the results obtained for the natural acyl-PfACP substrates that exhibit no activity with C16:0 and C18:0 acyl chain length. Investigation of the substrate acceptance of other
-ketoacyl-ACP synthases with a series of acyl-ACPs and the corresponding acyl-CoAs are not described in literature, and thus it is not known whether this behavior is also common for other
-ketoacyl-ACP-synthases. However, as the activity of acyl-CoAs is very low and high substrate concentrations had to be applied, PfFabBF activity with respect to acyl-CoA is not likely to be physiologically relevant. Given the very different substrate specificity of PfFabBF toward its natural and artificial substrates, it is likely that acyl-PfACPs and acyl-CoAs display different behavior also with the other enzymes involved in fatty acid biosynthesis. Thus, to avoid artifacts, acyl-PfACP should be used for characterizing enzymes in the P. falciparum type-II FAS system. This most probably also applies to FAS systems of other organisms.
Comparing the kinetic parameters of PfFabBF to the kinetic parameters of corresponding enzymes of other organisms is difficult due to different substrate specificities. For M. tuberculosis KasA and KasB with C16:0- and C20:0-ACP substrates (E. coli-ACP was used in this study), Km values between 1.4 and 3.2 µM were reported, and thus the Km values obtained for PfFabBF-substrates are about 100-fold greater than the ones reported for M. tuberculosis KasA and KasB (16). Km values determined for E. coli FabB and FabF using C14:0-ACP (E. coli-ACP) are determined to be 71 and 68 µM, respectively. These results seem to be more in the range of the values determined for the corresponding substrates of PfFabBF. This is not surprising, because E. coli FabB and FabF exhibit substrate specificities that are similar to PfFabBF. In E. coli, the synthesis of C14:0 and C16:0 is predominant, but the specific activities of E. coli FabB and FabF with saturated acyl-ACPs are similar to the ones observed for PfFabBF (41, 42).
PfFabBF was tested for inhibition with CER and TLM. CER acts as a potent irreversible inhibitor of
-ketoacyl-ACP synthases by covalent modification of the active site cysteine thiol. As expected, PfFabBF was found to be very sensitive to CER. After 1 min of incubation with 100 µM CER, the enzyme was completely inactivated. This corresponds to a 10 times faster inactivation if compared with M. tuberculosis KasA and KasB. The kcat values determined for PfFabBF were up to 36-fold higher than the kcat values reported for the M. tuberculosis enzymes. The relatively high reactivity of PfFabBF could be an explanation for the rapid inactivation by CER.
TLM is known to inhibit
-ketoacyl-ACP synthases by competing with malonyl-ACP for binding (18, 19). We could show that this is also true for PfFabBF. As shown in Fig. 6B, the lines of the double-reciprocal plot intersect at the 1/v axis, indicating a competitive binding mode with respect to malonyl-PfACP. We obtained a Ki value of 10 ± 4 µM. Crystal structures of E. coli FabB in complex with TLM revealed that the O-3 of TLM forms strong hydrogen bonds with the two active site histidines (17). Because the mechanism of TLM binding to PfFabBF is identical to the one reported for other
-ketoacyl-ACP synthases, and because the His-His-Cys catalytic triad is highly conserved, we can assume that His-362 and His-399 of PfFabBF are involved in TLM binding.
All three
-ketoacyl-ACP synthases (FabB, FabF, and FabH) are susceptible to TLM inhibition but to a different extent. In E. coli, FabB is most inhibited by TLM, followed by FabF and FabH (17, 43). In M. tuberculosis, KasA is more sensitive to TLM than KasB (16). Thus, FabB seems to be the major target of TLM. The same is observed for the two
-ketoacyl-ACP synthases of P. falciparum; PfFabH is much less affected by TLM, with an IC50 of over 330 µM (21), compared with 23.6 ± 6 for PfFabBF.
The presented biochemical characterization of PfFabBF provides insight into the catalytic mechanism of PfFabBF. With the development of a system to produce soluble and active PfFabBF, it is now possible to extend the screening for inhibitors on the
-ketoacyl-ACP synthase activity of P. falciparum. Further investigation of the biochemical properties and structure of PfFabBF could form the basis for the rational design of new lead compounds.
| FOOTNOTES |
|---|
1 To whom correspondence should be addressed: Biochimie Pharmaceutique, Laboratoire de Chimie Thérapeutique, Section des Sciences Pharmaceutiques, Université de Genève, Quai Ernest-Ansermet 30, CH-1211 Genève 4, Switzerland. Tel.: 41-22-3793371; Fax: 41-22-3793360; E-mail: remo.perozzo{at}pharm.unige.ch.
2 The abbreviations used are: FAS, fatty-acid synthase; PfACP, P. falciparum acyl carrier protein; EcACPS, E. coli holo-acyl carrier protein synthase; PfFabBF, P. falciparum
-ketoacyl-ACP synthase; PfFabG, P. falciparum
-ketoacyl-ACP reductase; DTT, dithiothreitol; CER, cerulenin; TLM, thiolactomycin; TB, terrific broth; CS-PAGE, conformational sensitive gel electrophoresis; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M.-H. Cho, O. R. A. Corea, H. Yang, D. L. Bedgar, D. D. Laskar, A. M. Anterola, F. A. Moog-Anterola, R. L. Hood, S. E. Kohalmi, M. A. Bernards, et al. Phenylalanine Biosynthesis in Arabidopsis thaliana: IDENTIFICATION AND CHARACTERIZATION OF AROGENATE DEHYDRATASES J. Biol. Chem., October 19, 2007; 282(42): 30827 - 30835. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Mazumdar and B. Striepen Make It or Take It: Fatty Acid Metabolism of Apicomplexan Parasites Eukaryot. Cell, October 1, 2007; 6(10): 1727 - 1735. [Full Text] [PDF] |
||||
![]() |
|