Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M513094200 on February 2, 2006

J. Biol. Chem., Vol. 281, Issue 15, 10365-10373, April 14, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/15/10365    most recent
M513094200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McGill, G. G.
Right arrow Articles by Fisher, D. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McGill, G. G.
Right arrow Articles by Fisher, D. E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

c-Met Expression Is Regulated by Mitf in the Melanocyte Lineage*

Gaël G. McGill{ddagger}1, Rizwan Haq§, Emi K. Nishimura, and David E. Fisher, A Distinguished Clinical Scholar of the Doris Duke Foundation and the Charles and Jan Nirenberg Fellow in Pediatric Oncology at the Dana-Farber Cancer Institute{ddagger}2

From the {ddagger}Department of Pediatric Oncology, Dana Farber Cancer Institute, Boston, Massachusetts 02115, §Department of Internal Medicine, Johns Hopkins Hospital, Baltimore, Maryland 21205, and Department of Dermatology and Creative Research Institute Sousei, Hokkaido University Graduate School of Medicine, N15, W7, Kita-ku Sapporo 060-8638, Japan

Received for publication, December 8, 2005 , and in revised form, February 2, 2006.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Hepatocyte growth factor (HGF)/c-Met signaling is thought to be a key pathway in both melanocyte development and melanoma metastasis. Here, HGF stimulation of melanocytes was seen to up-regulate c-Met expression. In an effort to decipher the mechanism by which HGF up-regulates its receptor, we found that c-Met is a direct transcriptional target of Mitf. This was confirmed with chromatin immunoprecipitation experiments of the human c-Met promoter, as well as by the ability of adenovirally expressed Mitf to modulate endogenous c-Met protein levels in melanocytes. Disruption of Mitf blocked HGF-dependent increases in endogenous c-Met message and protein levels, indicating that HGF regulates its own receptor levels via Mitf. Finally, dominant-negative inhibition of Mitf resulted in profound resistance of melanocytes and melanoma cells to HGF-dependent matrix invasion, suggesting a physiologic role for this pathway in melanocytic development and melanoma.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
A number of signaling pathways have been implicated in the development and survival of the melanocyte lineage. For the most part, these were initially uncovered through the analysis of coat color mutants that affect melanocyte viability. These include, for example, the Steel/c-Kit and Edn3/ENDRB mutant mice whose phenotypes share severe defects in melanocyte numbers (1). Many of these key pathways have now been studied in molecular detail and tested for their importance in supporting growth of primary melanocytes under tissue culture conditions (2). Among the pathways melanocytes employ to maintain growth and survival, c-Met and its ligand Scatter Factor/hepatocyte growth factor (HGF)3 have been observed to play a key role not only in growth but specifically in the migratory behavior of this lineage.

Originally discovered as an oncogene (3), the c-Met receptor tyrosine kinase is a multifaceted regulator of growth, motility, and invasion in a number of lineages in vivo. Its pattern of expression during gestation and the resulting lethality of c-Met null mice around embryonic day 11.5 have complicated our understanding of its specific contributions to the various lineages in which it is expressed in the adult. Nevertheless, characterization of c-Met and HGF null animals prior to E 11.5 (4) as well as studies using conditional knock-out animals (5) have furthered our understanding of the role of c-Met in several lineages during development and in the adult. Combined with experiments in chick where ectopic HGF results in aberrant migration of muscle precursors, these studies suggest a role for this pathway in cell motility (6). Indeed, experiments employing hypomorphic c-Met mutant animals that survive until birth (7) or transgenic animals that produce ectopic HGF (8) point to an expanded role for this pathway in the development of numerous lineages in addition to muscle. HGF is also known to mediate epithelial-mesenchymal transitions in many organ types during development. Indeed, c-Met expression is found in numerous epithelial tissues, and HGF is often expressed in neighboring mesenchymal cell compartments (9). Melanocytes of the skin and inner ear, for example, derive from neural crest precursors that migrate dorso-ventrally after undergoing epithelial-mesenchymal transition in the dorsal neural tube (10).

A role for HGF/c-Met signaling in the developmental regulation of melanocytes has also been suggested in several transgenic mouse models. Metallothionein promoter-driven HGF transgenic mice produce ectopic melanocytes in regions of abnormal HGF expression (8). Interestingly, the survival and number of differentiating melanoblasts in neural crest explant cultures from these animals can be increased with HGF (11). A more recent study in which HGF expression is restricted to the epidermis using the human cytokeratin K14 promoter shows an increase in embryonic skin melanoblasts as well as mature dermal melanocytes after birth (12).

Although the exact mechanism whereby HGF transduces migratory signals through c-Met remains incompletely understood, a number of common signaling events are induced downstream of c-Met and include among others the Ras/MAPK, phosphatidylinositol 3-kinase, phospholipase c-{gamma}, and signal transducers and activators of transcription (STAT) pathways (9, 13). Attempts to dissect the respective contributions of these pathways to the different aspects of HGF/c-Met signaling suggest that, whereas the Ras arm is key for proliferation, the phosphatidylinositol 3-kinase arm is required for scattering, and these two pathways in combination with STAT signaling may be important in morphogenesis (14-17). As with most other receptor tyrosine kinases, activation of these pathways occurs as a result of recruitment of Src homology 2-containing signaling intermediates to the cytoplasmic region of the receptor (13). In the case of c-Met, a region of the C terminus comprises a multifunctional docking site that contains key tyrosine residues phosphorylated following receptor dimerization and autophosphorylation (18, 19).

More recently the finding that c-Met activity in melanomas is linked with increased metastatic potential has sparked particular interest in deciphering the mechanisms governing its expression in melanocytes. Indeed, robust c-Met expression has been observed in human melanomas (20-24); such tumors arising from transgenic overexpression of HGF in mice also display HGF and endogenous c-Met overexpression along with enhanced c-Met activity (25). Experiments in mouse models of tumor metastasis demonstrate that colonization of organs such as the liver is significantly enhanced by increased c-Met activity (20). Of note, lung and liver metastasis of melanoma cells engineered to overexpress c-Met is stimulated when these cells are introduced into HGF transgenic mice (26), suggesting that non-autocrine mechanisms may also play a significant role in metastasis. Therefore, a better understanding of how c-Met is expressed and normally regulated in melanocytes might provide clues as to how this receptor becomes overactive in widely metastatic melanomas.

A number of key melanocyte pathways such as c-Kit, {alpha}-MSH, Wnt, and endothelin appear to converge on the master lineage regulator Mitf to mediate at least part of their function. The critical developmental role of Mitf in melanocytes is apparent in the complete lack of viable melanocytes in null mutants (27). Unlike other common melanocytic markers, expression of Mitf is not only retained in nearly 100% of primary human melanomas (28, 29), but the Mitf gene is also amplified in a significant fraction of malignant melanomas (30).

Here, we examined whether HGF/c-Met may transduce some of its downstream signaling through Mitf. We found that stimulation of primary melanocytes and melanoma cells with HGF/scatter factor leads to Mitf phosphorylation via the MAPK pathway. Genomic analyses identified conserved Mitf binding consensus sequences in the human and mouse c-Met promoters that are bound by Mitf, which also regulates c-Met expression levels in primary melanocytes. As a result, HGF regulates levels of its receptor c-Met through Mitf. Finally, we observed that the ability of HGF to stimulate invasive growth potential of melanocytes and melanoma cells in culture could be abolished with suppression of endogenous Mitf. This inhibition suggests a potential means for interfering with melanoma metastasis in a lineage-restricted manner.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—Primary human melanocytes between passages 2 and 5 from neonatal foreskins (provided by Dr. Ruth Halaban, Yale University) were established in TICVA medium containing Ham's F10 medium (Invitrogen), 7% fetal bovine serum, penicillin/streptomycin/glutamine (Invitrogen), 1 x 10-4 M 3-isobutyl-1-methyl xanthine (IBMX; Sigma), 50 ng ml-1 12-O-tetradecanoyl phorbol-13-acetate (TPA; Sigma), 1 µM Na3VO4, and 1 x 10-3 M N6,2'-O-dibutyryladenosine 3:5-cyclic monophosphate (dbcAMP; Sigma). 501mel human melanoma cells were grown in Ham's F-10 medium supplemented with 10% fetal bovine serum and penicillin/streptomycin/L-glutamine. A375, M14, SKMEL-2, and SKMEL-28 melanoma lines were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and penicillin/streptomycin/L-glutamine.

Adenoviral Infections—Adenoviruses were previously described (31) and engineered to overexpress either wild-type human Mitf, R215del (dominant-negative Mitf), or a green fluorescence protein (GFP)/wee1-truncation hybrid (which targets GFP to the nucleus as vector control), all under the control of the elongation factor {alpha}-promoter. Subconfluent primary human melanocytes and 501mel human melanoma cells were incubated with concentrated adenoviruses in serum-free F10 supplemented with 10 mM MgCl2 for 30 min at multiplicities of infection ranging from 200 to 1000. After infection, the medium was replaced by fresh, fully supplemented growth medium and cultured for the indicated times until stimulation or direct harvest.

Melanoma Nuclear Extracts and Electrophoretic Mobility Shift Assay—Nuclear extracts were prepared from 501mel human melanoma cells and used in gel shift reactions as described (32). The c-met-specific probe spanning the E-box consensus was prepared using oligos with the following sequences: E-box probe: GGCAGACAGACACGTGCTGGGGCGGG (FWD), CCCGCCCCAGCACGTGTCTGTCTGCC (REV), and mutant probe: GGCAGACAGAGAGGTGCTGGGGCGGG (FWD), CCCGCCCCAGCACCTCTCTGTCTGCC (REV).

Chromatin Immunoprecipitation—Chromatin immunoprecipitation of human c-met sequences from 501mel human melanoma cells was performed as in Ref. 33. Nuclear extracts were immunoprecipitated using purified rabbit antibody against Mitf. PCR (iCycler; Bio-Rad) was carried out using primers specific to the promoter region of human c-met (FWD: 5'-TTCTGCGGTGCCCAAATCTCT-3' and REV:5'-TGTCTGTCTGCCTCGCGTGCTGTC-3') or spanning the human c-met coding region/3'-untranslated region boundary (FWD: 5'-GAACGTAAAATGTGTCGCTC-3' and REV: 5'-CTCTGTCAGATAAGAAATTCCTTAG-3'). PCR products were resolved by 1.5% agarose gel electrophoresis.

Quantitative Reverse Transcription-PCR/TaqMan—For HGF stimulation experiments, cells were starved in Ham's F-10 for 16 h and subsequently harvested at 0, 0.5, 1, 2, 4, and 6 h following stimulation. RNA was isolated using the Ambion RNAqueous kit and quantitated by spectrophotometry (Beckman). TaqMan One-Step RT-PCR Master Mix reagent as well as GAPDH Control Reagents (Applied Biosystems, CA) were used for quantitative reverse transcription PCR reactions, each containing 100 ng of total sample RNA. Reactions were run for 40 cycles under the following conditions: stage 1, 48 °C, 30 min; stage 2, 95 °C, 10 min; stage 3, 94 °C, 20 s; stage 4, 62 °C, 1 min for 40 cycles. Human c-met message was detected using the forward 5'-AATGCTGGCACCCTAAAGC-3' and reverse 5'-AAGATCGCTGATATCCGGG-3' primers (IDT) and TaqMan probe 6FAM-CGCCCATCCTTTTCTGAACTGGTG-TAMRA (Applied Biosystems). All reactions were run in triplicate on an ABI-PRISM 7700 instrument (Applied Biosystems), and c-met message levels were normalized to glyceraldehyde-3-phosphate dehydrogenase expression.

Gel Electrophoresis and Immunoblotting—Total protein from cell cultures were subjected to Western blotting with anti-Met (Upstate), anti-phospho-Met (Cell Signaling Technologies), anti-Mitf (NeoMarkers), anti-phospho-MAPK (Cell Signaling Technologies), and anti-tubulin (Sigma) antibodies. Samples were run on SDS-PAGE gels, transferred onto nitrocellulose, blocked with 5% nonfat dry milk in TBST (150 mM NaCl, 10 mM Tris pH 8.0, 0.05% Tween 20), and probed with respective antibodies in TBST overnight at 4 °C. Membranes was washed three times for 15 min with TBST, probed with a secondary goat anti-mouse antibody (ICN Biomedicals Inc.), washed three times for 30 min in TBST, and developed by ECL (Amersham Biosciences).

Matrigel Invasion Assays—24-well tissue culture plate BioCoat Matrigel inserts (Becton Dickinson) were rehydrated for 3 h in 37°C Ham's F-10 prior to use. 5 x 105 cells were subsequently plated on the inserts in 0.5 ml of their respective media ± 50 ng/ml of HGF to assess the number of invasive cells. After 24 h, the surface of the Matrigel inserts was gently scraped, leaving only invasive cells that had migrated inside the protective Matrigel layer. Remaining cells were subsequently fixed, stained, and counted. As a control to assess plating efficiency, duplicate inserts were fixed and stained without prior scraping of the Matrigel surface. The most representative data in three independent experiments are shown in Fig. 4.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
HGF Induces Mitf Phosphorylation and Degradation via MAPK—Although the HGF/c-Met pathway appears to be critical for melanocyte development, its regulation remains poorly understood. Based on our previous studies on the regulation of Mitf downstream of receptor tyrosine kinase pathways such as SCF/c-Kit, we investigated whether the HGF/c-Met pathway leads to post-translational modification of Mitf. We found that treatment of human neonatal melanocytes with recombinant HGF over a period of 6 h results in rapid stimulation/phosphorylation of the c-Met receptor and MAPK (Fig. 1A). Blotting with an antibody against Mitf revealed a mobility shift in primary melanocytes (Fig. 1A) as well as 501mel melanoma cells (Fig. 1B).


Figure 1
View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 1.
HGF-induces Mitf phosphorylation via MAPK and leads to Mitf degradation. Primary neonatal human melanocytes (A) and 501mel melanoma cells (B) were stimulated with 50 ng/ml of HGF for indicated times and harvested for Western blot analysis using monoclonal antibodies against phospho-Met, phospho-MAPK, Mitf, and {alpha}-tubulin. C, primary neonatal human melanocytes were stimulated with 50 ng/ml of HGF in the presence of increasing doses of PD2345 mitogen-activated protein kinase/extracellular signal-regulated kinase kinase (MEK) inhibitor drug (MEK-i). Lysates were harvested 30 min following treatment with HGF and immunoblotted with either Mitf (top panel), phospho-MAPK (middle panel), or {alpha}-tubulin antibodies (lower panel). D, immunoprecipitation of Mitf protein with serine 73 phospho-specific antibodies following HGF stimulation of primary melanocytes. Pellets were immunoblotted with Mitf antibody (top panel), and supernatants were immunoblotted with Mitf, phospho-Met, and tubulin antibodies (lower three panels). E, HGF stimulation time course of primary neonatal melanocytes in the absence or presence of MG-132 protease inhibitor drug. Lysates were harvested at indicated times and immunoblotted with Mitf (top panel), phospho-MAPK (middle panel), and {alpha}-tubulin antibodies (lower panel). The asterisk in all immunoblots denotes A-form Mitf protein.

 
The Mitf band shift from a doublet to a single upper band was observed at 30 min and persisted 2-4 h after HGF stimulation, suggesting a post-translational modification with kinetics similar to the rapid induction of phospho-p42/44 MAPK. To confirm that Mitf phosphorylation required MAPK, we pretreated HGF-stimulated melanocytes with increasing concentrations of mitogen-activated protein kinase/extracellular signal-regulated kinase kinase inhibitor and found that both phospho-MAPK and shifted Mitf levels decreased accordingly (Fig. 1C).

Immunoprecipitation of Mitf using a phospho-specific antibody targeted to serine 73 also confirmed that HGF/c-Met targets the same phosphorylation site on Mitf as the stem cell factor/c-Kit pathway (Fig. 1D). Indeed, whereas immunoblots of the immunoprecipitation supernatants recapitulated the same Mitf doublet and band shift pattern and confirmed c-Met receptor activation, immunoprecipitation pellets showed an increase in serine 73-specific phosphorylation. Finally, as predicted from earlier studies of cytokine-dependent Mitf degradation (32, 34), HGF-dependent phosphorylation targeted Mitf for degradation within 2 h of stimulation. This degradation occurred via the proteasome pathway, as revealed by the ability of the inhibitor MG-132 to stabilize the upper mobility (phosphor-ser73) isoform of Mitf (Fig. 1E).

HGF Regulates Levels of Its Receptor c-Met via Mitf—Because elevated c-Met levels have also been described in human melanoma and implicated in the aggressive metastatic potential of these tumors, we wanted to understand how c-Met levels are regulated in these cells. HGF has been reported to induce c-Met levels at the transcriptional level in other cell types (35-37), and therefore we wondered whether HGF stimulation might similarly affect c-Met expression in melanocytes or melanoma cells. Using 501mel human melanoma cells or primary human melanocytes treated with recombinant HGF over a period of 6 h, we observed that c-Met protein levels increased with time (Fig. 2A). This observation suggests that a homeostatic regulatory mechanism may exist through which HGF modulates or replenishes levels of its own receptor.

Combining our observations that HGF stimulation leads to Mitf phosphorylation and increases c-Met protein levels with previous knowledge that Mitf phosphorylation triggers recruitment of the transcriptional coactivator p300 (38), we asked whether the HGF-dependent increase in c-Met might be mediated through Mitf. Examination of the genomic sequences in the human and mouse c-Met proximal promoter regions revealed a conserved high affinity Mitf consensus DNA binding element at ~300 bp upstream of the transcriptional start site (Fig. 2B). As with melanoma cells, HGF stimulation of primary melanocytes led to an increase in c-Met receptor message levels using Taqman real-time PCR (Fig. 2C). However, this transcriptional induction was completely dependent upon Mitf function because c-Met was not induced in the presence of a previously described (39) dominant-negative Mitf-expressing adenovirus. These observations were recapitulated with similar kinetics at the protein level. Although HGF-induced phosphorylation of Mitf via MAPK occurred both in the presence of wild-type and dominant-negative Mitf, c-Met protein increased only in the presence of wild-type but not dominant-negative Mitf (Fig. 2D) in cells where expression of these exogenous Mitf proteins was similar (Fig. 3C, middle panel, 500 M.O.I.).


Figure 2
View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 2.
HGF stimulation leads to Mitf-dependent Met message and protein induction. A, 501mel human melanoma cells (left panel) and primary melanocytes (right panel) were stimulated with 50 ng/ml of HGF for the indicated times and harvested for Western blot analysis using monoclonal antibodies against Met and {alpha}-tubulin. B, c-met gene promoter diagram showing the E-box binding site (CACGTG) that is conserved between human and murine promoters. Hatched box indicates transcribed region; red arrows show region for chromatin immunoprecipitation primer pair. C, quantitative Taqman reverse transcription PCR analysis of total RNA isolated from primary human melanocytes infected with either control (GFP, blue) or dominant-negative (DN, red) adenovirus (multiplicity of infection 500) for 48 h, stimulated with 50 ng/ml of HGF, and harvested at indicated times. In each case, c-met message levels were normalized to glyceraldehyde-3-phosphate dehydrogenase and performed in triplicate. Adenovirally infected cultures were checked for plating efficiency and survival, using light microscopy and infection efficiency with GFP fluorescence (right panels). D, Western blotting analysis of whole-cell lysates prepared from primary human melanocytes infected with either wild-type (Mitf-WT) or dominant-negative (Mitf-DN) adenovirus (multiplicity of infection 500) for 48 h, stimulated with 50 ng/ml of HGF, and harvested at indicated times. Lysates were immunoblotted with antibodies against c-Met, phospho-MAPK, or {alpha}-tubulin.

 


Figure 3
View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 3.
c-Met is a direct transcriptional target of Mitf. A, electromobility shift assay using 501mel human melanoma nuclear extracts with 32P-labeled DNA probe covering the E-box consensus site. Mitf-bound complexes were supershifted with monoclonal antibody against Mitf, and cold competitor probe experiments were performed in 5- or 25-fold excess unlabeled DNA probes containing either a wild-type or mutant E-box sequence. B, chromatin immunoprecipitations were performed from log-phase 501mel human melanoma cells. No DNA (lane 6), protein-chromatin cross-linked complexes immunoprecipitated with either control antibody (lane 3), Mitf monoclonal antibody (lane 4), or no antibody (lane 2), and input genomic DNA (lane 5) were run with DNA markers (M, lane 1) on a 1.5% agarose gel and stained with ethidium bromide. Arrow shows PCR amplification products spanning the promoter region of the c-met gene. C, Mitf regulates endogenous c-Met protein levels. Primary melanocytes were infected at two different multiplicities of infection (M.O.I. 500 and 1000) with adenovirus encoding GFP control (G), wild-type Mitf (W), or dominant-negative Mitf (D). Lysates were harvested 48 h after infection and immunoblotted with antibodies against either c-Met, Mitf, or {alpha}-tubulin.

 
c-Met Is a Direct Transcriptional Target Gene of Mitf—We next asked whether Mitf directly interacts with the endogenous c-Met promoter and regulates its expression. Electrophoretic mobility shift assays were performed using nuclear extracts prepared from 501mel melanoma cells, Mitf antibody, and 32P-labeled probe covering the putative Mitf binding site (Fig. 3A). Specific binding to the E-box element was demonstrated through the ability of excess unlabeled wild-type (but not mutant) probe to compete the supershifted Mitf-DNA complex. Chromatin immunoprecipitation experiments were also performed to assess whether Mitf is bound to the c-Met promoter in cells. Using primers spanning the Mitf consensus element, a c-Met promoter-specific product was amplified from Mitf (but not control) chromatin immunoprecipitates, suggesting an in vivo interaction (Fig. 3B). This interaction was shown to be specific both for the antibody used and for the site on the chromatin, because the same anti-Mitf antibody did not reveal Mitf occupancy of a downstream region of the same transcriptionally active c-met gene (data not shown).

To assess whether Mitf can directly modulate endogenous levels of c-Met, we infected primary human melanocyte cultures with adenoviral constructs encoding either wild-type, dominant-negative, or GFP control proteins. Expression of the exogenous Mitf proteins by Western blotting was similar for both wild-type and dominant-negative constructs (Fig. 3C, middle panel). Wild-type Mitf, but not GFP control or dominant-negative, increased endogenous c-Met protein levels at two different multiplicities of infection (M.O.I.).


Figure 4
View larger version (46K):
[in this window]
[in a new window]
 
FIGURE 4.
HGF-dependent invasion of melanocytes/melanoma is Mitf dependent. A, primary human neonatal melanocytes and 501mel, A375, M14, SKMEL-2, and SKMEL-28 human melanoma cells were plated on Matrigel inserts ± 50 ng/ml of HGF and counted after 24 h to assess the number of invasive cells. B, as before, primary human melanocytes were infected with adenovirus encoding either wild-type or dominant-negative Mitf for 24 h (multiplicity of infection 500) and plated on Matrigel inserts in TICVA medium ± 50 ng/ml of HGF to assess the number of invasive cells. As plating efficiency controls, duplicate inserts were fixed and stained without prior scraping of the Matrigel surface (lower panels). C, 501mel human melanoma cells were infected with adenovirus encoding control, wild-type, or dominant-negative Mitf for 48 h (multiplicity of infection 500) and plated on Matrigel inserts in F10 medium ± 50 ng/ml of HGF to assess the number of invasive cells. As plating efficiency controls, duplicate inserts for each virus were fixed and stained without prior scraping of the Matrigel surface (Adhesion Controls). The most representative data in three independent experiments are shown.

 
Mitf Modulates HGF-dependent Invasion in Melanocytes and Melanoma—HGF has been shown to stimulate the invasive potential of melanocytes and melanoma cells using a number of tissue culture and in vivo models (6, 9). Using Matrigel invasion assays, we observed that the invasive potential of primary human melanocytes strongly responds to HGF (Fig. 4A). 501mel melanoma cells displayed a similar HGF-dependent invasion behavior in Matrigel. This stands in contrast to a number of other melanoma cell lines we tested (A375, M14, SKMEL-2, and SKMEL-28) that were inherently more invasive and displayed minimal or no response to HGF.

Because HGF regulates c-Met levels via Mitf, we asked whether HGF-dependent Matrigel invasion of primary melanocytes might require Mitf. Melanocytes expressing dominant-negative (but not wild-type) Mitf were completely resistant to HGF-induced Matrigel invasion (Fig. 4B). Failure to invade Matrigel was not due to nonspecific toxic effects of the dominant-negative mutant as seen by the number and morphology of cells that adhered and grew on control Matrigel inserts (Fig. 4B, Adhesion Control). 501mel cells infected with control, wild-type, or dominant-negative Mitf adenovirus and stimulated with HGF showed similar Mitf-dependent Matrigel invasion behavior. As with the primary melanocytes, the morphology and adhesion of infected cells in control Matrigel inserts indicated that these observations were specific to the invasive behavior of the cells and not a result of differing plating efficiency or viability. The identical experiment carried out using a 501mel line stably overexpressing Bcl-2 showed similar results (data not shown), providing further assurance that the effects observed were not because of differences in cell survival. These results implicate Mitf in modulating matrix invasion of melanocytes and HGF-responsive melanomas through its regulation of c-Met levels.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
HGF Regulates c-Met Levels via Mitf—The kinetics of the signaling events we observed following stimulation of melanocytes and melanoma cells with HGF (namely, phospho-Met induction, followed by MAPK and Mitf phosphorylation and degradation, and finally increased c-Met message and protein) are consistent with the notion that HGF regulates c-Met via Mitf. The requirement for intact Mitf function in HGF-induced c-Met induction provides further mechanistic evidence for this possibility. Of note, c-Met levels have also been shown to increase following treatment of melanoma cells with {alpha}-MSH (40), a hormone that also induces Mitf (41, 42). In a microarray screen looking at transcriptional targets downstream of the {alpha}-MSH pathway in primary melanocytes, we also observed that c-Met is induced by {alpha}-MSH.4 However, as with HGF, c-Met induction following {alpha}-MSH did not occur in the presence of dominant-negative Mitf, providing strong evidence that in both cases these extracellular ligands require Mitf function to induce c-Met.

The observation that stimulation of primary human melanocytes and human melanoma cells with HGF leads to Mitf phosphorylation constitutes a new signaling axis in this lineage. Indeed, although the HGF/c-Met pathway has previously been shown to be required for the proliferation and migration of these cells, a mechanistic link to Mitf suggests that this pathway may regulate a much wider variety of melanocytic behaviors. Indeed, our prior studies of Mitf-dependent target genes downstream of c-Kit as well as other studies reveal that Mitf regulates the transcription of a broad array of genes involved in survival (39), cell cycle (43), and pigmentation (44, 45) among others (46).4 Based on our results with HGF, it is equally likely that these target genes may also be induced downstream of HGF/c-Met signaling.

c-Met Is a Direct Transcriptional Target of Mitf—We observed using chromatin immunoprecipitations from human melanoma cells that endogenous Mitf protein occupies the c-met promoter, but not the downstream region. In combination with our observations that up- or down-regulation of Mitf modulates endogenous c-Met protein expression in primary melanocytes, these experiments suggest that c-met is a direct transcriptional target of Mitf in this lineage.

Gel shift assays with nuclear extracts from melanoma cells demonstrated binding by endogenous Mitf protein to the c-met promoter DNA fragment containing the consensus Mitf binding (E-box) site. The fact that this promoter region is conserved between human and mice is consistent with an important role in promoter regulation. It is also possible that other E-box binding factors may also transactivate c-met through this conserved site. Addition of cold competitor probe to the binding extract-probe reactions reduced the intensity of bands other than the Mitf supershift, indicating that other factors present in melanoma nuclear extracts are capable of binding this conserved site. Whether the site is targeted in vivo by other basic helix-loop-helix leucine zipper factors remains unknown, however. Given the fact that Mitf expression is lineage restricted, it is plausible either that the E-box element is uniquely involved in melanocytic expression of c-Met or that non-Mitf E-box-binding proteins might utilize this element in other c-Met-expressing cell types.

Melanocyte Cross-talk—In addition to HGF/c-Met, a number of other signaling pathways have been shown to play key developmental roles in the melanocyte lineage. Among these are the Stem Cell Factor/c-Kit, {alpha}MSH/MC1R, and endothelin pathways. Interestingly, each of these pathways has been shown to converge on the master lineage regulator Mitf, which is either post-translationally modified or transcriptionally induced following stimulation of these pathways (1). In addition, other genes known to result in melanocyte deficiencies in mice as well as humans, such as Pax 3 and Sox10 (each implicated in different subtypes of Waardenburg syndrome), regulate the Mitf promoter (47). This may provide a mechanism for extensive cross-talk among these melanocytic pathways, allowing for cytokines from one pathway to induce either receptors or genes downstream of other pathways through Mitf. For example, one would predict that stimulation of melanocytes or melanoma cells with SCF may result in c-Met increases. Alternatively, key transcriptional regulators of neural crest derivatives such as Pax3 may also modulate c-Met expression via Mitf. Indeed, in addition to the direct effect of Pax3 on c-Met expression (48), it may affect c-Met levels at least in part via Mitf.

Given that c-Kit and c-Met both activate the Ras/MAPK pathway, it is perhaps not surprising that we observed similar responses on Mitf stability and transactivation. Indeed, the molecular events and kinetics of signaling downstream of HGF were indistinguishable from those induced by SCF/c-Kit signaling (49). As we previously reported, stimulation of melanocytes or melanoma cells with SCF (or 12-O-tetradecanoylphorbol-13-acetate as a substitute) rapidly triggers the MAPK pathway and leads to phosphorylation of Mitf on serine 73. These studies combined with subsequent analyses of protein stability indicate that Mitf phosphorylation results in a coupled activation/degradation mechanism (32). The same modification that targets Mitf for rapid proteasome-mediated degradation also induces its phospho-specific association with the p300 coactivator (38). Although studies aimed at Mitf association with p300 downstream of HGF are ongoing, the rapid degradation of phospho-Mitf (with kinetics parallel to activated MAPK) in both our HGF and SCF experiments points to tight regulation of Mitf function.

A Role for Mitf in Melanocyte Matrix Invasion and Melanoma Metastasis—Mitf has been suggested to be a master transcriptional regulator of melanocyte development as evidenced by the effects of naturally occurring Mitf alleles on the coat color of mice and corresponding pigment cell abnormalities in humans with Waardenburg Syndrome Type IIA. Mitf is thought to regulate lineage survival as well as pigmentation, two remarkably different biological endpoints in most cell lineages. As noted above, a growing list of transcriptional targets of Mitf includes pigment enzyme and processing genes as well as proliferation/survival regulatory factors. The finding that Mitf regulates c-Met expression in the context of HGF signaling places Mitf at the center of a key migration pathway during melanocyte development and, possibly, melanoma progression.

Our results showing that primary melanocytes in culture are responsive to HGF-induced invasion confirm the work of others in which HGF-treated melanocytes matched melanoma invasive characteristics in vitro (50). Indeed, Matrigel assays measure the ability of cells to penetrate a three-dimensional layer of extracellular matrix as opposed to the migration of cells in two dimensions. Using this assay system, we found that HGF potently increased matrix invasion of primary melanocytes to levels often matching their transformed counterparts. Interestingly, whereas many of the melanoma lines tested were intrinsically more invasive than melanocytes, several also showed HGF-independent invasion, a behavior that could not be explained by abnormal expression levels or constitutive phosphorylation of either c-Met or Mitf proteins (data not shown). Interfering with Mitf in melanocytes entirely blocked HGF-mediated invasion, indicating that Mitf regulates key intermediates required for matrix invasion. Importantly, our experiments do not prove that c-Met is the sole functionally important Mitf target modulating invasive behavior, a possibility very difficult to ascertain, although rescue of Mitf suppression by ectopic c-Met would provide supportive evidence. Alternatively, it is possible that Mitf also acts downstream of HGF/c-Met to modulate other target genes required for matrix invasion. However, based on our experiments in which dominant-negative Mitf blocked HGF-induced c-Met expression, we favor a model in which Mitf acts as a permissive factor for melanocyte invasion. In this model, one of the roles of Mitf is to maintain sufficient levels of c-Met protein, allowing cells to respond to HGF in their environment.

A role for Mitf in the invasive behavior of HGF-treated melanocytes is interesting given the importance of c-Met in melanoma metastasis. A common theme that emerges from studies of melanocytic signaling pathways in aggressive melanoma is the establishment of autocrine loops (9). For example, basic fibroblast growth factor, an important growth factor for melanocytes in culture (51), may be secreted autonomously by melanoma cells (52). The resulting autocrine loop confers autonomous proliferative potential to melanomas, a critical property for growth in vivo (53, 54). Consistent with these findings, an oncogenesis model using HGF transgenic animals shows that a fraction of melanomas will similarly establish HGF/c-Met autocrine loops but that these typically do not occur in tumors that already rely on basic fibroblast growth factor/FGFR loops (55). Interestingly, other reports show that melanomas can gain enhanced metastatic potential through increased c-Met, but not HGF, levels (22), suggesting that an autocrine loop may not be required. In light of our results showing that Mitf is activated both downstream of c-Met and involved in modulating c-Met levels, it is tempting to speculate that melanomas may establish a positive feedback loop of c-Met expression independent of HGF production (ligand-independent receptor activation). This possibility is all the more intriguing given the recently described amplification of Mitf in malignant melanoma (30). Indeed, the ability of Mitf to transcriptionally maintain high c-Met levels could lead to receptor autophosphorylation while relieving the pressure to secrete HGF. A prediction of this model is also that metastatic melanomas would be sensitive to therapies that intervene with Mitf function, thereby disrupting autonomous c-Met expression as well as other targets critical for melanoma survival and progression.


    FOOTNOTES
 
* This work was supported in part by a National Institutes of Health grant (to D. E. F.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 Supported by a Howard Hughes Medical Institute predoctoral fellowship and a Sandoz fellowship. Back

2 To whom correspondence should be addressed: Dept. of Pediatric Oncology, Dana Farber Cancer Inst., 44 Binney St., Boston, MA 02115. Tel.: 617-632-4916; Fax: 617-632-2085; E-mail: david_fisher{at}dfci.harvard.edu.

3 The abbreviations used are: HGF, hepatocyte growth factor; MAPK, mitogen-activated protein kinase; STAT, transducers and activators of transcription; GFP, green fluorescent protein; SCF, stem cell factor. Back

4 M. Horstmann and D. E. Fisher, unpublished data. Back


    ACKNOWLEDGMENTS
 
We thank Wade Huber for adenovirus production and technical assistance and members of the Fisher laboratory for helpful contributions. We also thank Glenn Merlino for comments on the manuscript.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Goding, C. R. (2000) Genes Dev. 14, 1712-1728[Free Full Text]
  2. Halaban, R., Rubin, J. S., Funasaka, Y., Cobb, M., Boulton, T., Faletto, D., Rosen, E., Chan, A., Yoko, K., White, W., et al. (1992) Oncogene 7, 2195-2206[Medline] [Order article via Infotrieve]
  3. Park, M., Dean, M., Cooper, C. S., Schmidt, M., O'Brien, S. J., Blair, D. G., and Vande Woude, G. F. (1986) Cell 45, 895-904[CrossRef][Medline] [Order article via Infotrieve]
  4. Bladt, F., Riethmacher, D., Isenmann, S., Aguzzi, A., and Birchmeier, C. (1995) Nature 376, 768-771[CrossRef][Medline] [Order article via Infotrieve]
  5. Huh, C. G., Factor, V. M., Sanchez, A., Uchida, K., Conner, E. A., and Thorgeirsson, S. S. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 4477-4482[Abstract/Free Full Text]
  6. Birchmeier, C., and Gherardi, E. (1998) Trends Cell Biol. 8, 404-410[CrossRef][Medline] [Order article via Infotrieve]
  7. Maina, F., Casagranda, F., Audero, E., Simeone, A., Comoglio, P. M., Klein, R., and Ponzetto, C. (1996) Cell 87, 531-542[CrossRef][Medline] [Order article via Infotrieve]
  8. Takayama, H., La Rochelle, W. J., Anver, M., Bockman, D. E., and Merlino, G. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 5866-5871[Abstract/Free Full Text]
  9. Chin, L., Merlino, G., and DePinho, R. A. (1998) Genes Dev. 12, 3467-3481[Free Full Text]
  10. Knecht, A. K., and Bronner-Fraser, M. (2002) Nat. Rev. Genet. 3, 453-461[CrossRef][Medline] [Order article via Infotrieve]
  11. Kos, L., Aronzon, A., Takayama, H., Maina, F., Ponzetto, C., Merlino, G., and Pavan, W. (1999) Pigment Cell Res. 12, 13-21[CrossRef][Medline] [Order article via Infotrieve]
  12. Kunisada, T., Yamazaki, H., Hirobe, T., Kamei, S., Omoteno, M., Tagaya, H., Hemmi, H., Koshimizu, U., Nakamura, T., and Hayashi, S. I. (2000) Mech. Dev. 94, 67-78[CrossRef][Medline] [Order article via Infotrieve]
  13. Birchmeier, C., Birchmeier, W., Gherardi, E., and Vande Woude, G. F. (2003) Nat. Rev. Mol. Cell Biol. 4, 915-925[CrossRef][Medline] [Order article via Infotrieve]
  14. Bardelli, A., Longati, P., Gramaglia, D., Stella, M. C., and Comoglio, P. M. (1997) Oncogene 15, 3103-3111[CrossRef][Medline] [Order article via Infotrieve]
  15. Fixman, E. D., Fournier, T. M., Kamikura, D. M., Naujokas, M. A., and Park, M. (1996) J. Biol. Chem. 271, 13116-13122[Abstract/Free Full Text]
  16. Giordano, S., Bardelli, A., Zhen, Z., Menard, S., Ponzetto, C., and Comoglio, P. M. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 13868-13872[Abstract/Free Full Text]
  17. Ponzetto, C., Zhen, Z., Audero, E., Maina, F., Bardelli, A., Basile, M. L., Giordano, S., Narsimhan, R., and Comoglio, P. (1996) J. Biol. Chem. 271, 14119-14123[Abstract/Free Full Text]
  18. Ponzetto, C., Bardelli, A., Zhen, Z., Maina, F., dalla Zonca, P., Giordano, S., Graziani, A., Panayotou, G., and Comoglio, P. M. (1994) Cell 77, 261-271[CrossRef][Medline] [Order article via Infotrieve]
  19. Sachs, M., Weidner, K. M., Brinkmann, V., Walther, I., Obermeier, A., Ullrich, A., and Birchmeier, W. (1996) J. Cell Biol. 133, 1095-1107[Abstract/Free Full Text]
  20. Hendrix, M. J., Seftor, E. A., Seftor, R. E., Kirschmann, D. A., Gardner, L. M., Boldt, H. C., Meyer, M., Pe'er, J., and Folberg, R. (1998) Am. J. Pathol. 152, 855-863[Abstract]
  21. Natali, P. G., Nicotra, M. R., Di Renzo, M. F., Prat, M., Bigotti, A., Cavaliere, R., and Comoglio, P. M. (1993) Br. J. Cancer 68, 746-750[Medline] [Order article via Infotrieve]
  22. Rusciano, D., Lorenzoni, P., and Burger, M. M. (1995) Oncogene 11, 1979-1987[Medline] [Order article via Infotrieve]
  23. Saitoh, K., Takahashi, H., Sawada, N., and Parsons, P. G. (1994) J. Pathol. 174, 191-199[CrossRef][Medline] [Order article via Infotrieve]
  24. Li, G., Schaider, H., Satyamoorthy, K., Hanakawa, Y., Hashimoto, K., and Herlyn, M. (2001) Oncogene 20, 8125-8135[CrossRef][Medline] [Order article via Infotrieve]
  25. Takayama, H., LaRochelle, W. J., Sharp, R., Otsuka, T., Kriebel, P., Anver, M., Aaronson, S. A., and Merlino, G. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 701-706[Abstract/Free Full Text]
  26. Yu, Y., and Merlino, G. (2002) Cancer Res. 62, 2951-2956[Abstract/Free Full Text]
  27. Hodgkinson, C. A., Moore, K. J., Nakayama, A., Steingrimsson, E., Copeland, N. G., Jenkins, N. A., and Arnheiter, H. (1993) Cell 74, 395-404[CrossRef][Medline] [Order article via Infotrieve]
  28. King, R., Googe, P. B., Weilbaecher, K. N., Mihm, M. C., Jr., and Fisher, D. E. (2001) Am. J. Surg. Pathol. 25, 51-57[Medline] [Order article via Infotrieve]
  29. King, R., Weilbaecher, K. N., McGill, G., Cooley, E., Mihm, M., and Fisher, D. E. (1999) Am. J. Pathol. 155, 731-738[Abstract/Free Full Text]
  30. Garraway, L. A., Widlund, H. R., Rubin, M. A., Getz, G., Berger, A. J., Ramaswamy, S., Beroukhim, R., Milner, D. A., Granter, S. R., Du, J., Lee, C., Wagner, S. N., Li, C., Golub, T. R., Rimm, D. L., Meyerson, M. L., Fisher, D. E., and Sellers, W. R. (2005) Nature 436, 117-122[CrossRef][Medline] [Order article via Infotrieve]
  31. Motyckova, G., Weilbaecher, K. N., Horstmann, M., Rieman, D. J., Fisher, D. Z., and Fisher, D. E. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 5798-5803[Abstract/Free Full Text]
  32. Wu, M., Hemesath, T. J., Takemoto, C. M., Horstmann, M. A., Wells, A. G., Price, E. R., Fisher, D. Z., and Fisher, D. E. (2000) Genes Dev. 14, 301-312[Abstract/Free Full Text]
  33. Strahl-Bolsinger, S., Hecht, A., Luo, K., and Grunstein, M. (1997) Genes Dev. 11, 83-93[Abstract/Free Full Text]
  34. Xu, W., Gong, L., Haddad, M. M., Bischof, O., Campisi, J., Yeh, E. T., and Medrano, E. E. (2000) Exp. Cell Res. 255, 135-143[CrossRef][Medline] [Order article via Infotrieve]
  35. Boccaccio, C., Gaudino, G., Gambarotta, G., Galimi, F., and Comoglio, P. M. (1994) J. Biol. Chem. 269, 12846-12851[Abstract/Free Full Text]
  36. Chen, Q., Seol, D. W., Carr, B., and Zarnegar, R. (1997) Hepatology 26, 59-66[Medline] [Order article via Infotrieve]
  37. Seol, D. W., Chen, Q., and Zarnegar, R. (2000) Oncogene 19, 1132-1137[CrossRef][Medline] [Order article via Infotrieve]
  38. Price, E. R., Ding, H. F., Badalian, T., Bhattacharya, S., Takemoto, C., Yao, T. P., Hemesath, T. J., and Fisher, D. E. (1998) J. Biol. Chem. 273, 17983-17986[Abstract/Free Full Text]
  39. McGill, G. G., Horstmann, M., Widlund, H. R., Du, J., Motyckova, G., Nishimura, E. K., Lin, Y-L., Ramaswamy, S., Avery, W., Ding, H-F., Jordan, S. A., Jackson, I. J., Korsmeyer, S. J., Golub, T. R., and Fisher, D. E. (2002) Cell 109, 707-718[CrossRef][Medline] [Order article via Infotrieve]
  40. Rusciano, D., Lorenzoni, P., and Burger, M. M. (1999) J. Cell Sci. 112, Pt. 5, 623-630[Abstract]
  41. Bertolotto, C., Abbe, P., Hemesath, T. J., Bille, K., Fisher, D. E., Ortonne, J. P., and Ballotti, R. (1998) J. Cell Biol. 142, 827-835[Abstract/Free Full Text]
  42. Price, E. R., Horstmann, M. A., Wells, A. G., Weilbaecher, K. N., Takemoto, C. M., Landis, M. W., and Fisher, D. E. (1998) J. Biol. Chem. 273, 33042-33047[Abstract/Free Full Text]
  43. Du, J., Widlund, H. R., Horstmann, M. A., Ramaswamy, S., Ross, K., Huber, W. E., Nishimura, E. K., Golub, T. R., and Fisher, D. E. (2004) Cancer Cell 6, 565-576[CrossRef][Medline] [Order article via Infotrieve]
  44. Du, J., Miller, A. J., Widlund, H. R., Horstmann, M. A., Ramaswamy, S., and Fisher, D. E. (2003) Am. J. Pathol. 163, 333-343[Abstract/Free Full Text]
  45. Vetrini, F., Auricchio, A., Du, J., Angeletti, B., Fisher, D. E., Ballabio, A., and Marigo, V. (2004) Mol. Cell. Biol. 24, 6550-6559[Abstract/Free Full Text]
  46. Miller, A. J., Du, J., Rowan, S., Hershey, C. L., Widlund, H. R., and Fisher, D. E. (2004) Cancer Res. 64, 509-516[Abstract/Free Full Text]
  47. Widlund, H. R., and Fisher, D. E. (2003) Oncogene 22, 3035-3041[CrossRef][Medline] [Order article via Infotrieve]
  48. Epstein, J. A., Shapiro, D. N., Cheng, J., Lam, P. Y., and Maas, R. L. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 4213-4218[Abstract/Free Full Text]
  49. Hemesath, T. J., Price, E. R., Takemoto, C., Badalian, T., and Fisher, D. E. (1998) Nature 391, 298-301[CrossRef][Medline] [Order article via Infotrieve]
  50. Livant, D. L., Linn, S., Markwart, S., and Shuster, J. (1995) Cancer Res. 55, 5085-5093[Abstract/Free Full Text]
  51. Halaban, R. (1996) Semin. Oncol. 23, 673-681[Medline] [Order article via Infotrieve]
  52. Halaban, R., Kwon, B. S., Ghosh, S., Delli Bovi, P., and Baird, A. (1988) Oncogene Res. 3, 177-186[Medline] [Order article via Infotrieve]
  53. Wang, Y., and Becker, D. (1997) Nat. Med. 3, 887-893[CrossRef][Medline] [Order article via Infotrieve]
  54. Yayon, A., Ma, Y. S., Safran, M., Klagsbrun, M., and Halaban, R. (1997) Oncogene 14, 2999-3009[CrossRef][Medline] [Order article via Infotrieve]
  55. Otsuka, T., Takayama, H., Sharp, R., Celli, G., LaRochelle, W. J., Bottaro, D. P., Ellmore, N., Vieira, W., Owens, J. W., Anver, M., and Merlino, G. (1998) Cancer Res. 58, 5157-5167[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
DevelopmentHome page
H. Aoki, Y. Yamada, A. Hara, and T. Kunisada
Two distinct types of mouse melanocyte: differential signaling requirement for the maintenance of non-cutaneous and dermal versus epidermal melanocytes
Development, August 1, 2009; 136(15): 2511 - 2521.
[Abstract] [Full Text] [PDF]


Home page
Mayo Clin Proc.Home page
A. Sekulic, P. Haluska Jr, A. J. Miller, J. G. De Lamo, S. Ejadi, J. S. Pulido, D. R. Salomao, E. C. Thorland, R. G. Vile, D. L. Swanson, et al.
Malignant Melanoma in the 21st Century: The Emerging Molecular Landscape
Mayo Clin. Proc., July 1, 2008; 83(7): 825 - 846.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Chiaverini, L. Beuret, E. Flori, R. Busca, P. Abbe, K. Bille, P. Bahadoran, J.-P. Ortonne, C. Bertolotto, and R. Ballotti
Microphthalmia-associated Transcription Factor Regulates RAB27A Gene Expression and Controls Melanosome Transport
J. Biol. Chem., May 2, 2008; 283(18): 12635 - 12642.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Beuret, E. Flori, C. Denoyelle, K. Bille, R. Busca, M. Picardo, C. Bertolotto, and R. Ballotti
Up-regulation of MET Expression by {alpha}-Melanocyte-stimulating Hormone and MITF Allows Hepatocyte Growth Factor to Protect Melanocytes and Melanoma Cells from Apoptosis
J. Biol. Chem., May 11, 2007; 282(19): 14140 - 14147.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Tsuda, I. J. Davis, P. Argani, N. Shukla, G. G. McGill, M. Nagai, T. Saito, M. Lae, D. E. Fisher, and M. Ladanyi
TFE3 Fusions Activate MET Signaling by Transcriptional Up-regulation, Defining Another Class of Tumors as Candidates for Therapeutic MET Inhibition
Cancer Res., February 1, 2007; 67(3): 919 - 929.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
L. Chin, L. A. Garraway, and D. E. Fisher
Malignant melanoma: genetics and therapeutics in the genomic era.
Genes & Dev., August 15, 2006; 20(16): 2149 - 2182.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/15/10365    most recent
M513094200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McGill, G. G.
Right arrow Articles by Fisher, D. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McGill, G. G.
Right arrow Articles by Fisher, D. E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement