Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M510343200 on February 8, 2006

J. Biol. Chem., Vol. 281, Issue 16, 11205-11213, April 21, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/16/11205    most recent
M510343200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blumberg, J. M.
Right arrow Articles by Hollenberg, A. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blumberg, J. M.
Right arrow Articles by Hollenberg, A. N.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Complex Role of the Vitamin D Receptor and Its Ligand in Adipogenesis in 3T3-L1 Cells*

Jeffrey M. Blumberg, Iphigenia Tzameli, Inna Astapova, Francis S. Lam, Jeffrey S. Flier, and Anthony N. Hollenberg1

From the Division of Endocrinology, Diabetes, and Metabolism, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts 02215

Received for publication, September 20, 2005 , and in revised form, January 12, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The vitamin D receptor (VDR) and its ligand 1,25-OH2-VD3 (calcitriol) play an essential role in mineral homeostasis in mammals. Interestingly, the VDR is expressed very early in adipogenesis in 3T3-L1 cells, suggesting that the VDR signaling pathway may play a role in adipocyte biology and function. Indeed, it has been known for a number of years that calcitriol is a potent inhibitor of adipogenesis in this model but with no clear mechanism identified. In this study, we have further defined the molecular mechanism by which the unliganded VDR and calcitriol-liganded VDR regulate adipogenesis. In the presence of calcitriol, the VDR blocks adipogenesis by down-regulating both C/EBPbeta mRNA expression and C/EBPbeta nuclear protein levels at a critical stage of differentiation. In addition, calcitriol allows for the up-regulation of the recently described C/EBPbeta corerepressor, ETO, which would further inhibit the action of any remaining C/EBPbeta, whose action is required for adipogenesis. In contrast, in the absence of calcitriol, the unliganded VDR appears necessary for lipid accumulation, since knock-down of the VDR using siRNA both delays and prevents this process. Taken together, these data support the notion that the intracellular concentrations of calcitriol can play an important role in either promoting or inhibiting adipogenesis via the VDR and the transcriptional pathways that it targets. Further examination of this hypothesis in vivo may shed new light on the biology of adipogenesis.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The regulation of adipogenesis is a key biologic process that is required for both lipid storage and the development of the endocrine adipocyte. Both of these are key processes that determine the morbidity of obesity. Indeed, obesity is the leading risk for the development of Type 2 diabetes as well as an important contributing risk to heart disease and stroke. Thus, further understanding of the biology of adipogenesis might allow for the development of novel targets for new drugs to modify the function of the adipocyte in vivo.

The murine 3T3-L1 cell line has provided an ideal model system to understand adipocyte development. This line differentiates from fibroblast preadipocyte precursors to mature adipocytes when presented with a hormonal mixture that activates a number of key signaling pathways. These pathways induce a regulatory cascade beginning with the induction of the CCAAT/enhancer-binding protein beta and {delta} isoforms (C/EBPbeta and -{delta}),2 which in turn induce C/EBP{alpha} and the nuclear receptor peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}, present as two isoforms, {gamma}1 and {gamma}2) (1). Once expressed, C/EBP{alpha} and PPAR{gamma} enhance each other's production and are necessary for terminal differentiation (2). In addition, the production of a PPAR{gamma} ligand is also necessary to allow PPAR{gamma} to activate target genes to allow for differentiation (3). Whereas PPAR{gamma} binds the thiazolidinediones, the prostenoid 15-deoxy-{Delta}12-14-prostaglandin J2, some polyunsaturated fatty acids, and phospholipids, such as lysophosphatidic acid, its natural ligand(s) has remained elusive (4, 5) (6-8). Using a stably integrated ligand-sensing system, we recently demonstrated that endogenous PPAR{gamma} ligand activity is induced as early as 24 h after the induction of differentiation via a cAMP-requiring pathway (9).

In order to identify pathways that may lead to PPAR{gamma} ligand production, we used microarrays to identify genes expressed early in adipogenesis that required cAMP production (data not shown). Using this screen, we identified the gene encoding the vitamin D receptor (VDR) as a potential target in this pathway. The VDR, a member of the nuclear receptor superfamily, plays a key role in mineral homeostasis when bound to its ligand, calcitriol (11, 12). In addition, the unliganded VDR plays a critical role in hair follicle development, indicating that like other nuclear receptors, such as the thyroid and retinoic acid receptor isoforms, the VDR has unique functions in the presence and absence of its ligand (13-15).

Previous work by a number of groups has established that calcitriol is an inhibitor of adipogenesis in the 3T3-L1 model (16-18). More recently, work in mice has demonstrated that calcitriol inhibits bone marrow adipogenesis in vivo (19). However, no specific mechanism for the actions of calcitriol in adipocytes has been described. A recent report has suggested that calcitriol-mediated induction of the ER protein Insig-2 in 3T3-L1 adipocytes might lead to the inhibition of adipogenesis by preventing the transcription factor SREBP-1C from reaching the nucleus (20).

Whereas calcitriol inhibits adipogenesis, intriguingly it is the unliganded VDR that is available early in differentiation in 3T3-L1 cells. This suggests that the unliganded VDR may play a unique role in the molecular pathways governing adipogenesis, depending upon the availability of intracellular calcitriol. Indeed, the intracellular metabolism of nuclear receptor ligands is a critical determinant of receptor action. A recent striking example is that adipose tissue function can be altered directly by changes in intracellular cortisol levels through the overexpression of 11beta-HSD1, which reactivates cortisol in this tissue (21). In a parallel fashion, the intracellular availability of 1 {alpha}-hydroxylase, which synthesizes calcitriol from its precursor 25-hydroxyvitamin D3, may be a critical determinant in the action of vitamin D signaling in adipose tissue in vivo (22).

To further characterize the key role of the VDR-signaling pathway in adipogenesis, we have, in this study, identified the molecular mechanism by which the liganded VDR inhibits adipogenesis and also defined a novel role for the unliganded VDR in promoting lipid accumulation. Further work on defining the molecular targets of the VDR in adipose tissue will yield greater insight into its potential in vivo role.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—3T3-L1 preadipocytes were cultured in Dulbecco's modified Eagle's medium supplemented with 10% bovine serum and 1% penicillin/streptomycin during passage. Two days postconfluence (day 0), at initiation of differentiation, 3T3-L1 cells were then cultured with Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. The differentiation mixture introduced at day 0 consists of 1 µM dexamethasone, 1.67 µM insulin, 0.5 mM 3-isobutyl-1-methylxanthine (DIM), and, depending on the experiment, 10 nM calcitriol. Two days postinduction, medium was changed and supplemented with 0.42 µM insulin (and calcitriol if needed), and at day 4 medium was changed again, unsupplemented except in calcitriol experiments. In experiments where calcitriol was added for short periods of time, the cells were washed with phosphate-buffered saline and replaced with the medium present in the control 3T3-L1 cells.

3T3-L1 preadipocytes with the stably integrated ligand-sensing system (5B2 cells (9)) were cultured as described above or treated with the indicated concentrations of calcitriol and/or rosiglitazone. Twenty-four hours after induction of differentiation with DIM and the indicated ligands, the cells were lysed and assayed for beta-galactosidase activity. All experiments were performed in triplicate.

The extent of differentiation was determined by the amount of lipid accumulation at 5 and 7 days by oil red O staining. Briefly, cells were fixed in 10% formaldehyde in phosphate-buffered saline for 1 h, washed with distilled water, and completely dried. Cell were stained with a 0.5% oil red O solution in 60:40 (v/v) isopropyl alcohol/H2O for 30 min at room temperature, washed four times with water, and dried. Differentiation was examined by visual inspection and quantified by elution with isopropyl alcohol and an optical density (OD) measurement at 590 nm.

Cell proliferation was determined by incorporation of crystal violet. Briefly, at the indicated time points, cells were aspirated of medium and washed with phosphate-buffered saline, fixed with 10% formaldehyde for 10 min, washed with water, and completely dried. Cells were then stained with 0.1% crystal violet in 30% ethanol for 30 min at room temperature, washed with water, and air-dried. Crystal violet was then eluted with 10% acetic acid (v/v) and diluted 1:40, and an OD measurement was taken at 590 nm.

Western Blot Analysis—Nuclear protein extracts of 3T3-L1 preadipocytes were prepared as described (23). Protein concentrations were determined using a bicinchoninic acid protein assay (BCA). Equal amounts (20-50 µg) of nuclear protein extracts were loaded onto 10% NuPage gels (Invitrogen) and then transferred with an Invitrogen blot module to nitrocellulose membrane according to the manufacturer's protocol. Mouse anti-PPAR{gamma}, rabbit anti-C/EBPbeta, rabbit anti-C/EBP{alpha}, and goat anti-ETO were purchased from Santa Cruz Biotechnology (sc-7273, sc-150, sc-61, and sc-9737, respectively). Rabbit anti-histone deacetylase 1 was purchased from Cell Signaling (catalog no. 2062), and rat anti-VDR was purchased from Affinity BioReagents (MA1-710). Horseradish peroxidase-linked anti-mouse, rabbit, and rat were from Amersham Biosciences, and horseradish peroxidase-linked anti-goat was from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Membranes were stripped with 70 mM Tris, pH 6.8, 2% SDS, and 0.1% beta-mercaptoethanol for multiple probes of the same membrane.

Quantitative PCR—Total RNA was extracted from 3T3-L1 preadipocytes using RNA STAT-60 (TelTest) according to the manufacturer's protocol, and concentration was determined by OD at 260 nm. To demonstrate quality, integrity, and accuracy of OD concentration, 1.5 µg of each sample was run on a 1.5% agarose/ethidium bromide gel and visualized with UV. Taqman assay on demand primer/probe combinations (Applied Biosystems) were used for analysis of VDR, C/EBPbeta, and Insig-2 expression (Mm00437297_m1, Mm00843434_s1, and Mm00460121_m1, respectively). Assay on demand-derived quantitative PCRs (25 µl) consisted of 5 ng of RNA (samples diluted to 1 ng/µl), 12.5 µl of TaqMan Universal PCR Master Mix (Applied Biosystems), 0.25 µl of primer/probe, 0.125 µl of MulV reverse transcriptase, and 7.125 µl of RNase-free water. To normalize sample values, 18 S was used as an internal control. The reaction setup for 18 S was the same as above, except that 0.375 µl of forward and reverse primers, 0.125 µl of probe, and 6.5 µl of water was used. Sequence for 18 S primer and probe were as follows: forward primer, AGTCCCTGCCCTTTGTACACA; reverse primer, GATCCGAGGGCCTCACTAAAC; probe, CGCCCGTCGCTACTACCGATTGG. All samples were run in duplicate. Quantitative PCR reactions were run on a MX3000p (Stratagene) with the following conditions: 30 min at 48 °C, 10 min at 95 °C, and 40 cycles of 95 °C at 15 s and 1 min at 60 °C. Template quantity was determined from gene-specific standard curves (50 ng to 0.1 mg of total RNA). Relative mRNA concentrations were determined by dividing the initial template quantity of the target gene by the 18 S initial template quantity. Results shown are pooled from two separate experiments. The data are displayed as mean ± S.E. Significance was determined by Student's t test.

RNA Interference—3T3-L1 preadipocytes were transfected with siRNA oligonucleotide duplexes 1 day postconfluence (day-1) with Lipofectamine 2000 (Invitrogen). Generally, 100 nM (unless otherwise indicated) siRNA was transfected with 4 µl of Lipofectamine/well of a 6-well plate with fresh medium. Each experiment contained equivalent samples transfected with a nontargeting control siRNA pool (Dharmacon) and samples not treated with Lipofectamine. siRNA oligonucleotide duplexes for each gene of interest were purchased from Dharmacon as either a four-duplex pool (Insig-2) or an optimized single duplex (VDR; sense, GAAUGUGCCUCGGAUCUGUUU; antisense, ACAGAUCCGAGGCACAUUCUU). Transfection efficiency was monitored using fluorescence-tagged oligonucleotides (Blockit; Invitrogen) transfected as described above and visualized with a mercury lamp fluorescent microscope.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
The VDR Is Induced Early in Adipogenesis via a cAMP Pathway—To confirm our microarray data suggesting that the VDR is expressed as early as 6 h after the induction of differentiation with DIM, we analyzed VDR expression via Q-PCR in differentiating 3T3-L1 cells. As shown in Fig. 1A, VDR mRNA levels reached their maximum 6 h after the addition of DIM and then declined rapidly. Consistent with its mRNA expression were VDR protein levels in 3T3-L1 nuclear extracts. VDR nuclear protein began to accumulate at 4 h and was maximally present at 12 h. Thereafter, it quickly declined and disappeared 2 days into differentiation (Fig. 1B). In contrast, nuclear protein levels of histone deacetylase 1 were relatively constant during differentiation. We next looked at nuclear VDR protein in response to each component of the differentiation mixture. Whereas dexamethasone and insulin had no effect in inducing the VDR, 3-isobutyl-1-methylxanthine strongly induced the VDR 6 h after its addition (Fig. 1C). This finding is consistent with the cAMP pathway being responsible for the early induction of the VDR in 3T3-L1 cells and with similar effects of this pathway in other cell types on VDR expression (24, 25).

To determine whether VDR signaling influences formation of PPAR{gamma} ligand activity in 3T3-L1 cells, we analyzed ligand activity in 3T3-L1 5B2 cells that were stably transfected with a PPAR{gamma} ligand-sensing system, which activates a beta-galactosidase reporter in the presence of a PPAR{gamma} ligand (10). As shown in Fig. 2, 24 h after the addition of DIM, beta-galactosidase levels increased by close to 8-fold, consistent with the production of an endogenous PPAR{gamma} ligand. Indeed, 500 mM rosiglitazone induced a 4-fold induction of the same reporter. In the presence of DIM and calcitriol, reporter activation was inhibited by ~40%, consistent with the notion that the VDR-signaling system lies upstream of PPAR{gamma} ligand formation. To control for possible squelching, we added calcitriol to the rosiglitazone-treated cells and saw no effect, indicating that liganded VDR was not blocking the liganded Gal4-PPAR{gamma} directly or via competition for limiting cofactors.

The Liganded VDR Blocks Adipogenesis by Lowering C/EBPbeta Levels—To confirm the ability of calcitriol to inhibit adipogenesis, we examined a range of concentrations of calcitriol. Concentrations of calcitriol from 100 nM down to 1 nM were sufficient to inhibit adipogenesis, as shown by the lack of oil red O staining (Fig. 3A). This finding demonstrates that the serum used during DIM-induced adipogenesis contains very little calcitriol, supporting the notion that the VDR expressed early in adipogenesis is unliganded.


Figure 1
View larger version (17K):
[in this window]
[in a new window]
  		FIGURE 1.
The VDR is induced early in adipogenesis via cAMP stimulation. A, 2 days after reaching confluence, dexamethasone, insulin, and 3-isobutyl-1-methylxanthine were added to 3T3-L1 cells, and total RNA was isolated at the indicated time points. Quantitative PCR for the VDR and 18 S RNA was performed, and the data were normalized (VDR/18 S). B, using an identical paradigm, nuclear extracts were isolated from 3T3-L1 cells, and equal amounts were run on SDS-PAGE and probed with either a VDR or histone deacetylase 1 antibody. C, 3T3-L1 cells were exposed to either insulin, dexamethasone, or 3-isobutyl-1-methylxanthine (IBMX); nuclear extracts were isolated 6 and 12 h later, and VDR levels were analyzed by Western blot.

 


Figure 2
View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 2.
The VDR lies upstream of PPAR{gamma} ligand production. 5B2 3T3-L1 cells were induced to differentiate as described (see "Materials and Methods"). 24 h after induction with dexamethasone, insulin, and 3-isobutyl-1-methylxanthine, the cells were lysed, and beta-galactosidase levels were determined. Rosi, Rosiglitazone, VD3, calcitriol.

 
We next examined the levels of VDR in the presence of calcitriol. As expected, calcitriol acted to stabilize the VDR in nuclear extracts and prevent its degradation, as has been demonstrated previously (26, 27). Because of this effect, the VDR was present throughout most of the adipogenic period. However, a transcriptional component appears to also play a role, since VDR transcription was reinitiated at day 4 and maintained at day 5 (Fig. 3B). Thus, the presence of calcitriol through both transcriptional and post-transcriptional mechanisms induced the production and stability of the VDR, explaining in part its ability to potently block adipogenesis.

To ensure that calcitriol was not blocking mitotic clonal expansion, which occurs in the first few days after DIM addition and appears to be necessary for adipogeneis (28), we measured DNA content using crystal violet staining. As shown in Fig. 3C, calcitriol has a small effect on expansion, but the treated cells still go through a near doubling process in the first 48 h, indicating that the liganded VDR is not fully blocking this process.

In order to determine the mechanism by which the liganded VDR inhibits adipogenesis, we examined the expression of key members of the transcriptional cascade that induce the adipogenic program. Not surprisingly, both C/EBP{alpha} and PPAR{gamma} levels were very low in calcitriol-treated nuclear extracts (Fig. 4A). In contrast, C/EBP{alpha} accumulation in the nuclear extracts from untreated cells was dramatically enhanced on day 2 after the addition of DIM and stays at high levels throughout the adipogenic program. Similarly, PPAR{gamma} expression became noticeable at day 1 and progressively increased during the remainder of differentiation. Thus, calcitriol appears to have its effects upstream of the induction of C/EBP{alpha} and PPAR{gamma}.


Figure 3
View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 3.
Calcitriol inhibits adipogenesis. A, 3T3-L1 cells were allowed to differentiate for 8 days after the administration of DIM in the presence or absence of the indicated concentration of calcitriol (VD3). The cells were then fixed and stained with oil red O. B, groups of 3T3-L1 cells were allowed to differentiate in the presence of 10 nM calcitriol, and either mRNA or nuclear extracts were isolated at the indicated time points. Quantitative PCR was performed for VDR and 18 S, and the data were quantified as described above. VDR nuclear protein levels were determined by Western analysis. C, 3T3-L1 cells were allowed to differentiate for the indicated amount of time, after which the cells were stained with crystal violet to determine DNA amounts and cell proliferation. Each point was performed in duplicate.

 
We next assessed the protein levels of C/EBPbeta in nuclear extracts from calcitriol-treated and control cells. As is shown in Fig. 4B, C/EBPbeta protein levels began to increase 6 h after the induction of the adipogenic program, although some basal expression was present at time 0. C/EBPbeta protein levels peaked during day 2 and then fell off, presumably after inducing adequate amounts of C/EBP{alpha} and PPAR{gamma} to maintain effective adipogenesis. In contrast, in calcitriol-treated nuclear extracts, C/EBPbeta protein levels rose in a similar fashion to control extracts but were decreased on day 2, suggesting that the liganded VDR functions to block C/EBPbeta accumulation and thus prevents full activation of C/EBP{alpha} and PPAR{gamma} levels. Whereas the data presented highlight the 34-kDa LAP isoform of C/EBPbeta, we could also visualize the smaller LIP isoform, which was expressed at lower levels and did not change in proportion with calcitriol treatment. In the same experiments, we also examined C/EBP{delta} levels. In the DIM-treated extracts, there was little C/EBP{delta} at time 0, but this progressively increased to a peak at 4 h and then rapidly fell. This early pattern of induction was not changed in the calcitriol-treated nuclear extracts, consistent with calcitriol affecting only C/EBPbeta levels.

To determine if calcitriol signaling regulates C/EBPbeta at the level of transcription, we next looked at C/EBPbeta mRNA levels. In control cells, C/EBPbeta mRNA was induced strongly 6 h after the addition of DIM in the absence of calcitriol and was maintained until day 2, after which it began to fall toward its basal level (Fig. 4B). In the presence of calcitriol, C/EBPbeta mRNA was also induced. However, it was also down-regulated much more quickly beginning at day 1 and progressing through day 2 such that it had returned to basal levels. These data are consistent with the protein levels seen in nuclear extracts. Thus, calcitriol either directly or indirectly negatively regulates C/EBPbeta gene expression in differentiating 3T3-L1 cells.

We also considered whether calcitriol-VDR signaling may also regulate pathways that may modify C/EBPbeta action. Recently, Rochford et al. (29) demonstrated that the transcriptional corepressor ETO/MTG8 is expressed in preadipocytes and is down-regulated via insulin signaling in early adipogenesis. When overexpressed, ETO/MTG8 is a potent inhibitor of adipogenesis through its ability to directly interact with C/EBPbeta and inhibit its action on the C/EBP{alpha} promoter. To analyze the role of calcitriol in ETO/MTG8 expression, we looked at ETO/MTG8 levels in nuclear extracts from differentiating 3T3-L1 cells. As described, ETO levels decreased dramatically in the first 12 h after the addition of the differentiating mixture in control cells. In contrast, in the presence of calcitriol (Fig. 5), ETO expression was maintained throughout adipogenesis and increased after day 1.

We next considered whether the actions of calcitriol are reversible such that its removal would allow differentiation to resume. As is seen in Fig. 6, the addition of calcitriol to DIM-treated 3T3-L1 cells for as brief a period as 6 h was effective in blocking differentiation. Longer treatments from 12 h up to 3 days are clearly more effective. To control for the addition and removal of calcitriol, we added the ligand for 1 h and saw no effect on adipogenesis (data not shown). Not surprisingly, the effects of short term pulses of calcitriol are mediated by the inhibition of the induction of C/EBP{alpha} and PPAR{gamma} that would normally occur in DIM-treated cells by day 3 (Fig. 6B).


Figure 4
View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 4.
The calcitriol-VDR pathway inhibits adipogenesis by negatively regulating C/EBPbeta protein and mRNA levels. A, nuclear extracts were obtained from differentiating 3T3-L1 cells at the indicated time points, and Western analysis was performed for C/EBP{alpha} and PPAR{gamma} either in the presence or absence of 10 nM calcitriol (VD3). B, mRNA and nuclear extracts were isolated from differentiating 3T3-L1 cells at the indicated time points in the presence or absence of 10 nM calcitriol. Quantitative PCR was performed for C/EBPbeta and 18 S mRNA, and the data were normalized (C/EBPbeta/18 S). *, p < 0.05.

 


Figure 5
View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 5.
ETO/MTG8 levels are induced in calcitriol-treated 3T3-L1 cells. Nuclear extracts were isolated from differentiating 3T3-L1 cells at the indicated time points either in the presence or absence of 10 nM calcitriol (VD3). Equal amounts of extract were analyzed by Western using an ETO antibody.

 
Finally, to determine if the dramatic induction of the Insig-2A isoform by calcitriol could also be playing a role in the ability of the liganded VDR to block adipogenesis, we asked whether Insig-2 lies downstream of calcitriol (20). Since both Insig-2A and -2B encode the same protein, we first asked whether total Insig-2 mRNA is regulated by calcitriol (30). To do this, we used Q-PCR with the assay directed at a coding exon that both isoforms share. Using this assay, we saw only a moderate 2-fold induction in Insig-2 mRNA 24-36 h after the addition of DIM and calcitriol (not shown), suggesting that Insig-2A makes up only a small portion of total Insig-2, with Insig-2B making up the majority. We next used siRNA against Insig-2 to determine whether its induction plays a role in calcitriol action in inhibiting differentiation. To accomplish this, we used an siRNA pool that dramatically reduced Insig-2 mRNA expression (Fig. 7A). As is shown in Fig. 7B, knock-down of Insig-2 is proadipogenic, leading to a substantial induction of oil red O staining 5 days after the addition DIM. However, siRNA directed against Insig-2 has no effect on the ability of calcitriol to inhibit adipogenesis. Thus, the actions of calcitriol do not appear to require induction of Insig-2.

The Role of the Unliganded VDR in Adipogenesis—Our data demonstrate that the early expression of the VDR in the adipogenic program occurs in the absence of appreciable amounts of calcitriol present in the medium and serum; thus, the VDR probably acts early in adipogenesis as an unliganded receptor. To determine whether the unliganded VDR plays a role in adipogenesis, we used siRNA to down-regulate its expression in differentiating 3T3-L1 cells. Confluent 3T3-L1 cells were transfected with varying amounts of siRNA duplexes 24 h prior to the induction of adipogenesis with DIM. As shown in Fig. 8A, successful knock-down of the VDR can be accomplished using this technique, and levels of the VDR remain low when compared with control cells 24 h after the induction of adipogenesis. We next examined the role of the unliganded VDR in adipogenesis. We allowed groups of the transfected cells with varying amounts of the VDR siRNA to differentiate and performed oil red O staining at day 8. We found that 100 nM siRNA was most effective at decreasing both VDR levels and oil red O staining at day 8 (13% when quantified by optical density after elution in isopropyl alcohol).


Figure 6
View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 6.
Short pulses of calcitriol partially inhibit adipogenesis. Differentiating 3T3-L1 adipocytes received 10 nM calcitriol (VD3) for the indicated amount of time, after which the cells were washed and fresh differentiating medium was added. The cells were then either stained with oil red O at day 8 (A) or lysed for nuclear extract isolation at day 3. Western analysis was performed on equal amounts of protein using the isolated day 3 nuclear extracts (B).

 


Figure 7
View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 7.
Insig-2 is not required for the actions of calcitriol on adipogenesis. Confluent 3T3-L1 preadipocytes were transfected with siRNA directed against Insig-2, a scrambled control, or were not transfected. 24 h later, DIM was added either alone or with 10 nM calcitriol (VD3). Parallel groups of cells were lysed 24 h after the addition of DIM to collect mRNA for quantitative PCR to demonstrate efficient knock-down of Insig-2 (A) or were allowed to differentiate for 5 days and then fixed and stained with oil red O (B).

 
To further examine the role of the unliganded VDR in adipogenesis, we also wanted to look at the rate of adipogenesis by examining lipid accumulation earlier than day 8. To do this, we again transfected 3T3-L1 cells with either VDR siRNA or scrambled duplexes (and also a mock transfection control) and looked at VDR protein levels at day 1 after the addition of DIM and oil red O staining at day 5. As demonstrated in Fig. 9A, VDR protein levels were significantly reduced at day 1 in cells transfected with VDR siRNA as compared with control cells, and oil red O staining was also decreased by 35% in these cells as compared with control cells. To confirm these data, we repeated the dose-response experiment and stained again at day 5. Again, increasing doses of VDR siRNA caused a reduction in oil red O staining consistent with an effect on lipid accumulation (Fig. 9B).

Whereas oil red O staining was partially impaired, we also wanted to examine markers of adipocyte differentiation in cells treated with VDR siRNA. As shown in Fig. 9C, VDR levels were substantially reduced over the course of differentiation by VDR siRNA. However, induction of the PPAR{gamma} isoforms was not blocked by VDR siRNA, suggesting that the role of the unliganded VDR is not complete in blocking the adipogenic program both in the context of oil red O staining and induction of adipogenic markers.


Figure 8
View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 8.
Knock-down of VDR levels in 3T3-L1 cells using siRNA. A, 1-day postconfluent 3T3-L1 cells were transfected with a variety of concentrations of VDR siRNA duplex. Twenty-four hours later (2 days postconfluence, time 0), differentiation mixture was added, and nuclear extracts were isolated 24 h later. Equal amounts of nuclear extracts were analyzed by Western blot for VDR and histone deacetylase 1. B, parallel groups of 3T3-L1 cells were transfected with the indicated concentration of VDR siRNA duplex 24 h after reaching confluence. Twenty-four hours later, differentiation was induced, and cells from this transfection were stained with oil red O 8 days after the addition of DIM.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The 3T3-L1 cell line is a key model that has revealed regulatory routes by which transcription factors induce adipogenesis. While it has long been known that the VDR and its cognate ligand calcitriol inhibit adipogenesis in this model, the mechanism has remained elusive. Given the role of the VDR in regulating tumor growth and proliferation in malignancy, the mechanism by which the unliganded and liganded VDR regulate adipogenesis will provide further key insight into the role of the vitamin D signaling pathway in health and disease (12). In addition, the data presented here demonstrate unique roles for the VDR, depending upon the availability of its ligand, calcitriol, suggesting that the intracellular concentration of calcitriol might be a target for modulation in the treatment of obesity.

The VDR, like other nuclear receptor family members, including thyroid receptors, RARs, and PPAR{gamma}, is bound to regulatory elements in target genes as heterodimers with the retinoid X receptor in both the absence and presence of their cognate ligands (22). In the absence of ligand, these receptors recruit the nuclear corepressors, NCoR and SMRT, which act as platforms for a multiprotein complex that mediates transcriptional repression via histone deacetylation (31-34). Indeed, the unliganded VDR is known to recruit NCoR and SMRT and appears to recruit a novel complex containing the Williams syndrome transcription factor (35). Furthermore, the unliganded VDR plays a distinct role in hair follicle development in vivo, establishing it as a bona fide mediator independent of the presence of calcitriol. Indeed, the actions of the unliganded VDR in the hair follicle may be through its recruitment of the tissue-specific corepressor hairless (36, 37). In the presence of ligand, an allosteric shift repositions the helices of the nuclear receptor ligand-binding domain, which displaces the corepressors and allows for the targeted recruitment of a coregulatory complex that allows for transcriptional activation via histone acetylation and methylation (38-40). Whereas this model explains the action of the VDR on most targets, certain targets genes are paradoxically repressed by the liganded VDR, such as the 25(OH)D3 1{alpha}-hydroxylase promoter. In this case, the liganded VDR is able to bind to and block the activation function of VDIR, which binds to and activates the 1{alpha}-hydroxylase promoter (41). Thus, the VDR has important biologic activity in the absence of ligand and has the ability to either inhibit or activate gene expression in the presence of ligand.

In this study, we demonstrate unique functions of both the unliganded and liganded VDR in adipogenesis in 3T3-L1 cells. Surprisingly, it is the unliganded VDR that may promote adipogenesis, whereas the liganded VDR represses C/EBPbeta expression and inhibits adipogenesis. Although the unliganded VDR is not required for adipogenesis, it appears to enhance the process and allow for more lipid accumulation. The mechanism by which the VDR acts is not clear, but the possibility exists that an adipocyte-specific cofactor mediates the effects of the unliganded VDR on lipid accumulation. Certainly, VDR knock-out mice appear to have normal amounts of adipose tissue. However, due to the dietary needs of these animals, it is unclear how they would respond to a nutritional challenge, such as a high fat diet.

Our data demonstrate that the VDR is expressed early in adipogenesis, driven by the cAMP pathway, which is known to activate VDR expression in other cell types. The mechanism by which this pathway increases VDR transcription is not clear, although a cAMP response element is present in the VDR promoter (24). Interestingly, the early response gene, krox20, has recently been demonstrated to be essential for adipogenesis and to be expressed in 3T3-L1 cells in the first 4 h after the addition of DIM (42). krox20 appears to function by enhancing C/EBPbeta expression, although the region of the C/EBPbeta promoter that mediates this effect lacks a krox20 binding site. However, the VDR promoter contains a consensus krox20 site near the transcriptional start site. It is tempting to speculate that the early induction of krox20 allows for VDR expression, which in turn plays a role in full induction of C/EBPbeta in the absence of calcitriol (24, 42). A precedent for ligand-independent activation of gene expression by nuclear receptors exists such that the thyroid receptor isoforms activate transcription of target genes such as TSHbeta in the pituitary and thyrotropin-releasing hormone in the hypothalamus (43-45).

In contrast to the role of the unliganded VDR, the liganded VDR is a potent inhibitor of adipogenesis in 3T3-L1 cells. Whereas VDR levels decline rapidly in the absence of calcitriol, the presence of calcitriol maintains VDR expression through at least day 5 of the adipogenic program. This is in keeping with the well established role of calcitriol in stabilizing the VDR protein itself (26, 27). Thus, the liganded VDR is able to persistently act to inhibit adipogenesis. The mechanism by which the liganded VDR inhibits adipogenesis is multifactorial but appears focused on the C/EBPbeta signaling pathway. Our data demonstrate that the liganded VDR causes a substantial fall in both the induction of C/EBPbeta mRNA and the amount of C/EBPbeta protein present beginning between days 1 and 2 of the differentiation program. This occurs at a critical period when C/EBPbeta is required for the induction of C/EBP{alpha} and PPAR{gamma}. Thus, given the required role of this pathway in adipogenesis, it is likely that C/EBPbeta levels are too low to induce C/EBP{alpha} and PPAR{gamma}. In addition, calcitriol inhibits PPAR{gamma} ligand formation, consistent with the previously described role of C/EBPbeta in this process (9, 46).

Whereas calcitriol-VDR signaling directly inhibits C/EBPbeta production, the remaining C/EBPbeta seen would have little transcriptional effect, based on the high levels of ETO/MTG8 present in the calcitriol-treated cells. Indeed, ETO directly blocks transcriptional activation mediated by C/EBPbeta based on its ability to interact directly with C/EBPbeta on target promoters and recruit corepressors, such as NCoR and SMRT, to target genes (29, 47). Further work will be required to understand the mechanism by which calcitriol-VDR signaling reactivates ETO/MTG8 expression.


Figure 9
View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 9.
The unliganded VDR plays a role in lipid accumulation. A, groups of 3T3-L1 cells were transfected with a 100 nM concentration of the VDR siRNA duplex or a control scrambled duplex. Nuclear extracts were isolated from half of the transfected cells 24 h after the addition of differentiation mixture, and Western analysis was performed for VDR. The remainder of the cells were allowed to differentiate for 5 days and then fixed and stained with oil red O. Oil red O accumulation was quantified by extracting in isopropyl alcohol and measuring OD in duplicate. B, groups of 3T3-L1 cells were transfected with a variety of concentrations of VDR or control siRNA duplex. Parallel groups of cells were allowed to differentiate or lysed for nuclear extracts. C, 1-day postconfluent 3T3-L1 cells were transfected with a 100 nM concentration of a VDR siRNA duplex or a scrambled control. Nuclear extracts were isolated at the indicated time points, and equal amounts were subjected to SDS-PAGE and analyzed by Western blot.

 
Whereas disruption of the C/EBPbeta pathway is critical for the effects of the liganded VDR, the mechanism by which the liganded VDR blocks C/EBPbeta expression is not clear. Given that C/EBPbeta mRNA levels accumulate during the first 12-24 h of differentiation in the presence or absence of calcitriol, it is likely that the liganded VDR induces the expression of an adipocyte-specific negative regulator of C/EBPbeta transcription rather than directly inhibiting C/EBPbeta transcription. This is supported by a recent report demonstrating that calcitriol induces C/EBPbeta mRNA levels in osteosarcoma and kidney cells, suggesting that the cell-specific expression of regulatory cofactors may influence liganded VDR action on the C/EBPbeta gene (48). Further work will focus on genes induced by calcitriol in 3T3-L1 cells in order to clarify this mechanism. In addition, identification of pathways induced by calcitriol will allow for insight into the mechanism by which calcitriol-VDR signaling also inhibits PPAR{gamma} ligand formation. Although not primary in the ability of calcitriol to inhibit adipogenesis, identification of further elements of this pathway may facilitate efforts to identify the endogenous PPAR{gamma} ligand.

In addition to the results presented here, a recent report has also described the ability of calcitriol to inhibit C/EBP{alpha} and PPAR{gamma} expression in 3T3-L1 cells (49). Furthermore, these investigators also demonstrated the ability of the VDR to block PPAR{gamma} transcriptional activity, suggesting that calcitriol may function on multiple levels to regulate adipogenesis. This report did not demonstrate regulation of C/EBPbeta by calcitriol, but this was not quantitatively assessed.

In summary, we have demonstrated that the liganded VDR represses both C/EBP{alpha} and PPAR{gamma} expression via inhibition of C/EBPbeta expression and action and is a potent inhibitor of adipogenesis. In contrast, the unliganded receptor is not required for adipogenesis but may play a role in some aspect of the process. These data suggest that the intracellular levels of calcitriol play a key role in adipocyte formation. Thus, altering the production of intracellular calcitriol may allow for the modulation of adipogenesis in vivo.


   FOOTNOTES
 
* This work was supported by grants from Takeda Chemical Industries (Osaka, Japan) (to J. S. F. and A. N. H.) and the National Institutes of Health Grants DKR3728081 (to J. S. F.) and DK056123 (to A. N. H.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Division of Endocrinology, Diabetes and Metabolism Beth Israel Deaconess Medical Center, 330 Brookline Ave., Boston, MA 02215. Tel.: 617-667-2151; E-mail: thollenb{at}bidmc.harvard.edu.

2 The abbreviations used are: C/EBP, CCAAT/enhancer binding protein; VDR, vitamin D receptor; PPAR{gamma}, peroxisome proliferator-activated receptor; RAR, retinoic acid receptor; DIM, differentiation mixture; siRNA, small interfering RNA. Back


   ACKNOWLEDGMENTS
 
We thank Drs. Evan Rosen and Marie Demay for helpful discussions.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Rosen, E. D., and Spiegelman, B. M. (2000) Annu. Rev. Cell Dev. Biol. 16, 145-171[CrossRef][Medline] [Order article via Infotrieve]
  2. Rosen, E. D., Hsu, C. H., Wang, X., Sakai, S., Freeman, M. W., Gonzalez, F. J., and Spiegelman, B. M. (2002) Genes Dev. 16, 22-26[Abstract/Free Full Text]
  3. Tontonoz, P., Hu, E., and Spiegelman, B. M. (1994) Cell 79, 1147-1156[CrossRef][Medline] [Order article via Infotrieve]
  4. Lehmann, J. M., Moore, L. B., Smith-Oliver, T. A., Wilkison, W. O., Willson, T. M., and Kliewer, S. A. (1995) J. Biol. Chem. 270, 12953-12956[Abstract/Free Full Text]
  5. Kliewer, S. A., Sundseth, S. S., Jones, S. A., Brown, P. J., Wisely, G. B., Koble, C. S., Devchand, P., Wahli, W., Willson, T. M., Lenhard, J. M., and Lehmann, J. M. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 4318-4323[Abstract/Free Full Text]
  6. Forman, B. M., Tontonoz, P., Chen, J., Brun, R. P., Spiegelman, B. M., and Evans, R. M. (1995) Cell 83, 803-812[CrossRef][Medline] [Order article via Infotrieve]
  7. Kliewer, S. A., Lenhard, J. M., Willson, T. M., Patel, I., Morris, D. C., and Lehmann, J. M. (1995) Cell 83, 813-819[CrossRef][Medline] [Order article via Infotrieve]
  8. McIntyre, T. M., Pontsler, A. V., Silva, A. R., St. Hilaire, A., Xu, Y., Hinshaw, J. C., Zimmerman, G. A., Hama, K., Aoki, J., Arai, H., and Prestwich, G. D. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 131-136[Abstract/Free Full Text]
  9. Tzameli, I., Fang, H., Ollero, M., Shi, H., Hamm, J. K., Kievit, P., Hollenberg, A. N., and Flier, J. S. (2004) J. Biol. Chem. 279, 36093-36102[Abstract/Free Full Text]
  10. Baker, A. R., McDonnell, D. P., Hughes, M., Crisp, T. M., Mangelsdorf, D. J., Haussler, M. R., Pike, J. W., Shine, J., and O'Malley, B. W. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 3294-3298[Abstract/Free Full Text]
  11. Haussler, M. R., Whitfield, G. K., Haussler, C. A., Hsieh, J. C., Thompson, P. D., Selznick, S. H., Dominguez, C. E., and Jurutka, P. W. (1998) J. Bone Miner. Res. 13, 325-349[CrossRef][Medline] [Order article via Infotrieve]
  12. Jones, G., Strugnell, S. A., and DeLuca, H. F. (1998) Physiol. Rev. 78, 1193-1231[Abstract/Free Full Text]
  13. Chen, J. D., and Evans, R. M. (1995) Nature 377, 454-457[CrossRef][Medline] [Order article via Infotrieve]
  14. Horlein, A. J., Naar, A. M., Heinzel, T., Torchia, J., Gloss, B., Kurokawa, R., Ryan, A., Kamei, Y., Soderstrom, M., Glass, C. K., and Rosenfeld, M. G. (1995) Nature 377, 397-404[CrossRef][Medline] [Order article via Infotrieve]
  15. Skorija, K., Cox, M., Sisk, J. M., Dowd, D. R., MacDonald, P. N., Thompson, C. C., and Demay, M. B. (2005) Mol. Endocrinol. 19, 855-862[Abstract/Free Full Text]
  16. Kamei, Y., Kawada, T., Kazuki, R., Ono, T., Kato, S., and Sugimoto, E. (1993) Biochem. Biophys. Res. Commun. 193, 948-955[CrossRef][Medline] [Order article via Infotrieve]
  17. Kawada, T., Kamei, Y., and Sugimoto, E. (1996) Int. J. Obes. Relat. Metab. Disord. 20, Suppl. 3, 52-57
  18. Sato, M., and Hiragun, A. (1988) J. Cell. Physiol. 135, 545-550[CrossRef][Medline] [Order article via Infotrieve]
  19. Kelly, K. A., and Gimble, J. M. (1998) Endocrinology 139, 2622-2628[Abstract/Free Full Text]
  20. Lee, S., Lee, D. K., Choi, E., and Lee, J. W. (2005) Mol. Endocrinol. 19, 399-408[Abstract/Free Full Text]
  21. Masuzaki, H., Paterson, J., Shinyama, H., Morton, N. M., Mullins, J. J., Seckl, J. R., and Flier, J. S. (2001) Science 294, 2166-2170[Abstract/Free Full Text]
  22. Sutton, A. L., and MacDonald, P. N. (2003) Mol. Endocrinol. 17, 777-791[Abstract/Free Full Text]
  23. Hodgson, M. C., Astapova, I., Cheng, S., Lee, L. J., Verhoeven, M. C., Choi, E., Balk, S. P., and Hollenberg, A. N. (2005) J. Biol. Chem. 280, 6511-6519[Abstract/Free Full Text]
  24. Jehan, F., and DeLuca, H. F. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 10138-10143[Abstract/Free Full Text]
  25. Krishnan, A. V., and Feldman, D. (1992) Mol. Endocrinol. 6, 198-206[Abstract/Free Full Text]
  26. Arbour, N. C., Prahl, J. M., and DeLuca, H. F. (1993) Mol. Endocrinol. 7, 1307-1312[Abstract/Free Full Text]
  27. Wiese, R. J., Uhland-Smith, A., Ross, T. K., Prahl, J. M., and DeLuca, H. F. (1992) J. Biol. Chem. 267, 20082-20086[Abstract/Free Full Text]
  28. Zhang, J. W., Tang, Q. Q., Vinson, C., and Lane, M. D. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 43-47[Abstract/Free Full Text]
  29. Rochford, J. J., Semple, R. K., Laudes, M., Boyle, K. B., Christodoulides, C., Mulligan, C., Lelliott, C. J., Schinner, S., Hadaschik, D., Mahadevan, M., Sethi, J. K., Vidal-Puig, A., and O'Rahilly, S. (2004) Mol. Cell. Biol. 24, 9863-9872[Abstract/Free Full Text]
  30. Yabe, D., Brown, M. S., and Goldstein, J. L. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 12753-12758[Abstract/Free Full Text]
  31. Ishizuka, T., and Lazar, M. A. (2003) Mol. Cell. Biol. 23, 5122-5131[Abstract/Free Full Text]
  32. Li, J., Lin, Q., Wang, W., Wade, P., and Wong, J. (2002) Genes Dev. 16, 687-692[Abstract/Free Full Text]
  33. Li, J., Wang, J., Nawaz, Z., Liu, J. M., Qin, J., and Wong, J. (2000) EMBO J. 19, 4342-4350[CrossRef][Medline] [Order article via Infotrieve]
  34. Privalsky, M. L. (2004) Annu. Rev. Physiol. 66, 315-360[CrossRef][Medline] [Order article via Infotrieve]
  35. Kitagawa, H., Fujiki, R., Yoshimura, K., Mezaki, Y., Uematsu, Y., Matsui, D., Ogawa, S., Unno, K., Okubo, M., Tokita, A., Nakagawa, T., Ito, T., Ishimi, Y., Nagasawa, H., Matsumoto, T., Yanagisawa, J., and Kato, S. (2003) Cell 113, 905-917[CrossRef][Medline] [Order article via Infotrieve]
  36. Hsieh, J. C., Sisk, J. M., Jurutka, P. W., Haussler, C. A., Slater, S. A., Haussler, M. R., and Thompson, C. C. (2003) J. Biol. Chem. 278, 38665-38674[Abstract/Free Full Text]
  37. Potter, G. B., Beaudoin, G. M., III, DeRenzo, C. L., Zarach, J. M., Chen, S. H., and Thompson, C. C. (2001) Genes Dev. 15, 2687-2701[Abstract/Free Full Text]
  38. Chen, D., Ma, H., Hong, H., Koh, S. S., Huang, S. M., Schurter, B. T., Aswad, D. W., and Stallcup, M. R. (1999) Science 284, 2174-2177[Abstract/Free Full Text]
  39. Glass, C. K., and Rosenfeld, M. G. (2000) Genes Dev. 14, 121-141[Free Full Text]
  40. Rachez, C., Suldan, Z., Ward, J., Chang, C. P., Burakov, D., Erdjument-Bromage, H., Tempst, P., and Freedman, L. P. (1998) Genes Dev. 12, 1787-1800[Abstract/Free Full Text]
  41. Murayama, A., Kim, M. S., Yanagisawa, J., Takeyama, K., and Kato, S. (2004) EMBO J. 23, 1598-1608[CrossRef][Medline] [Order article via Infotrieve]
  42. Chen, Z., Torrens, J. I., Anand, A., Spiegelman, B. M., and Friedman, J. M. (2005) Cell Metab. 1, 93-106[CrossRef][Medline] [Order article via Infotrieve]
  43. Hollenberg, A. N., Monden, T., and Wondisford, F. E. (1995) J. Biol. Chem. 270, 14274-14280[Abstract/Free Full Text]
  44. Langlois, M. F., Zanger, K., Monden, T., Safer, J. D., Hollenberg, A. N., and Wondisford, F. E. (1997) J. Biol. Chem. 272, 24927-24933[Abstract/Free Full Text]
  45. Satoh, T., Yamada, M., Iwasaki, T., and Mori, M. (1996) J. Biol. Chem. 271, 27919-27926[Abstract/Free Full Text]
  46. Hamm, J. K., Park, B. H., and Farmer, S. R. (2001) J. Biol. Chem. 276, 18464-18471[Abstract/Free Full Text]
  47. Zhang, J., Hug, B. A., Huang, E. Y., Chen, C. W., Gelmetti, V., Maccarana, M., Minucci, S., Pelicci, P. G., and Lazar, M. A. (2001) Mol. Cell. Biol. 21, 156-163[Abstract/Free Full Text]
  48. Dhawan, P., Peng, X., Sutton, A. L., MacDonald, P. N., Croniger, C. M., Trautwein, C., Centrella, M., McCarthy, T. L., and Christakos, S. (2005) Mol. Cell. Biol. 25, 472-487[Abstract/Free Full Text]
  49. Kong, J., and Li, Y. C. (2005) Am. J. Physiol., in press

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
K. E. Wong, F. L. Szeto, W. Zhang, H. Ye, J. Kong, Z. Zhang, X. J. Sun, and Y. C. Li
Involvement of the vitamin D receptor in energy metabolism: regulation of uncoupling proteins
Am J Physiol Endocrinol Metab, April 1, 2009; 296(4): E820 - E828.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
C. J. Narvaez, D. Matthews, E. Broun, M. Chan, and J. Welsh
Lean Phenotype and Resistance to Diet-Induced Obesity in Vitamin D Receptor Knockout Mice Correlates with Induction of Uncoupling Protein-1 in White Adipose Tissue
Endocrinology, February 1, 2009; 150(2): 651 - 661.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
R. Bouillon, G. Carmeliet, L. Verlinden, E. van Etten, A. Verstuyf, H. F. Luderer, L. Lieben, C. Mathieu, and M. Demay
Vitamin D and Human Health: Lessons from Vitamin D Receptor Null Mice
Endocr. Rev., October 1, 2008; 29(6): 726 - 776.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/16/11205    most recent
M510343200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blumberg, J. M.
Right arrow Articles by Hollenberg, A. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blumberg, J. M.
Right arrow Articles by Hollenberg, A. N.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement